Antioxidant Activity and Anti-Apoptotic Effect of the Small Molecule Procyanidin B1 in Early Mouse Embryonic Development Produced by Somatic Cell Nuclear Transfer
Abstract
1. Introduction
2. Results
2.1. Determination of the Concentration of PB1 and the Effect of 50 μM PB1 on the Development of SCNT Embryos
2.1.1. ROS, GSH and JC-1 Ratio Levels in Two-Cell, Four-Cell, Eight-Cell and Blastocyst Embryos Cultured in KSOM Medium Supplemented in 50 µM PB1
2.1.2. The Levels of Catalase (CAT) in Two-Cell, Four-Cell, Eight-Cell and Blastocyst Embryos and the DNA Damage Repairability of PB1
2.1.3. Apoptosis of Blastocysts Cultured in KSOM Medium Supplemented in 50 µM PB1
3. Discussion
4. Materials and Methods
4.1. Ethics Statement
4.2. Reagents and Animals
4.3. Drug Treatment and Experimental Design
4.4. SCNT Protocol and Embryonic IVC
4.5. Assay of Total Blastocyst Cell Numbers
4.6. Immunofluorescence Staining and Quantitative Real-Time Polymerase Chain Reaction (Q-PCR) Protocol
4.7. TUNEL Method
4.8. ROS, GSH and MMP Level Assay
4.9. CAT Levels Method
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Rideout, W.M., 3rd; Hochedlinger, K.; Kyba, M.; Daley, G.Q.; Jaenisch, R. Correction of a genetic defect by nuclear transplantation and combined cell and gene therapy. Cell 2002, 109, 17–27. [Google Scholar] [CrossRef] [Scilit]
- Byrne, J.A.; Pedersen, D.A.; Clepper, L.L.; Nelson, M.; Sanger, W.G.; Gokhale, S.; Wolf, D.P.; Mitalipov, S.M. Producing primate embryonic stem cells by somatic cell nuclear transfer. Nature 2007, 450, 497–502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tachibana, M.; Amato, P.; Sparman, M.; Gutierrez, N.M.; Tippner-Hedges, R.; Ma, H.; Kang, E.; Fulati, A.; Lee, H.S.; Sritanaudomchai, H.; et al. Human embryonic stem cells derived by somatic cell nuclear transfer. Cell 2013, 153, 1228–1238. [Google Scholar] [CrossRef] [Scilit]
- Chung, Y.G.; Eum, J.H.; Lee, J.E.; Shim, S.H.; Sepilian, V.; Hong, S.W.; Lee, Y.; Treff, N.R.; Choi, Y.H.; Kimbrel, E.A.; et al. Human somatic cell nuclear transfer using adult cells. Cell Stem Cell 2014, 14, 777–780. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamada, M.; Johannesson, B.; Sagi, I.; Burnett, L.C.; Kort, D.H.; Prosser, R.W.; Paull, D.; Nestor, M.W.; Freeby, M.; Greenberg, E.; et al. Human oocytes reprogram adult somatic nuclei of a type 1 diabetic to diploid pluripotent stem cells. Nature 2014, 510, 533–536. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beyhan, Z.; Iager, A.E.; Cibelli, J.B. Interspecies nuclear transfer: Implications for embryonic stem cell biology. Cell Stem Cell 2007, 1, 502–512. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loi, P.; Ptak, G.; Barboni, B.; Fulka, J.; Cappai, P., Jr.; Clinton, M. Genetic rescue of an endangered mammal by cross-species nuclear transfer using post-mortem somatic cells. Nat. Biotechnol. 2001, 19, 962–964. [Google Scholar] [CrossRef] [Scilit]
- Kamimura, S.; Inoue, K.; Ogonuki, N.; Hirose, M.; Oikawa, M.; Yo, M.; Ohara, O.; Miyoshi, H.; Ogura, A. Mouse cloning using a drop of peripheral blood. Biol. Reprod. 2013, 89, 24. [Google Scholar] [CrossRef] [Scilit]
- Wakayama, S.; Ohta, H.; Hikichi, T.; Mizutani, E.; Iwaki, T.; Kanagawa, O.; Wakayama, T. Production of healthy cloned mice from bodies frozen at −20 degrees C for 16 years. Proc. Natl. Acad. Sci. USA 2008, 105, 17318–17322. [Google Scholar] [CrossRef] [Scilit]
- Doudna, J.A.; Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 2014, 346, 1258096. [Google Scholar] [CrossRef] [Scilit]
- Hsu, P.D.; Lander, E.S.; Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell 2014, 157, 1262–1278. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Mishra, V.; Thaker, R.; Gor, M.; Perumal, S.; Joshi, P.; Sheth, H.; Shaikh, I.; Gautam, A.K.; Verma, Y. Role of environmental factors & oxidative stress with respect to in vitro fertilization outcome. Indian J. Med. Res. 2018, 148, S125–S133. [Google Scholar] [PubMed]
- Ashibe, S.; Miyamoto, R.; Kato, Y.; Nagao, Y. Detrimental effects of oxidative stress in bovine oocytes during intracytoplasmic sperm injection (ICSI). Theriogenology 2019, 133, 71–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, D.; Zhang, J.-B.; Li, S.-P.; Liu, W.; Yao, X.-R.; Guo, H.; Jin, Z.-L.; Jin, Y.-X.; Yuan, B.; Jiang, H.; et al. Imperatorin Ameliorates the Aging-Associated Porcine Oocyte Meiotic Spindle Defects by Reducing Oxidative Stress and Protecting Mitochondrial Function. Front. Cell. Dev. Biol. 2020, 8, 592433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- An, Q.; Peng, W.; Cheng, Y.; Lu, Z.; Zhou, C.; Zhang, Y.; Su, J. Melatonin supplementation during in vitro maturation of oocyte enhances subsequent development of bovine cloned embryos. J. Cell. Physiol. 2019, 234, 17370–17381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takahashi, M. Oxidative stress and redox regulation on in vitro development of mammalian embryos. J. Reprod. Dev. 2012, 58, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Al-Zubaidi, U.; Liu, J.; Cinar, O.; Robker, R.L.; Adhikari, D.; Carroll, J. The spatio-temporal dynamics of mitochondrial membrane potential during oocyte maturation. Mol. Hum. Reprod. 2019, 25, 695–705. [Google Scholar] [CrossRef] [Scilit]
- Poprac, P.; Jomova, K.; Simunkova, M.; Kollar, V.; Rhodes, C.J.; Valko, M. Targeting Free Radicals in Oxidative Stress-Related Human Diseases. Trends Pharmacol. Sci. 2017, 38, 592–607. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Firuzi, O.; Miri, R.; Tavakkoli, M.; Saso, L. Antioxidant therapy: Current status and future prospects. Curr. Med. Chem. 2011, 18, 3871–3888. [Google Scholar] [CrossRef] [Scilit]
- Matta, F.V.; Xiong, J.; Lila, M.A.; Ward, N.I.; Felipe-Sotelo, M.; Esposito, D. Chemical Composition and Bioactive Properties of Commercial and Non-Commercial Purple and White Acai Berries. Foods 2020, 9, 1481. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Li, X.; Su, M.; Du, J.; Zhou, H.; Li, X.; Ye, Z. A comparative UPLC-Q-TOF/MS-based metabolomics approach for distinguishing peach (Prunus persica (L.) Batsch) fruit cultivars with varying antioxidant activity. Food Res. Int. 2020, 137, 109531. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, T.; Li, Q.; Wu, W.; Li, Y.; Hou, D.-X.; Xu, H.; Zheng, B.; Zeng, S.; Shan, Y.; Lu, X.; et al. Lotus seed skin proanthocyanidin extract exhibits potent antioxidant property via activation of the Nrf2-ARE pathway. Acta Biochim. Biophys. Sin. 2019, 51, 31–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gillmeister, M.; Ballert, S.; Raschke, A.; Geistlinger, J.; Kabrodt, K.; Baltruschat, H.; Deising, H.B.; Schellenberg, I. Polyphenols from Rheum Roots Inhibit Growth of Fungal and Oomycete Phytopathogens and Induce Plant Disease Resistance. Plant Dis. 2019, 103, 1674–1684. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fia, G.; Bucalossi, G.; Gori, C.; Borghini, F.; Zanoni, B. Recovery of Bioactive Compounds from Unripe Red Grapes (cv. Sangiovese) through a Green Extraction. Foods 2020, 9, 566. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sano, A.; Yamakoshi, J.; Tokutake, S.; Tobe, K.; Kubota, Y.; Kikuchi, M. Procyanidin B1 is detected in human serum after intake of proanthocyanidin-rich grape seed extract. Biosci. Biotechnol. Biochem. 2003, 67, 1140–1143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mao, J.T.; Xue, B.; Smoake, J.; Lu, Q.Y.; Park, H.; Henning, S.M.; Burns, W.; Bernabei, A.; Elashoff, D.; Serio, K.J.; et al. MicroRNA-19a/b mediates grape seed procyanidin extract-induced anti-neoplastic effects against lung cancer. J. Nutr. Biochem. 2016, 34, 118–125. [Google Scholar] [CrossRef] [Scilit]
- Zuriarrain, A.; Zuriarrain, J.; Puertas, A.I.; Duenas, M.T.; Ostra, M.; Berregi, I. Polyphenolic profile in cider and antioxidant power. J. Sci. Food Agric. 2015, 95, 2931–2943. [Google Scholar] [CrossRef] [Scilit]
- Kanno, H.; Kawakami, Z.; Tabuchi, M.; Mizoguchi, K.; Ikarashi, Y.; Kase, Y. Protective effects of glycycoumarin and procyanidin B1, active components of traditional Japanese medicine yokukansan, on amyloid beta oligomer-induced neuronal death. J. Ethnopharmacol. 2015, 159, 122–128. [Google Scholar] [CrossRef] [Scilit]
- Gao, W.; Jin, Y.; Hao, J.; Huang, S.; Wang, D.; Quan, F.; Ren, W.; Zhang, J.; Zhang, M.; Yu, X. Procyanidin B1 promotes in vitro maturation of pig oocytes by reducing oxidative stress. Mol. Reprod. Dev. 2021, 88, 55–66. [Google Scholar] [CrossRef] [Scilit]
- Terra, X.; Palozza, P.; Fernandez-Larrea, J.; Ardévol, A.; Bladé, C.; Pujadas, G.; Salvado, J.; Arola, L.; Blay, M.T. Procyanidin dimer B1 and trimer C1 impair inflammatory response signalling in human monocytes. Free Radic. Res. 2011, 45, 611–619. [Google Scholar] [CrossRef] [Scilit]
- Xing, J.; Li, R.; Li, N.; Zhang, J.; Li, Y.; Gong, P.; Gao, D.; Liu, H.; Zhang, Y. Anti-inflammatory effect of procyanidin B1 on LPS-treated THP1 cells via interaction with the TLR4-MD-2 heterodimer and p38 MAPK and NF-kappaB signaling. Mol. Cell. Biochem. 2015, 407, 89–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Na, W.; Ma, B.; Shi, S.; Chen, Y.; Zhang, H.; Zhan, Y.; An, H. Procyanidin B1, a novel and specific inhibitor of Kv10.1 channel, suppresses the evolution of hepatoma. Biochem. Pharmacol. 2020, 178, 114089. [Google Scholar] [CrossRef] [Scilit]
- Zhu, J.; Du, C. Could grape-based food supplements prevent the development of chronic kidney disease? Crit. Rev. Food Sci. Nutr. 2020, 60, 3054–3062. [Google Scholar] [CrossRef] [Scilit]
- Ma, Y.; Gu, M.; Chen, L.; Shen, H.; Pan, Y.; Pang, Y.; Miao, S.; Tong, R.; Huang, H.; Zhu, Y.; et al. Recent advances in critical nodes of embryo engineering technology. Theranostics 2021, 11, 7391–7424. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, J.; Wang, Y.; Xing, X.; Zhang, L.; Sun, H.; Zhang, Y. Melatonin significantly improves the developmental competence of bovine somatic cell nuclear transfer embryos. J. Pineal Res. 2015, 59, 455–468. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hwang, I.S.; Bae, H.K.; Cheong, H.T. Mitochondrial and DNA damage in bovine somatic cell nuclear transfer embryos. J. Vet. Sci. 2013, 14, 235–240. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Zhou, C.; Cheng, W.; Tao, R.; Xu, H.; Liu, H. Vitamin C protects early mouse embryos against juglone toxicity. Reprod. Toxicol. 2020, 98, 200–208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qi, J.J.; Li, X.X.; Diao, Y.F.; Liu, P.L.; Wang, D.L.; Bai, C.Y.; Yuan, B.; Liang, S.; Sun, B.X. Asiatic acid supplementation during the in vitro culture period improves early embryonic development of porcine embryos produced by parthenogenetic activation, somatic cell nuclear transfer and in vitro fertilization. Theriogenology 2020, 142, 26–33. [Google Scholar] [CrossRef] [Scilit]
- Qu, P.; Shen, C.; Du, Y.; Qin, H.; Luo, S.; Fu, S.; Dong, Y.; Guo, S.; Hu, F.; Xue, Y.; et al. Melatonin Protects Rabbit Somatic Cell Nuclear Transfer (SCNT) Embryos from Electrofusion Damage. Sci. Rep. 2020, 10, 2186. [Google Scholar] [CrossRef] [Scilit]
- Attanzio, A.; D’Anneo, A.; Pappalardo, F.; Bonina, F.P.; Livrea, M.A.; Allegra, M.; Tesoriere, L. Phenolic Composition of Hydrophilic Extract of Manna from Sicilian Fraxinus angustifolia Vahl and its Reducing, Antioxidant and Anti-Inflammatory Activity in Vitro. Antioxidants 2019, 8, 494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kelly-Aubert, M.; Trudel, S.; Fritsch, J.; Nguyen-Khoa, T.; Baudouin-Legros, M.; Moriceau, S.; Jeanson, L.; Djouadi, F.; Matar, C.; Conti, M.; et al. GSH monoethyl ester rescues mitochondrial defects in cystic fibrosis models. Hum. Mol. Genet. 2011, 20, 2745–2759. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Del Rio, L.A.; Lopez-Huertas, E. ROS Generation in Peroxisomes and its Role in Cell Signaling. Plant Cell Physiol. 2016, 57, 1364–1376. [Google Scholar] [CrossRef] [Scilit]
- Mizutani, H.; Hayashi, Y.; Hashimoto, M.; Imai, M.; Ichimaru, Y.; Kitamura, Y.; Ikemura, K.; Miyazawa, D.; Ohta, K.; Ikeda, Y.; et al. Oxidative DNA Damage and Apoptosis Induced by Aclarubicin, an Anthracycline: Role of Hydrogen Peroxide and Copper. Anticancer Res. 2019, 39, 3443–3451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, C.H.; Ma, H.L.; Deng, Y.Q.; Feng, J.; Jie, Y.K.; Guo, Z.X. Oxidative stress, cell cycle arrest, DNA damage and apoptosis in the mud crab (Scylla paramamosain) induced by cadmium exposure. Chemosphere 2021, 263, 128277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mori, Y.; Ogonuki, N.; Hasegawa, A.; Kanatsu-Shinohara, M.; Ogura, A.; Wang, Y.; McCarrey, J.R.; Shinohara, T. OGG1 protects mouse spermatogonial stem cells from reactive oxygen species in culturedagger. Biol. Reprod. 2021, 104, 706–716. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kunimura, N.; Kitagawa, K.; Sako, R.; Narikiyo, K.; Tominaga, S.; Bautista, D.S.; Xu, W.; Fujisawa, M.; Shirakawa, T. Combination of rAd-p53 in situ gene therapy and anti-PD-1 antibody immunotherapy induced anti-tumor activity in mouse syngeneic urogenital cancer models. Sci. Rep. 2020, 10, 17464. [Google Scholar] [CrossRef] [Scilit]
- De Santis, R.; Liepelt, A.; Mossanen, J.C.; Dueck, A.; Simons, N.; Mohs, A.; Trautwein, C.; Meister, G.; Marx, G.; Ostareck-Lederer, A.; et al. miR-155 targets Caspase-3 mRNA in activated miR-155 targets Caspase-3 mRNA in activated macrophages. RNA Biol. 2016, 13, 43–58. [Google Scholar] [CrossRef] [Scilit]
- Kong, D.; Yan, Y.; He, X.Y.; Yang, H.; Liang, B.; Wang, J.; He, Y.; Ding, Y.; Yu, H. Effects of Resveratrol on the Mechanisms of Antioxidants and Estrogen in Alzheimer’s Disease. BioMed Res. Int. 2019, 2019, 8983752. [Google Scholar] [CrossRef] [Scilit]




| Gene | Primer | Sequence | Annealing | |
|---|---|---|---|---|
| Forward | CTGCCTAGCAGCATGAGACAT | |||
| OGG1 | [45] | 61 °C | ||
| Reverse | CAGTGTCCATACTTGATCTGCC | |||
| Forward | CAGCCAAGTCTGTGACTTGCACGTAC | |||
| P53 | [46] | 61 °C | ||
| Reverse | CTATGTCGAAAAGTGTTTCTGTCATC | |||
| Forward | CCAACCTCAGAGAGACATTC | |||
| Caspase3 | [47] | 61 °C | ||
| Reverse | TTTCGGCTTTCCAGTCAGAC | |||
| Forward | GGGAAATCGTGCGTGACATT | |||
| β-actin | [48] | 61 °C | ||
| Reverse | GCGGCAGTGGCCATCTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gao, W.; Yu, T.; Li, G.; Shu, W.; Jin, Y.; Zhang, M.; Yu, X. Antioxidant Activity and Anti-Apoptotic Effect of the Small Molecule Procyanidin B1 in Early Mouse Embryonic Development Produced by Somatic Cell Nuclear Transfer. Molecules 2021, 26, 6150. https://doi.org/10.3390/molecules26206150
Gao W, Yu T, Li G, Shu W, Jin Y, Zhang M, Yu X. Antioxidant Activity and Anti-Apoptotic Effect of the Small Molecule Procyanidin B1 in Early Mouse Embryonic Development Produced by Somatic Cell Nuclear Transfer. Molecules. 2021; 26(20):6150. https://doi.org/10.3390/molecules26206150
Chicago/Turabian StyleGao, Wei, Tingting Yu, Guomeng Li, Wei Shu, Yongxun Jin, Mingjun Zhang, and Xianfeng Yu. 2021. "Antioxidant Activity and Anti-Apoptotic Effect of the Small Molecule Procyanidin B1 in Early Mouse Embryonic Development Produced by Somatic Cell Nuclear Transfer" Molecules 26, no. 20: 6150. https://doi.org/10.3390/molecules26206150
APA StyleGao, W., Yu, T., Li, G., Shu, W., Jin, Y., Zhang, M., & Yu, X. (2021). Antioxidant Activity and Anti-Apoptotic Effect of the Small Molecule Procyanidin B1 in Early Mouse Embryonic Development Produced by Somatic Cell Nuclear Transfer. Molecules, 26(20), 6150. https://doi.org/10.3390/molecules26206150

