Laminarin Induces Defense Responses and Efficiently Controls Olive Leaf Spot Disease in Olive
Abstract
1. Introduction
2. Results
2.1. Disease Assessment and Control Efficacy
2.2. Defense-Genes Expression in Laminarin-Treated Non-Inoculated Plants
2.3. Defense-Genes’ Expression in Laminarin-Treated and Inoculated Plants
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Product Applications and Artificial Inoculations
4.3. Disease Assessment
4.4. RNA Extraction and Defense-Related Gene Expression in Laminarin-Treated Olive Plants
4.5. RNA Preparation
4.6. Quantification of Gene Expression Levels with RT-qPCR
4.7. Data Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Torres, M.; Pierantozzi, P.; Searles, P.M.; Rousseaux, M.C.; García-Inza, G.; Miserere, A.; Bodoira, R.; Contreras, C.; Maestri, D. Olive cultivation in the Southern Hemisphere: Flowering, water requirements and oil quality responses to new crop environments. Front. Plant Sci. 2017, 8, 1830. [Google Scholar] [CrossRef] [PubMed]
- IOC. General Description of Olive Growing in Greece. 2012. Available online: https://www.internationaloliveoil.org/wpcontent/uploads/2019/11ENGLISG_POLICY_GREECE-2012_OK.pdf (accessed on 22 January 2020).
- Grosso, G.; Marventano, S.; Yang, J.; Mickel, A.; Pajak, A.; Scalfi, L.; Galvano, F.; Kales, S.N. A comprehensive meta-analysis on evidence of Mediterranean diet and cardiovascular disease: Are individual components equal? Crit. Rev. Food. Sci. Nutr. 2017, 57, 3218–3232. [Google Scholar] [CrossRef] [PubMed]
- Farras, M.; Canyelles, M.; Fito, M.; Escola-Gil, J.C. Effects of Virgin olive oil and phenol-enriched virgin olive oils on lipoprotein atherogenicity. Nutrients 2020, 12, 601. [Google Scholar] [CrossRef]
- González-Domínguez, E.; Armengol, J.; Rossi, V. Biology and epidemiology of Venturia species affecting fruit crops: A review. Front. Plant Sci. 2017, 8, 1496. [Google Scholar] [CrossRef] [PubMed]
- Graniti, A. Olive scab: A review. EPPO Bull. 1993, 23, 377–384. [Google Scholar] [CrossRef]
- Teviotdale, B.L.; Sibbett, G.S.; Harper, D.H. Several Copper fungicides control olive leaf spot. Calif. Agric. 1989, 43, 30–31. [Google Scholar]
- Obanor, F.O.; Walter, M.; Jones, E.E.; Jaspers, M.V. Efficacy of systemic acquired resistance inducers in olive leaf spot management. Australas. Plant Pathol. 2013, 42, 163–168. [Google Scholar] [CrossRef]
- Roca, L.F.; Moral, J.; Viruega, J.R.; Ávila, A.; Oliveira, R.; Trapero, A. Copper fungicides in the control of olive diseases. Olea 2007, 26, 48–50. [Google Scholar]
- Durrant, W.E.; Dong, X. Systemic acquired resistance. Annu. Rev. Phytopathol. 2004, 42, 185–209. [Google Scholar] [CrossRef]
- Sandroni, M.; Liljeroth, E.; Mulugeta, T.; Alexandersson, E. Plant resistance inducers (PRIs): Perspectives for future disease management in the field. CAB Reviews 2020, 15, 1–10. [Google Scholar] [CrossRef]
- Hammerschmidt, R. Systemic acquired resistance. In Advances in Botanical Research; Van Loon, L.C., Ed.; Academic Press: New York, NY, USA, 2009; pp. 173–222. [Google Scholar]
- Llorens, E.; García-Agustín, P.; Lapeña, L. Advances in induced resistance by natural compounds: Towards new options for woody crop protection. Sci. Agric. 2017, 74, 90–100. [Google Scholar] [CrossRef]
- Gozzo, F.; Faoro, F. Systemic acquired resistance (50 years after discovery): Moving from the lab to the field. J. Agric. Food Chem. 2013, 61, 12473–12491. [Google Scholar] [CrossRef]
- Pieterse, C.M.J.; Van Loon, L.C. NPR1: The spider in the web of induced resistance signaling pathways. Curr. Opin. Plant Biol. 2004, 7, 456–464. [Google Scholar] [CrossRef] [PubMed]
- Alexandersson, E.; Mulugeta, T.; Lankinen, A.; Liljeroth, E.; Andreasson, E. Plant resistance inducers against pathogens in Solanaceae species-from molecular mechanisms to field application. Int. J. Mol. Sci. 2016, 17, 1673. [Google Scholar] [CrossRef] [PubMed]
- Walters, D.R.; Ratsep, J.; Havis, N.D. Controlling crop diseases using induced resistance: Challenges for the future. J. Exp. Bot. 2013, 64, 1263–1280. [Google Scholar] [CrossRef] [PubMed]
- Jamiołkowska, A. Natural compounds as elicitors of plant resistance against Diseases and new biocontrol strategies. Agronmy 2020, 10, 173. [Google Scholar] [CrossRef]
- Choi, M.-S.; Kim, W.; Lee, C.; Oh, C.-S. Harpins, Multifunctional Proteins Secreted by Gram-Negative Plant-Pathogenic Bacteria. MPMI 2013, 26, 1115–1122. [Google Scholar] [CrossRef]
- Ayed, H.B.; Hmidet, N.; Béchet, M.; Chollet, M.; Chataigné, G.; Leclère, V.; Jacques, P.; Nasri, M. Identification and biochemical characteristics of lipopeptides from Bacillus mojavensis A21. Process Biochem. 2014, 4, 1699–1707. [Google Scholar] [CrossRef]
- Cao, Y.; Xu, Z.; Ling, N.; Yuan, Y.; Yang, X.; Chen, L.; Shen, B.; Shen, Q. Isolation and identification of lipopeptides produced by B. subtilis SQR 9 for suppressing Fusarium wilt of cucumber. Sci. Hortic. 2012, 135, 32–39. [Google Scholar] [CrossRef]
- Shafi, J.; Tian, H.; Ji, M. Bacillus species as versatile weapons for plant pathogens: A review. Biotechnol. Biotechnol. Equip. 2017, 31, 446–459. [Google Scholar] [CrossRef]
- Salman, M. Biological control of Spilocaea oleagina, the causal agent of olive leaf spot disease, using antagonistic bacteria. J. Plant Pathol. 2017, 99, 741–744. [Google Scholar]
- Vitanovic, E. Use of Cu fungicides in vineyards and olive groves. In Fungicides for Plant and Animal Diseases; Dhanasekaran, D., Ed.; InTech: London, UK, 2012; ISBN 978-953-307-804-5. Available online: http://www.intechopen.com/books/fungicides-for-plant-and-animal-diseases/use-of-cu-fungicides-in-vineyards-and-olive-grov (accessed on 17 November 2020).
- Moral, J.; Agustí-Brisach, C.; Agalliu, G.; de Oliveira, R.; Pérez-Rodríguez, M.; Roca, L.F.; Romero, J.; Trapero, A. Preliminary selection and evaluation of fungicides and natural compounds to control olive anthracnose caused by Colletotrichum species. Crop Prot. 2018, 114, 167–176. [Google Scholar] [CrossRef]
- Viruega, J.R.; Roca, L.F.; Moral, J.; Trapero, A. Factors affecting infection and disease development on olive leaves inoculated with Fusicladium oleagineum. Plant Dis. 2011, 95, 1139–1146. [Google Scholar] [CrossRef][Green Version]
- Salah, I.B.; Aghrouss, S.; Douira, A.; Aissam, S.; El Alaoui-Talibi, Z.; Filafi-Maltou, A.; El Modafar, C. Seaweed polysaccharides as bio-elicitors of natural defenses in olive trees against verticillium wilt of olive. J. Plant Inter. 2018, 13, 248–255. [Google Scholar]
- Aziz, A.; Poinssot, B.; Daire, X.; Adrian, M.; Bézier, A.; Lambert, B.; Joubert, J.-M.; Pugin, A. Laminarin elicits defense responses in grapevine and induces protection against Botrytis cinerea and Plasmopara viticola. MPMI 2003, 16, 1118–1128. [Google Scholar] [CrossRef]
- Trouvelot, S.; Varnier, A.L.; Allegre, M.; Mercier, L.; Baillieul, F.; Arnould, C.; Gianinazzi-Pearson, V.; Klarzynski, O.; Joubert, J.M.; Pugin, A.; et al. A β-1,3 glucan sulfate induces resistance in grapevine against Plasmopara viticola through priming of defense responses, including HR-like cell death. MPMI 2008, 21, 232–243. [Google Scholar] [CrossRef]
- da Silva, J.M.; Medeiros, M.D.; Oliveira, J.T.; de Medeiros, E.V.; de Souza-Motta, C.M.; Moreira, K.A. Resistance inducers and biochemical mechanisms in the control of anthracnose in cowpea. Cienc. Inv. Agr. 2018, 45, 290–300. [Google Scholar] [CrossRef]
- Huang, Z.; Carter, N.; Lu, H.; Zhang, Z.; Wang-Pruski, G. Translocation of phosphite encourages the protection against Phytophthora infestans in potato: The efficiency and efficacy. Pestic. Biochem. Physiol. 2018, 152, 122–130. [Google Scholar] [CrossRef]
- Marolleau, B.; Gaucher, M.; Heintz, C.; Degrave, A.; Warneys, R.; Orain, G.; Lemarquand, A.; Brisset, M.-N. When a plant resistance inducer leaves the lab for the field: Integrating ASM into routine apple protection practices. Front. Plant Sci. 2017, 8, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Percival, G.C.; Noviss, K.; Haynes, I. Field evaluation of systemic inducing resistance chemicals at different growth stages for the control of apple (Venturia inaequalis) and pear (Venturia pirina) scab. Crop Prot. 2009, 28, 629–633. [Google Scholar] [CrossRef]
- Compant, S.; Duffy, B.; Nowak, J.; Clement, C.; Barka, E.A. Use of plant growth promoting bacteria for biocontrol of plant diseases: Principles, mechanisms of action, and future prospects. Appl. Environ. Microbiol. 2005, 71, 4951–4959. [Google Scholar] [CrossRef] [PubMed]
- Khan, N.; Mishra, A.; Nautiyal, C.S. Paenibacillus lentimorbus B-30488r controls early blight disease in tomato by inducing host resistance associated gene expression and inhibiting Alternaria solani. Biol. Cont. 2012, 62, 65–74. [Google Scholar] [CrossRef]
- Khan, N.; Martínez-Hidalgo, P.; Ice, T.A.; Maymon, M.; Humm, E.A.; Nejat, N.; Sanders, E.R.; Kaplan, D.; Hirsch, A.M. Antifungal activity of Bacillus species against Fusarium and analysis of the potential mechanisms used in biocontrol. Front. Microbiol. 2018, 9, 2363. [Google Scholar] [CrossRef]
- Chowdhury, S.P.; Hartmann, A.; Gao, X.W.; Borriss, R. Biocontrol mechanism by root-associated Bacillus amyloliquefaciens FZB42—a review. Front. Microbiol. 2015, 6, 780. [Google Scholar] [CrossRef] [PubMed]
- Bardin, M.; Ajouz, S.; Comby, M.; Lopez-Ferber, M.; Graillot, B.; Siegwart, M.C.; Nicot, P.C. Is the efficacy of biological control against plant diseases likely to be more durable than that of chemical pesticides? Front. Plant Sci. 2015, 6, 566. [Google Scholar] [CrossRef]
- Samaras, A.; Nikolaidis, M.; Antequera-Gómez, M.L.; Cámara-Almirón, J.; Romero, D.; Moschakis, T.; Amoutzias, G.D.; Karaoglanidis, G.S. Whole genome sequencing and root colonization studies reveal novel insights in the biocontrol potential and growth promotion by Bacillus subtilis MBI 600 on cucumber. Front. Microbiol. 2021, 11, 3437. [Google Scholar] [CrossRef] [PubMed]
- Rhouma, A.; Chettaoui, M.; Krid, S.; Elbisir, H.; Msallem, M.; Triki, M.A. Evaluation of susceptibility of an olive progeny (Picholine x Meski) to olive leaf spot disease caused by Fusicladium oleagineum. Eur. J. Plant Pathol. 2013, 135, 23–33. [Google Scholar] [CrossRef][Green Version]
- Zine El Aabidine, A.; Baissac, Y.; Moukhli, A.; Jay-Allemand, C.; Khadari, B.; El Modafar, C. Resistance of olive-tree to Spilocaea oleagina is mediated by the synthesis of phenolic compounds. Int. J. Agric. Biol. 2010, 12, 61–67. [Google Scholar]
- Bulotta, S.; Celano, M.; Lepore, S.M.; Montalcini, T.; Pujia, A.; Diego Russo, D. Beneficial effects of the olive oil phenolic components oleuropein and ydroxytyrosol: Focus on protection against cardiovascular and metabolic diseases. J. Transl. Med. 2014, 12, 219. [Google Scholar] [CrossRef]
- Ma, L.; He, J.; Liu, H.; Zhou, H. The phenylpropanoid pathway affects apple fruit resistance to Botrytis cinerea. J. Phytopath. 2018, 166, 206–215. [Google Scholar] [CrossRef]
- Tavladoraki, P.; Cona, A.; Angelini, R. Copper-containing amine oxidases and FAD-dependent polyamine oxidases are key players in plant tissue differentiation and organ development. Front. Plant Sci. 2016, 7, 824. [Google Scholar] [CrossRef] [PubMed]
- Alagna, F.; Mariotti, R.; Panara, F.; Caporali, S.; Urbani, S.; Veneziani, G.; Esposto, S.; Taticchi, A.; Rosati, A.; Rao, R.; et al. Olive phenolic compounds: Metabolic and transcriptional profiling during fruit development. BMC Plant Biol. 2012, 12, 162. [Google Scholar] [CrossRef]
- Servili, M.; Selvaggini, R.; Esposto, S.; Taticchi, A.; Montedoro, G.; Morozzi, G. Health nad sensory properties of virgin oil hydrophilic phenols: Agronomic and technological aspects of production that affect their occurrence in the oil. J. Chromatogr. 2004, 1054, 113–127. [Google Scholar] [CrossRef]
- Hoj, P.B.; Fincher, G.B. Molecular evolution of β-glucan endohydrolases. Plant. J. 1995, 7, 367–379. [Google Scholar] [CrossRef] [PubMed]
- Klarzynski, O.; Plesse, B.; Joubert, J.-M.; Yvin, J.-C.; Kopp, M.; Kloareg, B.; Fritig, B. Linear β-1,3 glucans are elicitors of defense responses in tobacco. Plant Physiol. 2000, 124, 1027–1038. [Google Scholar] [CrossRef] [PubMed]
- Cardinale, F.; Jonak, C.; Wilco Ligterink, W.; Niehausi, K.; Boller, T.; Hirt, H. Differential Activation of Four Specific MAPK Pathways by distinct elicitors. J. Biol./Chem. 2000, 275, 36734–36740. [Google Scholar] [CrossRef]
- Wu, Y.R.; Lin, Y.C.; Chuang, H.W. Laminarin modulates the chloroplast antioxidant system to enhance abiotic stress tolerance partially through the regulation of the defensin-like gene expression. Plant Sci. 2016, 247, 83–92. [Google Scholar] [CrossRef] [PubMed]
- Benitez, Y.; Botella, M.A.; Trapero, A.; Alsalimiya, M.; Caballero, J.L.; Dorado, G.; Munoz-Blanco, J. Molecular analysis of the interaction between Olea europaea and the biotrophic fungus Spilocaea oleagina. Mol. Plant Pathol. 2005, 6, 425–438. [Google Scholar] [CrossRef]
- Héloir, M.-C.; Adrian, M.; Brulé, D.; Claverie, J.; Cordelier, S.; Daire, X.; Dorey, S.; Gauthier, A.; Lemaître-Guillier, C.; Negrel, J.; et al. Recognition of elicitors in grapevine: From MAMP and DAMP perception to induced resistance. Front. Plant Sci. 2019, 10, 1117. [Google Scholar] [CrossRef]
- Min, D.; Li, F.; Zhang, X.; Shu, P.; Cui, X.; Dong, L.; Ren, C.; Meng, D.; Li, J. Effect of methyl salicylate in combination with 1-methylcyclopropene on postharvest quality and decay caused by Botrytis cinerea in tomato fruit. J. Sci. Food Agric. 2018, 98, 3815–3822. [Google Scholar] [CrossRef]
- Xin, Z.; Cai, X.; Chen, S.; Luo, Z.; Bian, L.; Li, Z.; Ge, L.; Chen, Z. A disease resistance elicitor laminarin enhances tea defense against a piercing herbivore Empoasca (Matsumurasca) onukii Matsuda. Sci. Rep. 2019, 9, 814. [Google Scholar] [CrossRef] [PubMed]
- Marcos, R.; Izquierdo, Y.; Vellosillo, T.; Kulasekaran, S.; Cascón, T.; Hamberg, M.; Castresana, C. 9-Lipoxygenase-derived oxylipins activate brassinosteroid signaling to promote cell wall-based defense and limit pathogen infection. Plant Physiol. 2015, 169, 2324–2334. [Google Scholar] [CrossRef] [PubMed]
- Moschou, P.N.; Wu, J.; Cona, A.; Tavladoraki, P.; Angelini, R.; Roubelakis-Angelakis, K.A. The polyamines and their catabolic products are significant players in the turnover of nitrogenous molecules in plants. J. Exp. Bot. 2012, 63, 5003–5015. [Google Scholar] [CrossRef]
- Smirnoff, N.; Arnaud, D. Hydrogen peroxide metabolism and functions in plants. New Phytol. 2019, 221, 1197–1214. [Google Scholar] [CrossRef]
- Huecas, S.; Villalba, M.; Rodríguez, R. Ole e 9, a major olive pollen allergen is a 1,3-β-glucanase: Isolation, characterization, amino acid sequence, and tissue specificity. J. Biol. Chem. 2001, 276, 27959–27966. [Google Scholar] [CrossRef] [PubMed]
- Sinha, M.; Singh, R.P.; Kushwaha, G.S.; Iqbal, N.; Singh, A.; Kaushik, S.; Kaur, P.; Sharma, S.; Singh, T.P. Current overview of allergens of plant pathogenesis related protein families. Sci. World J. 2014, 2014, 543195. [Google Scholar] [CrossRef] [PubMed]
- Saad, A.; Masri, S. Epidemiological studies on olive leaf spot incited by Spilocaea oleagina (Cast.) Hugh. Phytopathol. Mediterr. 1978, 17, 170–173. [Google Scholar]
- Obanor, F.O.; Walter, M.; Jones, E.E.; Jaspers, M.V. Effects of temperature, inoculum concentration, leaf age, and continuous and interrupted wetness on infection of olive plants by Spilocaea oleagina. Plant Pathol. 2011, 60, 190–199. [Google Scholar] [CrossRef]
- Civantos, M. Olive Pest and Disease Management; International Olive Oil Council: Madrid, Spain, 1999; pp. 151–175. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression using real-time quantitative PCR. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Active Ingredient | Commercial Name | Concentration Dose (L−1 Water) a | Supplier |
---|---|---|---|
acibenzolar-S-methyl | BION 50WG | 100 mg | Syngenta |
Bacillus amyloquefaciens FZB24 | Taegro 13WP | 2.11 g | Syngenta |
laminarin | Vacciplant 4.5SL | 1 mL | Arysta |
harpin | Proact WDG | 0.1 g | Κ&Ν Efthymiadis |
copper oxychloride | Cupravit 50WP | 2.6 g | Κ&Ν Efthymiadis |
copper oxide | Nordox 75WG | 1.7 g | Κ&Ν Efthymiadis |
Primer Name | Sequence (5′-3′) | Size (bp) | Gene | Reference | Accession Number |
---|---|---|---|---|---|
OePAL-F | AATGGGGAGCTTCATCCATCA | 155 | Phenylalanine ammonia-lyase (Pal) | [45] | JX266200 |
OePAL-R | AGAAATGTGGATGACATAAGCTTCA | ||||
OeCUAO-F | AAGATGGCCTTGGGAAGAAT | 191 | Copper amine oxidase (Cuao) | [45] | GQ851613 |
OeCUAO-R | TTCTGCCAATCCTGTTCTCC | ||||
OeALDH1-F | TTTAAGTGGGGAGCTCAAATACA | 200 | Putative alcohol dehydrogenase (Aldh1) | [45] | JX266197 |
OeALDH1-R | GATGCTTCAGATATTCCCATGC | ||||
BGLU-F | TTTCACGCGTTGGTAATCCG | 180 | Beta-1,3-glucanase (Bglu) | This study | AJ810085.1 |
BGLU-R | CAGCCTTTTCAAGTGCTGCA | ||||
Mpol-F | TGTTCCCCAACCTCCAGTTT | 186 | Major pollen allergen (Mpol) | This study | XM_023036359.1 |
Mpol-R | TCCTTCTGCTCTCGTGTAACC | ||||
LOX-F | CAAGCGAAACACCAGAACCA | 180 | 9-Lipoxygenase (Lox) | This study | EU678670.1 |
LOX-R | CCACGGATCCTCCAAGAACC | ||||
OlPhely-F | CAAAAGCCTAAACAAGATCG | 188 | Phenylalanine ammonia-lyase (Phely) | This study | XM_023030332.1 |
OlPhely-R | CAGGGGTGGCTTGAAAATTC | ||||
OlActin-F | GAGCGGGAAATTGTGAGAGA | 195 | Actin (actin) | This study | AF545569 |
OlActin-R | CTGGTAAAGAACCTCAGGAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tziros, G.T.; Samaras, A.; Karaoglanidis, G.S. Laminarin Induces Defense Responses and Efficiently Controls Olive Leaf Spot Disease in Olive. Molecules 2021, 26, 1043. https://doi.org/10.3390/molecules26041043
Tziros GT, Samaras A, Karaoglanidis GS. Laminarin Induces Defense Responses and Efficiently Controls Olive Leaf Spot Disease in Olive. Molecules. 2021; 26(4):1043. https://doi.org/10.3390/molecules26041043
Chicago/Turabian StyleTziros, George T., Anastasios Samaras, and George S. Karaoglanidis. 2021. "Laminarin Induces Defense Responses and Efficiently Controls Olive Leaf Spot Disease in Olive" Molecules 26, no. 4: 1043. https://doi.org/10.3390/molecules26041043
APA StyleTziros, G. T., Samaras, A., & Karaoglanidis, G. S. (2021). Laminarin Induces Defense Responses and Efficiently Controls Olive Leaf Spot Disease in Olive. Molecules, 26(4), 1043. https://doi.org/10.3390/molecules26041043