Dipterocarpus tuberculatus Roxb. Ethanol Extract Has Anti-Inflammatory and Hepatoprotective Effects In Vitro and In Vivo by Targeting the IRAK1/AP-1 Pathway
Abstract
1. Introduction
2. Results
2.1. Effects of Dt-EE on Pro-Inflammatory Cytokines at a Trascriptional Level
2.2. Effects of Dt-EE on the Activation of the AP-1 and CREB Pathways
2.3. Effects of Dt-EE on the Enzyme Activity of IRAK1 and Regulation of the AP-1 Pathway
2.4. Effect of Dt-EE in an In Vivo Hepatitis Model in Mice
3. Discussion
4. Materials and Methods
4.1. Materials and Reagents
4.2. Cell Culture
4.3. Animals
4.4. Enzyme-Linked Immunosorbent Assay (ELISA)
4.5. mRNA Analysis Using Quantitative Real-time Polymerase Chain Reaction (PCR)
4.6. Plasmid Transfection and Luciferase Reporter Gene Activity Assay
4.7. Nuclear Fraction, Western Blotting Analysis, and Immunoprecipitation
4.8. IRAK1 and IRAK4 Kinase Assay
4.9. LPS/D-Galactosamine-Induced Hepatitis Mouse Model
4.10. Histopathology
4.11. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Delves, P.J.; Roitt, I.M. The immune system. New Engl. J. Med. 2000, 343, 37–49. [Google Scholar] [CrossRef]
- Murakami, M.; Hirano, T. The molecular mechanisms of chronic inflammation development. Front. Immunol. 2012, 3, 323. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Yi, Y.S.; Kim, M.Y.; Cho, J.Y. Role of ginsenosides, the main active components of Panax ginseng, in inflammatory responses and diseases. J. Ginseng Res. 2017, 41, 435–443. [Google Scholar] [CrossRef]
- De Martel, C.; Franceschi, S. Infections and cancer: Established associations and new hypotheses. Crit. Rev. Oncol. Hematol. 2009, 70, 183–194. [Google Scholar] [CrossRef] [PubMed]
- Xue, Q.; He, N.; Wang, Z.; Fu, X.; Aung, L.H.H.; Liu, Y.; Li, M.; Cho, J.Y.; Yang, Y.; Yu, T. Functional roles and mechanisms of ginsenosides from Panax ginseng in atherosclerosis. J. Ginseng Res. 2021, 45, 22–31. [Google Scholar] [CrossRef] [PubMed]
- Gregory, C.D.; Devitt, A. The macrophage and the apoptotic cell: An innate immune interaction viewed simplistically? Immunology 2004, 113, 1–14. [Google Scholar] [CrossRef]
- Janeway, C.A., Jr.; Medzhitov, R. Innate immune recognition. Annu. Rev. Immunol. 2002, 20, 197–216. [Google Scholar] [CrossRef]
- Yu, T.; Wang, Z.; Jie, W.; Fu, X.; Li, B.; Xu, H.; Liu, Y.; Li, M.; Kim, E.; Yang, Y.; et al. The kinase inhibitor BX795 suppresses the inflammatory response via multiple kinases. Biochem. Pharm. 2020, 174, 113797. [Google Scholar] [CrossRef]
- Callol, A.; Roher, N.; Amaro, C.; MacKenzie, S. Characterization of PAMP/PRR interactions in European eel (Anguilla anguilla) macrophage-like primary cell cultures. Fish Shellfish Immunol. 2013, 35, 1216–1223. [Google Scholar] [CrossRef]
- Takeda, K.; Akira, S. TLR Signaling Pathways, Seminars in Immunology; Elsevier: Amsterdam, The Netherlands, 2004; pp. 3–9. [Google Scholar]
- Lee, J.O.; Choi, E.; Shin, K.K.; Hong, Y.H.; Kim, H.G.; Jeong, D.; Hossain, M.A.; Kim, H.S.; Yi, Y.S.; Kim, D.; et al. Compound K, a ginsenoside metabolite, plays an antiinflammatory role in macrophages by targeting the AKT1-mediated signaling pathway. J. Ginseng Res. 2019, 43, 154–160. [Google Scholar] [CrossRef]
- Bai, B.; Yang, Y.; Wang, Q.; Li, M.; Tian, C.; Liu, Y.; Aung, L.H.H.; Li, P.F.; Yu, T.; Chu, X.M. NLRP3 inflammasome in endothelial dysfunction. Cell Death Dis. 2020, 11, 776. [Google Scholar] [CrossRef] [PubMed]
- Libby, P.; Ridker, P.M.; Maseri, A. Inflammation and atherosclerosis. Circulation 2002, 105, 1135–1143. [Google Scholar] [CrossRef] [PubMed]
- Johnson, G.L.; Lapadat, R. Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science 2002, 298, 1911–1912. [Google Scholar] [CrossRef]
- Lorz, L.R.; Kim, D.; Kim, M.Y.; Cho, J.Y. Panax ginseng-derived fraction BIOGF1K reduces atopic dermatitis responses via suppression of mitogen-activated protein kinase signaling pathway. J. Ginseng Res. 2020, 44, 453–460. [Google Scholar] [CrossRef]
- Kleinert, H.; Wallerath, T.; Fritz, G.; Ihrig-Biedert, I.; Rodriguez-Pascual, F.; Geller, D.A.; Forstermann, U. Cytokine induction of NO synthase II in human DLD-1 cells: Roles of the JAK-STAT, AP-1 and NF-κB-signaling pathways. Br. J. Pharmacol. 1998, 125, 193–201. [Google Scholar] [CrossRef] [PubMed]
- Rho, T.; Jeong, H.W.; Hong, Y.D.; Yoon, K.; Cho, J.Y.; Yoon, K.D. Identification of a novel triterpene saponin from Panax ginseng seeds, pseudoginsenoside RT8, and its antiinflammatory activity. J. Ginseng Res. 2020, 44, 145–153. [Google Scholar] [CrossRef]
- Zhang, J.-M.; An, J. Cytokines, inflammation and pain. Int. Anesthesiol. Clin. 2007, 45, 27. [Google Scholar] [CrossRef]
- Devi, A.S.; Yadava, P. Wood and leaf litter decomposition of Dipterocarpus tuberculatus Roxb. in a tropical deciduous forest of Manipur. Curr. Sci. 2007, 93. [Google Scholar]
- Surapinit, S.; Jong-aramruang, J.; Siripong, P.; Khumkratok, S.; Tip-pyang, S. Dipterostilbenosides A and B, oligostilbene glycosides from Dipterocarpus tuberculatus. Nat. Prod. Commun. 2014, 9, 1323–1326. [Google Scholar] [CrossRef]
- Takahashi, M.; Fuchino, H.; Satake, M.; Agatsuma, Y.; Sekita, S. In vitro screening of leishmanicidal activity in Myanmar timber extracts. Biol. Pharm. Bull. 2004, 27, 921–925. [Google Scholar] [CrossRef]
- Khare, C.P. Indian Medicinal Plants: An Illustrated Dictionary; Springer Science & Business Media: Berlin, Germany, 2008. [Google Scholar]
- Seo, E.-K.; Kinghorn, A.D. Bioactive Constituents of the Family Differocarpaceae, Studies in Natural Products Chemistry; Elsevier: Amsterdam, The Netherlands, 2000; pp. 531–561. [Google Scholar]
- Yang, W.S.; Lee, B.-H.; Kim, S.H.; Kim, H.G.; Yi, Y.-S.; Htwe, K.M.; Kim, Y.-D.; Yoon, K.D.; Hong, S.; Lee, W.-S.; et al. Dipterocarpus tuberculatus ethanol extract strongly suppresses in vitro macrophage-mediated inflammatory responses and in vivo acute gastritis. J. Ethnopharmacol. 2013, 146, 873–880. [Google Scholar] [CrossRef] [PubMed]
- Misra, U.K.; Pizzo, S.V. Coordinate rgulation of frskolin-induced cllular poliferation in mcrophages by potein knase A/cAMP-response eement-binding potein (CREB) and Epac1-Rap1 sgnaling: Effects of silencing CREB gene expression on Akt activation. J. Biol. Chem. 2005, 280, 38276–38289. [Google Scholar] [CrossRef]
- Weston, C.R.; Davis, R.J. The JNK signal transduction pathway. Curr. Opin. Cell Biol. 2007, 19, 142–149. [Google Scholar] [CrossRef]
- Burns, K.; Janssens, S.; Brissoni, B.; Olivos, N.; Beyaert, R.; Tschopp, J.r. Inhibition of interleukin 1 receptor/toll-like receptor signaling through the alternatively spliced, short form of MyD88 is due to its failure to recruit IRAK-4. J. Exp. Med. 2003, 197, 263–268. [Google Scholar] [CrossRef] [PubMed]
- Galanos, C.; Freudenberg, M.A.; Reutter, W. Galactosamine-induced sensitization to the lethal effects of endotoxin. Proc. Natl. Acad. Sci. 1979, 76, 5939–5943. [Google Scholar] [CrossRef]
- Wang, H.; Xu, D.-X.; Lv, J.-W.; Ning, H.; Wei, W. Melatonin attenuates lipopolysaccharide (LPS)-induced apoptotic liver damage in D-galactosamine-sensitized mice. Toxicology 2007, 237, 49–57. [Google Scholar] [CrossRef] [PubMed]
- Eipel, C.; Kidess, E.; Abshagen, K.; Leminh, K.; Menger, M.; Burkhardt, H.; Vollmar, B. Antileukoproteinase protects against hepatic inflammation, but not apoptosis in the response of D-galactosamine-sensitized mice to lipopolysaccharide. Br. J. Pharmacol. 2007, 151, 406–413. [Google Scholar] [CrossRef]
- Giannini, E.; Botta, F.; Fasoli, A.; Ceppa, P.; Risso, D.; Lantieri, P.B.; Celle, G.; Testa, R. Progressive liver functional impairment is associated with an increase in AST/ALT ratio. Dig. Dis. Sci. 1999, 44, 1249–1253. [Google Scholar] [CrossRef]
- Lee, K.K.; Choi, J.D. The effects of Areca catechu L extract on anti-inflammation and anti-melanogenesis. Int. J. Cosmet. Sci. 1999, 21, 275–284. [Google Scholar] [CrossRef]
- Sripanidkulchai, B.; Junlatat, J. Bioactivities of alcohol based extracts of Phyllanthus emblica branches: Antioxidation, antimelanogenesis and anti-inflammation. J. Nat. Med. 2014, 68, 615–622. [Google Scholar] [CrossRef]
- Peng, C.-H.; Su, J.-D.; Chyau, C.-C.; Sung, T.-Y.; Ho, S.-S.; Peng, C.-C.; Peng, R.Y. Supercritical fluid extracts of rosemary leaves exhibit potent anti-inflammation and anti-tumor effects. Biosci. Biotechnol. Biochem. 2007, 71, 2223–2232. [Google Scholar] [CrossRef] [PubMed]
- Loffreda, S.; Yang, S.; Lin, H.; Karp, C.; Brengman, M.L.; Wang, D.; Klein, A.; Bulkley, G.B.; Bao, C.; Noble, P. Leptin regulates proinflammatory immune responses. FASEB J. 1998, 12, 57–65. [Google Scholar] [CrossRef]
- Cui, W.; Xiao, N.; Xiao, H.; Zhou, H.; Yu, M.; Gu, J.; Li, X. β-TrCP-mediated IRAK1 degradation releases TAK1-TRAF6 from the membrane to the cytosol for TAK1-dependent NF-κB activation. Mol. Cell. Biol. 2012, 32, 3990–4000. [Google Scholar] [CrossRef]
- Bernal, W.; Wendon, J. Acute liver failure. New Engl. J. Med. 2013, 369, 2525–2534. [Google Scholar] [CrossRef]
- Hyeon, C.K.; Chung, M.N.; Sun, H.J.; Kwang, H.H.; Oh, D.K.; Suh, I. Normal serum aminotransferase concentration and risk of mortality from liver diseases: Prospective cohort study. BMJ 2004, 328, 983. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.J.; Deok, J.; Kim, S.; Yoon, D.H.; Sung, G.-H.; Aravinthan, A.; Lee, S.; Lee, M.-N.; Hong, S.; Kim, J.-H.; et al. Anti-inflammatory effect of Piper attenuatum methanol extract in LPS-stimulated inflammatory responses. Evid. Based Complementary Altern. Med. 2017, 2017, 4606459. [Google Scholar] [CrossRef]
- Lee, J.O.; Kim, J.H.; Kim, S.; Kim, M.Y.; Hong, Y.H.; Kim, H.G.; Cho, J.Y. Gastroprotective effects of the nonsaponin fraction of Korean Red Ginseng through cyclooxygenase-1 upregulation. J. Ginseng Res. 2020, 44, 655–663. [Google Scholar] [CrossRef]
- Back, S.S.; Kim, J.; Choi, D.; Lee, E.S.; Choi, S.Y.; Han, K. Cooperative transcriptional activation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 genes by nuclear receptors including Liver-X-Receptor. BMB Rep. 2013, 46, 322. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.G.; Choi, S.; Lee, J.; Hong, Y.H.; Jeong, D.; Yoon, K.; Yoon, D.H.; Sung, G.-H.; Lee, S.; Hong, S.; et al. Src is a prime target inhibited by Celtis choseniana methanol extract in its anti-inflammatory action. Evid. Based Complementary Altern. Med. 2018, 2018, 3909038. [Google Scholar] [CrossRef]
- Choi, E.; Kim, E.; Kim, J.H.; Yoon, K.; Kim, S.; Lee, J.; Cho, J.Y. AKT1-targeted proapoptotic activity of compound K in human breast cancer cells. J. Ginseng Res. 2019, 43, 692–698. [Google Scholar] [CrossRef] [PubMed]
Gene | Direction | Sequences (5′ to 3′) |
---|---|---|
IL-1β | Forward Reverse | GTGAAATGCCACCTTTTGACAGTG CCTGCCTGAAGCTCTTGTTG |
TNF-α | Forward Reverse | TGCCTATGTCTCAGCCTCTT GAGGCCATTTGGGAACTTCT |
IL-6 | Forward Reverse | GACAAAGCCAGAGTCCTTCAGAGA CTAGGTTTGCCGAGTAGATCTC |
GAPDH | Forward Reverse | CACTCACGGCAAATTCAACGGCAC GACTCCACGACATACTCAGCAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, H.; Yang, W.S.; Htwe, K.M.; Lee, M.-N.; Kim, Y.-D.; Yoon, K.D.; Lee, B.-H.; Lee, S.; Cho, J.Y. Dipterocarpus tuberculatus Roxb. Ethanol Extract Has Anti-Inflammatory and Hepatoprotective Effects In Vitro and In Vivo by Targeting the IRAK1/AP-1 Pathway. Molecules 2021, 26, 2529. https://doi.org/10.3390/molecules26092529
Kim H, Yang WS, Htwe KM, Lee M-N, Kim Y-D, Yoon KD, Lee B-H, Lee S, Cho JY. Dipterocarpus tuberculatus Roxb. Ethanol Extract Has Anti-Inflammatory and Hepatoprotective Effects In Vitro and In Vivo by Targeting the IRAK1/AP-1 Pathway. Molecules. 2021; 26(9):2529. https://doi.org/10.3390/molecules26092529
Chicago/Turabian StyleKim, Haeyeop, Woo Seok Yang, Khin Myo Htwe, Mi-Nam Lee, Young-Dong Kim, Ki Dong Yoon, Byoung-Hee Lee, Sarah Lee, and Jae Youl Cho. 2021. "Dipterocarpus tuberculatus Roxb. Ethanol Extract Has Anti-Inflammatory and Hepatoprotective Effects In Vitro and In Vivo by Targeting the IRAK1/AP-1 Pathway" Molecules 26, no. 9: 2529. https://doi.org/10.3390/molecules26092529
APA StyleKim, H., Yang, W. S., Htwe, K. M., Lee, M.-N., Kim, Y.-D., Yoon, K. D., Lee, B.-H., Lee, S., & Cho, J. Y. (2021). Dipterocarpus tuberculatus Roxb. Ethanol Extract Has Anti-Inflammatory and Hepatoprotective Effects In Vitro and In Vivo by Targeting the IRAK1/AP-1 Pathway. Molecules, 26(9), 2529. https://doi.org/10.3390/molecules26092529