Rhododendron molle G. Don Extract Induces Apoptosis and Inhibits Migration in Human Colorectal Cancer Cells and Potential Anticancer Components Analysis
Abstract
:1. Introduction
2. Results
2.1. The Effect of R. molle Extract on Cell Viability
2.2. The Effect of RLE on Colony Formation of HT-29 Cells
2.3. The Effect of RLE on HT-29 Cell Migration
2.4. The Effects of RLE on Apoptosis and Cell Cycle of HT-29 Cells
2.5. The Effect of RLE on the Apoptosis-Related Gene Expression
2.6. The Effects of RLE on the Apoptosis-Related Proteins Expression
2.7. Analysis of Anticancer Active Components in RLE by GC-MS
3. Discussion
4. Experimental Section
4.1. Reagents and Chemicals
4.2. Cell Culture
4.3. Sample Collection and Preparation of Extracts
4.4. MTT Assay
4.5. Colony Formation Assay
4.6. Wound Healing Assay
4.7. Detection of Apoptosis by DAPI Staining
4.8. Detection of Apoptosis and Cell Cycle by PI Staining
4.9. qRT-PCR Analysis
4.10. Western Blot Analysis
4.11. Analysis of Components in RLE by GC-MS
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [Green Version]
- Alteri, R.; Brooks, D.; Cokkinide, V. Colorectal Cancer Facts & Figures; American Cancer Society: Atlanta, GA, USA, 2013; p. 10. [Google Scholar]
- Manfredi, S.; Bouvier, A.M.; Lepage, C.; Hatem, C.; Dancourt, V.; Faivre, J. Incidence and patterns of recurrence after resection for cure of colonic cancer in a well defined population. Br. J. Surg. 2006, 93, 1115–1122. [Google Scholar] [CrossRef]
- Maruthappu, M.; Head, M.G.; Zhou, C.D.; Gilbert, B.J.; El-Harasis, M.A.; Raine, R.; Fitchett, J.R.; Atun, R. Investments in can-cer research awarded to UK institutions and the global burden of cancer 2000–2013: A systematic analysis. BMJ Open 2017, 7, e013936. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kirstein, M.M.; Lange, A.; Prenzler, A.; Manns, M.P.; Kubicka, S.; Vogel, A. Targeted Therapies in Metastatic Colorectal Cancer: A Systematic Review and Assessment of Currently Available Data. Oncologist 2014, 19, 1156–1168. [Google Scholar] [CrossRef] [Green Version]
- Hugen, N.; Van de Velde, C.J.H.; De Wilt, J.H.W.; Nagtegaal, I.D. Metastatic pattern in colorectal cancer is strongly influenced by histological subtype. Ann. Oncol. 2014, 25, 653–657. [Google Scholar] [CrossRef]
- Luk, J.M.; Wang, X.; Liu, P.; Wong, K.F.; Chan, K.L.; Tong, Y.; Hui, C.; Lau, G.K.; Fan, S. Traditional Chinese herbal medi-cines for treatment of liver fibrosis and cancer: From laboratory discovery to clinical evaluation. Liver Int. 2007, 27, 879–890. [Google Scholar] [CrossRef]
- Atanasov, G.A.; Zotchev, B.S.; Dirsch, M.V.; Supuran, T.C. Natural products in drug discovery: Advances and opportunities. Nat. Rev. Drug Discov. 2021, 20, 200–216. [Google Scholar] [CrossRef]
- Afrin, S.; Giampieri, F.; Gasparrini, M.; Forbes-Hernández, T.Y.; Cianciosi, D.; Reboredo-Rodriguez, P.; Zhang, J.; Manna, P.P.; Daglia, M.; Atanasov, A.G.; et al. Dietary phytochemicals in colorectal cancer prevention and treatment: A focus on the molecular mechanisms involved. Biotechnol. Adv. 2020, 38, 107322. [Google Scholar] [CrossRef] [PubMed]
- Nobili, S.; Lippi, D.; Witort, E.; Donnini, M.; Bausi, L.; Mini, E.; Capaccioli, S. Natural compounds for cancer treatment and prevention. Pharmacol. Res. 2009, 59, 365–378. [Google Scholar] [CrossRef]
- Birjandian, E.; Motamed, N.; Yassa, N. Crude Methanol Extract of Echinophora Platyloba Induces Apoptosis and Cell Cycle Arrest at S-Phase in Human Breast Cancer Cells. Iran. J. Pharm. Res. 2018, 17, 307–316. [Google Scholar]
- Robles-Escajeda, E.; Lerma, D.; Nyakeriga, A.M.; Ross, J.A.; Kirken, R.A.; Aguilera, R.J.; Varela-Ramirez, A. Searching in mother nature for anti-cancer activity: Anti-proliferative and pro-apoptotic effect elicited by Green Barley on leukemia/lymphoma cells. PLoS ONE 2013, 8, e73508. [Google Scholar] [CrossRef] [Green Version]
- Wanyu, W. Advances in the plant polysaccharides anti-tumor research. Heilongjiang Med. J. 2013, 26, 200–201. [Google Scholar]
- Wang, H.; Oo Khor, T.; Shu, L.; Su, Z.Y.; Fuentes, F.; Lee, J.H.; Tony Kong, A.N. Plants vs. cancer: A review on natural phytochemi-cals in preventing and treating cancers and their druggability. Anti-Cancer Agents Med. Chem. 2012, 12, 1281–1305. [Google Scholar] [CrossRef] [PubMed]
- Cheng, M.; Luo, X.; Liu, M.; Zhou, Y.; Cheng, Y.; Xie, J. Genetic diversity and genetic structure analysis on natural populations of endangered Rhododendron molle G. Don. Acta Bot. Boreali-Occident. Sin. 2016, 36, 674–680. [Google Scholar]
- Yong-Qing, C.A.I.; Jian-Hui, H.U.; Jie QI, N.; Tao SU, N.; Xiao-Li, L.I. Rhododendron Molle (Ericaceae): Phytochemistry, pharmacology, and toxicology. Chin. J. Nat. Med. 2018, 16, 401–410. [Google Scholar] [CrossRef]
- Cheng, X.A.; Xie, J.J.; Hu, M.Y.; Zhang, Y.B.; Huang, J.F. Induction of Intracellular Ca2+ and pH Changes in Sf9 Insect Cells by Rhodojaponin-III, A Natural Botanic Insecticide Isolated from Rhododendron molle. Molecules 2011, 16, 3179–3196. [Google Scholar] [CrossRef] [Green Version]
- Klocke, J.A.; Mei-Ying, H.; Shin-Foon, C.; Kubo, I. Grayanoid diterpene insect antifeedants and insecticides from Rhododendron molle. Phytochemistry 1991, 30, 1797–1800. [Google Scholar] [CrossRef]
- Liu, M.; Cheng, M.; Zhang, J.; Li, H.; Xie, J.; Luo, X. Genome-wide identification of SSR markers in endangered species Rhododendron molle G. Don. Acta. Bot. Boreali-Occident. Sin. 2018, 38, 0850–0857. [Google Scholar]
- Zong, L.; Zhang, J.; Dai, L.; Liu, J.; Yang, Y.; Xie, J.; Luo, X. The anti-inflammatory properties of Rhododendron molle G. Don leaf extract in LPS-induced RAW 264.7. Chem. Biodivers. 2020, 17, e2000477. [Google Scholar] [CrossRef]
- Badmus, J.A.; Ekpo, O.E.; Hussein, A.A.; Meyer, M.; Hiss, D.C. Antiproliferative and Apoptosis Induction Potential of the Methanolic Leaf Extract of Holarrhena floribunda (G. Don). Evid.-Based Complement. Altern. Med. 2015, 2015, 756482. [Google Scholar] [CrossRef] [Green Version]
- Xiang, M. Advances in anti-cancer drugs for invasion and metastasis. Chin. Pharmacol. Bull. 1999, 15, 501–504. [Google Scholar]
- Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef]
- Bennetts, P.S.; Pierce, J.D. Apoptosis: Understanding programmed cell death for the CRNA. AANA J. 2010, 78, 237–245. [Google Scholar]
- Gao, H.; Yin, D.F. Effect and mechanism of reconstruction zhongqi anticancer decoction containing serum in inhibiting gastric cancer SGC7901 cells. J. Liaoning Univ. TCM 2020, 22, 5–8. [Google Scholar]
- Frew, A.J.; Johnstone, R.W.; Bolden, J.E. Enhancing the apoptotic and therapeutic effects of HDAC inhibitors. Cancer Lett. 2009, 280, 125–133. [Google Scholar] [CrossRef] [PubMed]
- Hou, J.; Wang, D.; Zhang, R.; Wang, H. Experimental Therapy of Hepatoma with Artemisinin and Its Derivatives: In vitro and In vivo Activity, Chemosensitization, and Mechanisms of Action. Clin. Cancer Res. 2008, 14, 5519–5530. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tor, Y.S.; Yazan, L.S.; Foo, J.B.; Armania, N.; Cheah, Y.K.; Abdullah, R.; Imam, M.U.; Ismail, N.; Ismail, M. Induction of apoptosis through oxidative stress-related pathways in MCF-7, human breast cancer cells, by ethyl acetate extract of Dillenia suffruticosa. BMC Complement. Altern. Med. 2014, 14, 55. [Google Scholar] [CrossRef]
- Huang, Y.J.; Chang, C.C.; Wang, Y.Y.; Chiang, W.C.; Shih, Y.H.; Shieh, T.M.; Wang, K.; Ali, M.; Hsia, S.M. Adlay testa (Coix lachrymajobi L. var. Ma-yuen Stapf.) ethanolic extract and its active components exert anti-proliferative effects on endometrial cancer cells via cell cycle arrest. Molecules 2021, 26, 1966. [Google Scholar] [CrossRef]
- Singh, R.P.; Agarwal, R. Natural Flavonoids Targeting Deregulated Cell Cycle Progression in Cancer Cells. Curr. Drug Targets 2006, 7, 345–354. [Google Scholar] [CrossRef]
- Yang, Y.; Chen, L.; Pan, H.Z.; Kou, Y.; Xu, C.M. Glycosylation modification of human prion protein provokes apoptosis in HeLa cells in vitro. BMB Rep. 2009, 42, 331–337. [Google Scholar] [CrossRef] [Green Version]
- Hunter, T.; Pines, J. Cyclins and cancer II: Cyclin D and CDK inhibitors come of age. Cell 1994, 79, 573–582. [Google Scholar] [CrossRef]
- Radhakrishnan, S.K.; Feliciano, C.S.; Najmabadi, F.; Haegebarth, A.; Kandel, E.S.; Tyner, A.L.; Gartel, A.L. Constitutive ex-pression of E2F-1 leads to p21-dependent cell cycle arrest in S phase of the cell cycle. Oncogene 2004, 23, 4173–4176. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Levine, A.J.; Momand, J.; Finlay, C.A. The p53 tumour suppressor gene. Nat. Cell Biol. 1991, 351, 453–456. [Google Scholar] [CrossRef]
- Kuwana, T.; Newmeyer, D.D. Bcl-2-family proteins and the role of mitochondria in apoptosis. Curr. Opin. Cell Biol. 2003, 15, 691–699. [Google Scholar] [CrossRef]
- Gogvadze, V.; Orrenius, S.; Zhivotovsky, B. Multiple pathways of cytochrome c release from mitochondria in apoptosis. Biochim. Biophys. Acta (BBA)-Bioenerg. 2006, 1757, 639–647. [Google Scholar] [CrossRef] [Green Version]
- Joubert, A.; Maritz, C.; Joubert, F. Bax/Bcl-2 expression levels of 2-methoxyestradiol-exposed esophageal cancer cells. Biomed. Res. 2005, 26, 131–134. [Google Scholar] [CrossRef] [Green Version]
- Zhu, Y.X.; Zhao, M.Y.; Jiang, D.G.; Shi, Y.Q. Expression of tumor suppressor gene p53 apoptosis-suppressing gene Bcl-2, proapoptotic gene Bax in gastric cancer and precancerous lesions. Chin. J. Gastroenterol. Hepatol. 2016, 25, 1040–1043. [Google Scholar]
- Yu, X.; Pan, Y.; Ma, H.; Li, W. Simvastatin Inhibits Proliferation and Induces Apoptosis in Human Lung Cancer Cells. Oncol. Res. Featur. Preclin. Clin. Cancer Ther. 2013, 20, 351–357. [Google Scholar] [CrossRef] [PubMed]
- Park, S.; Hwang, K.; Na, J.R.; Lee, K.; Jeong, E.S. Triterpenoids from the leaves of Dendropanax morbifera Leveille and its cytotoxic activity toward breast MCF-7 and lung A549 cancer cells. Korean Soc. Food Preserv. 2018, 25, 471–481. [Google Scholar] [CrossRef]
- Luo, Y.; Wang, C.Z.; Sawadogo, R.; Yuan, J.B.; Zeng, J.X.; Xu, M.; Tan, T.; Yuan, C.S. 4-Vinylguaiacol, an active metabolite of ferulic acid by enteric microbiota and probiotics, possesses significant activities against drug-resistant human colorectal cancer cells. ACS Omega 2021, 6, 4551–4561. [Google Scholar] [CrossRef]
Sample | IC50 (μm/mL) | ||||
---|---|---|---|---|---|
HT-29 | A549 | A2780 | SGC-7901 | PC3 | |
RLE | 73.08 | 115.59 | 120.29 | 194.22 | 307.43 |
RFE | 552.86 | 812.68 | 634.61 | 1287.15 | 881.96 |
Forward Primer (5′ → 3′) | Reverse Primer (5′ → 3′) | |
---|---|---|
Bax | GAGAGGTCTTTTTCCGAGTG | GGTGAGGAGGCTTGAGGAGT |
Bcl-2 | GCTACCTAAGAAAAACCTGG | CAAGAAACAAGGTCAAAGGG |
p53 | CTTTGAGGTGCGTGTTT | CAGTGCTCGCTTAGTGC |
p21 | GACACCACTGGAGGGTGACT | CAGGTCCACATGGTCTTCCT |
β-actin | TGGCACCACACCTTCTACAAT | AGAGGCGTACAGGGATAGCAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zong, L.; Yang, Y.; Zhang, J.; Dai, L.; Luo, Y.; Yang, J.; Luo, X. Rhododendron molle G. Don Extract Induces Apoptosis and Inhibits Migration in Human Colorectal Cancer Cells and Potential Anticancer Components Analysis. Molecules 2021, 26, 2990. https://doi.org/10.3390/molecules26102990
Zong L, Yang Y, Zhang J, Dai L, Luo Y, Yang J, Luo X. Rhododendron molle G. Don Extract Induces Apoptosis and Inhibits Migration in Human Colorectal Cancer Cells and Potential Anticancer Components Analysis. Molecules. 2021; 26(10):2990. https://doi.org/10.3390/molecules26102990
Chicago/Turabian StyleZong, Luye, Yan Yang, Jin Zhang, Liangfang Dai, Yuqiang Luo, Jing Yang, and Xiangdong Luo. 2021. "Rhododendron molle G. Don Extract Induces Apoptosis and Inhibits Migration in Human Colorectal Cancer Cells and Potential Anticancer Components Analysis" Molecules 26, no. 10: 2990. https://doi.org/10.3390/molecules26102990
APA StyleZong, L., Yang, Y., Zhang, J., Dai, L., Luo, Y., Yang, J., & Luo, X. (2021). Rhododendron molle G. Don Extract Induces Apoptosis and Inhibits Migration in Human Colorectal Cancer Cells and Potential Anticancer Components Analysis. Molecules, 26(10), 2990. https://doi.org/10.3390/molecules26102990