Antiviral Activity of Porcine IFN-λ3 and IFN-α against Porcine Rotavirus In Vitro
Abstract
:Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Xie, J.; Bi, Y.; Xu, S.; Han, Y.; Idris, A.; Zhang, H.; Li, X.; Bai, J.; Zhang, Y.; Feng, R. Host antiviral protein IFITM2 restricts pseudorabies virus replication. Virus Res. 2020, 287, 198105. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Arslan, M.; Liu, X.; Song, H.; Du, M.; Li, Y.; Zhang, Z. IFN-γ establishes interferon-stimulated gene-mediated antiviral state against Newcastle disease virus in chicken fibroblasts. Acta Biochim. Biophys. Sin. 2020, 52, 268–280. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, S.; Fang, P.; Ke, W.; Wang, J.; Wang, X.; Xiao, S.; Fang, L. Porcine deltacoronavirus (PDCoV) infection antagonizes interferon-λ1 production. Vet. Microbiol. 2020, 247, 108785. [Google Scholar] [CrossRef] [PubMed]
- Kotenko, S.V.; Gallagher, G.; Baurin, V.V.; Lewis-Antes, A.; Shen, M.; Shah, N.K.; Langer, J.A.; Sheikh, F.; Dickensheets, H.; Donnelly, R.P. IFN-λs mediate antiviral protection through a distinct class II cytokine receptor complex. Nat. Immunol. 2003, 4, 69–77. [Google Scholar] [CrossRef] [PubMed]
- Kotenko, S.V.; Rivera, A.; Parker, D.; Durbin, J.E. Type III IFNs: Beyond antiviral protection. Semin. Immunol. 2019, 43, 101303. [Google Scholar] [CrossRef] [PubMed]
- Zanoni, I.; Granucci, F.; Broggi, A. Interferon (IFN)-λ takes the helm: Immunomodulatory roles of type III IFNs. Front. Immunol. 2017, 8, 1661. [Google Scholar] [CrossRef] [PubMed]
- Fan, W.; Jiao, P.; Zhang, H.; Chen, T.; Zhou, X.; Qi, Y.; Sun, L.; Shang, Y.; Zhu, H.; Hu, R.; et al. Inhibition of African swine fever virus replication by porcine type I and type II interferons. Front. Microbiol. 2020, 11, 1203. [Google Scholar] [CrossRef] [PubMed]
- Rojas, J.M.; Alejo, A.; Martín, V.; Sevilla, N. Viral pathogen-induced mechanisms to antagonize mammalian interferon (IFN) signaling pathway. Cell Mol. Life Sci. 2021, 78, 1423–1444. [Google Scholar] [CrossRef] [PubMed]
- Stanifer, M.L.; Pervolaraki, K.; Boulant, S. Differential Regulation of Type I and Type III Interferon Signaling. Int. J. Mol. Sci. 2019, 20, 1445. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lazear, H.M.; Schoggins, J.W.; Diamond, M.S. Shared and Distinct Functions of Type I and Type III Interferons. Immunity 2019, 50, 907–923. [Google Scholar] [CrossRef] [PubMed]
- Stanifer, M.L.; Guo, C.; Doldan, P.; Boulant, S. Importance of Type I and III Interferons at Respiratory and Intestinal Barrier Surfaces. Front. Immunol. 2020, 11, 608645. [Google Scholar] [CrossRef]
- Ank, N.; West, H.; Bartholdy, C.; Eriksson, K.; Thomsen, A.R.; Paludan, S.R. Lambda interferon (IFN-lambda), a type III IFN, is induced by viruses and IFNs and displays potent antiviral activity against select virus infections in vivo. J. Virol. 2006, 80, 4501–4509. [Google Scholar] [CrossRef] [Green Version]
- Molinari, B.L.D.; Possatti, F.; Lorenzetti, E.; Alfieri, A.F.; Alfieri, A.A. Unusual outbreak of post-weaning porcine diarrhea caused by single and mixed infections of rotavirus groups A, B, C, and H. Vet. Microbiol. 2016, 193, 125–132. [Google Scholar] [CrossRef]
- Homwong, N.; Diaz, A.; Rossow, S.; Ciarlet, M.; Marthaler, D. Three-level mixed-effects logistic regression analysis reveals complex epidemiology of swine rotaviruses in diagnostic samples from North America. PLoS ONE 2016, 11, e0154734. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frias, A.H.; Vijay-Kumar, M.; Jones, R.; Gentsch, J.R.; Estes, M.K.; Gewirtz, A.T. Intestinal epithelia activate anti-viral signaling via intracellular sensing of rotavirus structural components. Mucosal Immunol. 2010, 3, 622–632. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, F.; Li, G.; Wen, K.; Bui, T.; Cao, D.; Zhang, Y.; Yuan, L. Porcine small intestinal epithelial cell line (IPEC-J2) of rotavirus infection as a new model for the study of innate immune responses to rotaviruses and probiotics. Viral Immunol. 2010, 23, 135–149. [Google Scholar] [CrossRef] [PubMed]
- Tian, G.; Liang, X.; Chen, D.; Mao, X.; Yu, J.; Zheng, P.; He, J.; Huang, Z.; Yu, B. Vitamin D3 supplementation alleviates rotavirus infection in pigs and IPEC-J2 cells via regulating the autophagy signaling pathway. J. Steroid Biochem. Mol. Biol. 2016, 163, 157–163. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Zhu, L.; Xu, L.; Huang, J.; Sun, X.; Xu, Z. Porcine interferon lambda 3 (IFN-λ3) shows potent anti-PRRSV activity in primary porcine alveolar macrophages (PAMs). BMC Vet. Res. 2020, 16, 408. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Fu, F.; Xue, M.; Chen, W.; Liu, J.; Shi, H.; Chen, J.; Bu, Z.; Feng, L.; Liu, P. IFN-lambda preferably inhibits PEDV infection of porcine intestinal epithelial cells compared with IFN-alpha. Antivir. Res. 2017, 140, 76–82. [Google Scholar] [CrossRef] [PubMed]
- Saeng-Chuto, K.; Madapong, A.; Kaeoket, K.; Piñeyro, P.E.; Tantituvanont, A.; Nilubol, D. Co-infection of porcine deltacoronavirus and porcine epidemic diarrhea virus prolongs virus shedding and IFN-α up-regulation. Asian Pig Vet. Soc. Congr. 2019, 11, 3040. [Google Scholar] [CrossRef]
Gene Name | Primer Name | Sequence (5′–3′) | Product Size (bp) |
---|---|---|---|
VP6 | VP6-F | TTCGGATTACTTGGCACTA | 118 |
VP6-R | TAGCCATTTCATCCATACAC | ||
ISG15 | ISG15-F | ACAAGGGTCGCAGCAACGC | 192 |
ISG15-R | GCAGATTCATATACACGGTG | ||
MxA | MxA-F | GATGAAAGCGGGAAGATG | 119 |
MxA-R | TTGGTAAACAGCCGACAC | ||
OASL | OASL-F | TCCTTCGCCAAGTTACAG | 136 |
OASL-R | CATAGAGAGGGGGCAGCC | ||
β-actin | β-actin-F | ATCGTGCGGGACATCAAG | 179 |
β-actin-R | GGAAGGAGGGCTGGAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Deng, L.; Yin, Y.; Xu, Z.; Li, F.; Zhao, J.; Deng, H.; Jian, Z.; Lai, S.; Sun, X.; Zhu, L. Antiviral Activity of Porcine IFN-λ3 and IFN-α against Porcine Rotavirus In Vitro. Molecules 2022, 27, 4575. https://doi.org/10.3390/molecules27144575
Deng L, Yin Y, Xu Z, Li F, Zhao J, Deng H, Jian Z, Lai S, Sun X, Zhu L. Antiviral Activity of Porcine IFN-λ3 and IFN-α against Porcine Rotavirus In Vitro. Molecules. 2022; 27(14):4575. https://doi.org/10.3390/molecules27144575
Chicago/Turabian StyleDeng, Lishuang, Yue Yin, Zhiwen Xu, Fengqin Li, Jun Zhao, Huidan Deng, Zhijie Jian, Siyuan Lai, Xiangang Sun, and Ling Zhu. 2022. "Antiviral Activity of Porcine IFN-λ3 and IFN-α against Porcine Rotavirus In Vitro" Molecules 27, no. 14: 4575. https://doi.org/10.3390/molecules27144575
APA StyleDeng, L., Yin, Y., Xu, Z., Li, F., Zhao, J., Deng, H., Jian, Z., Lai, S., Sun, X., & Zhu, L. (2022). Antiviral Activity of Porcine IFN-λ3 and IFN-α against Porcine Rotavirus In Vitro. Molecules, 27(14), 4575. https://doi.org/10.3390/molecules27144575