Genistin: A Novel Potent Anti-Adipogenic and Anti-Lipogenic Agent
Abstract
1. Introduction
2. Results
2.1. Cytotoxicity of Soy Isoflavones in 3T3-L1 Preadipocytes
2.2. Effect of Soy Isoflavones on 3T3-L1 Adipocyte Differentiation
2.3. Inhibitory Effects of Genistin and Genistein on the Protein and Gene Expression of Adipogenic-Specific Factors During Differentiation of 3T3-L1 cells
2.4. Suppressive Effects of Genistin and Genistein on the Protein and Gene Expression of Lipogenic Enzymes
2.5. Modulation of AMPK Activity and SREBP-1c Expression by Genistin and Genistein
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Cell Culture, Differentiation, and Reagents
4.3. Cell Cytotoxicity Analysis
4.4. Live/Dead Imaging
4.5. Oil Red O (ORO) Staining
4.6. Western Blot Analysis
4.7. Real-Time Polymerase Chain Reaction (RT-PCR)
4.8. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
Abbreviations
| ACC | Acetyl-CoA carboxylase |
| ACL | ATP citrate lyase |
| AMPK | AMP-activated protein kinase |
| ATGL | Adipose triglyceride lipase |
| aP2 | Adipocyte-binding protein 2 |
| C/EBPα | CCAAT/enhancer-binding protein A |
| FABP4 | Fatty acid-binding protein 4 |
| FAS | Fatty acid synthase |
| HSL | Hormone-sensitive lipase |
| ORO | Oil Red O |
| PPARγ | Peroxisome proliferator-activated receptor γ |
| SREBP-1c | Sterol regulatory element-binding transcription factor 1c |
References
- Bastarrachea, R.A.; Cole, S.A.; Comuzzie, A.G. Genomics of body weight regulation: Unraveling the molecular mechanisms predisposing to obesity. Med. Clin-Barcelona 2004, 123, 104–117. [Google Scholar] [CrossRef]
- Spiegelman, B.M.; Flier, J.S. Adipogenesis and obesity: Rounding out the big picture. Cell 1996, 87, 377–389. [Google Scholar] [CrossRef]
- Muir, L.A.; Neeley, C.K.; Meyer, K.A.; Baker, N.A.; Brosius, A.M.; Washabaugh, A.R.; Varban, O.A.; Finks, J.F.; Zamarron, B.F.; Flesher, C.G.; et al. Adipose tissue fibrosis, hypertrophy, and hyperplasia: Correlations with diabetes in human. Obesity 2016, 24, 597–605. [Google Scholar] [CrossRef] [PubMed]
- Kersten, S. Mechanisms of nutritional and hormonal regulation of lipogenesis. EMBO Rep. 2001, 2, 282–286. [Google Scholar] [CrossRef]
- Wu, Z.D.; Rosen, E.D.; Brun, R.; Hauser, S.; Adelmant, G.; Troy, A.E.; McKeon, C.; Darlington, G.J.; Spiegelman, B.M. Cross-regulation of C/EBP alpha and PPAR gamma controls the transcriptional pathway of adipogenesis and insulin sensitivity. Mol. Cell 1999, 3, 151–158. [Google Scholar] [CrossRef]
- Kusminski, C.M.; Bickel, P.E.; Scherer, P.E. Targeting adipose tissue in the treatment of obesity-associated diabetes. Nat. Rev. Drug Discov. 2016, 15, 639–660. [Google Scholar] [CrossRef]
- Giby, V.G.; Ajith, T.A. Role of adipokines and peroxisome proliferator-activated receptors in nonalcoholic fatty liver disease. World J. Hepatol. 2014, 6, 570–579. [Google Scholar] [CrossRef]
- Chen, S.; Li, Z.; Li, W.; Shan, Z.; Zhu, W. Resveratrol inhibits cell differentiation in 3T3-L1 adipocytes via activation of AMPK. Can. J. Physiol. Pharmacol. 2011, 89, 793–799. [Google Scholar]
- Garin-Shkolnik, T.; Rudich, A.; Hotamisligil, G.S.; Rubinstein, M. FABP4 attenuates PPAR gamma and adipogenesis and is inversely correlated with PPARgamma in adipose tissues. Diabetes 2014, 63, 900–911. [Google Scholar] [CrossRef]
- Bernlohr, D.A.; Bolanowski, M.A.; Kelly, T.J., Jr.; Lane, M.D. Evidence for an increase in transcription of specific mRNAs during differentiation of 3T3-L1 preadipocytes. J. Biol. Chem. 1985, 260, 5563–5567. [Google Scholar]
- Cornelius, P.; MacDougald, O.A.; Lane, M.D. Regulation of adipocyte development. Annu. Rev. Nutr. 1994, 14, 99–129. [Google Scholar] [CrossRef] [PubMed]
- Gregoire, F.M.; Smas, C.M.; Sul, H.S. Understanding adipocyte differentiation. Physiol. Rev. 1998, 78, 783–809. [Google Scholar] [CrossRef] [PubMed]
- Ahmadian, M.; Suh, J.M.; Hah, N.; Liddle, C.; Atkins, A.R.; Downes, M.; Evans, R.M. PPAR gamma signaling and metabolism: The good, the bad and the future. Nat. Med. 2013, 19, 557–566. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.B.; Zhou, G.C.; Li, C. AMPK: An emerging drug target for diabetes and the metabolic syndrome. Cell Metab. 2009, 9, 407–416. [Google Scholar] [CrossRef] [PubMed]
- Rosen, E.D.; Walkey, C.J.; Puigserver, P.; Spiegelman, B.M. Transcriptional regulation of adipogenesis. Genes Dev. 2000, 14, 1293–1307. [Google Scholar] [PubMed]
- Tan, J.L.; Huang, C.; Luo, Q.H.; Liu, W.T.; Cheng, D.J.; Li, Y.F.; Xia, Y.; Li, C.; Tang, L.; Fang, J.; et al. Soy isoflavones ameliorate fatty acid metabolism of visceral adipose tissue by increasing the AMPK activity in male rats with diet-induced obesity (DIO). Molecules 2019, 24, 2089. [Google Scholar] [CrossRef]
- Medjakovic, S.; Mueller, M.; Jungbauer, A. Potential health-modulating effects of isoflavones and metabolites via activation of PPAR and AhR. Nutrients 2010, 2, 241–279. [Google Scholar] [CrossRef]
- Magee, P.J.; Allsopp, P.; Samaletdin, A.; Rowland, I.R. Daidzein, R-(+)equol and S-(–)equol inhibit the invasion of MDA-MB-231 breast cancer cells potentially via the down-regulation of matrix metalloproteinase-2. Eur. J. Nutr. 2014, 53, 345–350. [Google Scholar] [CrossRef]
- Yu, F.; Liu, Z.H.; Tong, Z.H.; Zhao, Z.G.; Liang, H.D. Soybean isoflavone treatment induces osteoblast differentiation and proliferation by regulating analysis of Wnt/beta-catenin pathway. Gene 2015, 573, 273–277. [Google Scholar] [CrossRef]
- Pusparini; Yenny; Hidayat, A. Effect of soy isoflavone supplementation on endothelial dysfunction and oxidative stress in equol-producing postmenopausal women. Endocr. Metab. Immune. 2015, 15, 71–79. [Google Scholar]
- Blay, M.; Espinel, A.E.; Delgado, M.A.; Baiges, I.; Blade, C.; Arola, L.; Salvado, J. Isoflavone effect on gene expression profile and biomarkers of inflammation. J. Pharmaceut. Biomed. 2010, 51, 382–390. [Google Scholar] [CrossRef] [PubMed]
- Rothwell, J.A.; Pérez-Jiménez, J.; Neveu, V.; Medina-Ramon, A.; M’Hiri, N.; Garcia Lobato, P.; Manach, C.; Knox, K.; Eisner, R.; Wishart, D.; et al. Phenol-Explorer 3.0: A major update of the Phenol-Explorer database to incorporate data on the effects of food processing on polyphenol content. Database 2013. [Google Scholar] [CrossRef] [PubMed]
- Takaoka, O.; Mori, T.; Ito, F.; Okimura, H.; Kataoka, H.; Tanaka, Y.; Koshiba, A.; Kusuki, I.; Shigehiro, S.; Amami, T.; et al. Daidzein-rich isoflavone aglycones inhibit cell growth and inflammation in endometriosis. J. Steroid Biochem. 2018, 181, 125–132. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Wang, G.J.; Song, T.T.; Murphy, P.A.; Hendrich, S. Urinary disposition of the soybean isoflavones daidzein, genistein and glycitein differs among humans with moderate fecal isoflavone degradation activity. J. Nutr. 1999, 129, 957–962. [Google Scholar] [CrossRef]
- Thomas, B.F.; Zeisel, S.H.; Busby, M.G.; Hill, J.M.; Mitchell, R.A.; Scheffler, N.M.; Brown, S.S.; Bloeden, L.T.; Dix, K.J.; Jeffcoat, A.R. Quantitative analysis of, the principle soy isoflavones genistein, daidzein and glycitein, and their primary conjugated metabolites in human plasma and urine using reversed-phase high-performance liquid chromatography with ultraviolet detection. J. Chromatogr. B 2001, 760, 191–205. [Google Scholar] [CrossRef]
- Shao, G.X.; Mo, R.Y.; Wang, C.Y.; Zhang, D.Y.; Yin, Z.Z.; Ouyang, R.; Xu, L.N. Studies on the syntheses and structure-biological activity relationships of daidzein and its derivatives (author’s transl). Yao Xue Xue Bao 1980, 15, 538–547. [Google Scholar] [PubMed]
- Yang, J.; Xu, Y.; Liu, H.Y.; Han, R.M.; Zhang, J.P.; Skibsted, L.H. Genistein binding to copper(II)-solvent dependence and effects on radical scavenging. Molecules 2017, 22, 1757. [Google Scholar] [CrossRef]
- Pavese, J.M.; Farmer, R.L.; Bergan, R.C. Inhibition of cancer cell invasion and metastasis by genistein. Cancer Metastasis Rev. 2010, 29, 465–482. [Google Scholar] [CrossRef]
- He, Y.; Niu, W.J.; Xia, C.Q.; Cao, B.H. Daidzein reduces the proliferation and adiposeness of 3T3-L1 preadipocytes via regulating adipogenic gene expression. J. Funct. Foods 2016, 22, 446–453. [Google Scholar] [CrossRef]
- Zeng, H.J.; Wang, Y.P.; Yang, R.; You, J.; Qu, L.B. Inhibitory effects of daidzein and genistein on trypsin: Insights from spectroscopic and molecular docking studies. Int. J. Biol. Macromol. 2016, 89, 336–343. [Google Scholar] [CrossRef]
- Sakamoto, Y.; Kanatsu, J.; Toh, M.; Naka, A.; Kondo, K.; Iida, K. The dietary isoflavone daidzein reduces expression of pro-inflammatory genes through PPAR alpha/gamma and JNK pathways in adipocyte and macrophage co-cultures. PLoS One 2016. [CrossRef]
- Liang, Y.S.; Qi, W.T.; Guo, W.Q.; Wang, C.L.; Hu, Z.B.; Li, A.K. Genistein and daidzein induce apoptosis of colon cancer cells by inhibiting the accumulation of lipid droplets. Food Nutr. Res. 2018. [CrossRef] [PubMed]
- Kuiper, G.G.J.M.; Lemmen, J.G.; Carlsson, B.; Corton, J.C.; Safe, S.H.; van der Saag, P.T.; van der Burg, P.; Gustafsson, J.A. Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor beta. Endocrinology 1998, 139, 4252–4263. [Google Scholar] [CrossRef] [PubMed]
- Hedlund, T.E.; Johannes, W.U.; Miller, G.J. Soy isoflavonoid equol modulates the growth of benign and malignant prostatic epithelial cells in vitro. Prostate 2003, 54, 68–78. [Google Scholar] [CrossRef] [PubMed]
- Adjakly, M.; Ngollo, M.; Boiteux, J.P.; Bignon, Y.J.; Guy, L.; Bernard-Gallon, D. Genistein and daidzein: Different molecular effects on prostate cancer. Anticancer Res. 2013, 33, 39–44. [Google Scholar] [PubMed]
- Harmon, A.W.; Patel, Y.M.; Harp, J.B. Genistein inhibits CCAAT/enhancer-binding protein beta (C/EBP beta) activity and 3T3-L1 adipogenesis by increasing C/EBP homologous protein expression. Biochem. J. 2002, 367, 203–208. [Google Scholar] [CrossRef]
- Kim, M.H.; Park, H.W.; Kim, W.G.; Lee, Y.S. The inhibitory effects of soy daidzein on obesity in C57BL/6J mice fed high fat. Faseb. J. 2007, 21, A1099. [Google Scholar]
- Hwang, J.T.; Park, I.J.; Shin, J.I.; Lee, Y.K.; Lee, S.K.; Baik, H.W.; Ha, J.; Park, O.J. Genistein, EGCG, and capsaicin inhibit adipocyte differentiation process via activating AMP-activated protein kinase. Biochem. Bioph. Res. Co. 2005, 338, 694–699. [Google Scholar] [CrossRef]
- Park, H.J.; Della-Fera, M.A.; Hausman, D.B.; Rayalam, S.; Ambati, S.; Baile, C.A. Genistein inhibits differentiation of primary human adipocytes. J. Nutr. Biochem. 2009, 20, 140–148. [Google Scholar] [CrossRef]
- Daval, M.; Foufelle, F.; Ferre, P. Functions of AMP-activated protein kinase in adipose tissue. J. Physiol. London 2006, 574, 55–62. [Google Scholar] [CrossRef]
- Fryer, L.G.D.; Carling, D. AMP-activated protein kinase and the metabolic syndrome. Biochem. Soc. T. 2005, 33, 362–366. [Google Scholar] [CrossRef] [PubMed]
- Ono, M.; Fujimori, K. Antiadipogenic effect of dietary apigenin through activation of AMPK in 3T3-L1 cells. J. Agr. Food Chem. 2011, 59, 13346–13352. [Google Scholar] [CrossRef] [PubMed]
- Ahn, J.; Lee, H.; Kim, S.; Park, J.; Ha, T. The anti-obesity effect of quercetin is mediated by the AMPK and MAPK signaling pathways. Biochem. Bioph. Res. Co. 2008, 373, 545–549. [Google Scholar] [CrossRef] [PubMed]
- Kang, M.C.; Ding, Y.; Kim, J.; Kim, E.A.; Fernando, I.P.S.; Heo, S.J.; Lee, S.H. 3-Chloro-4,5-dihydroxybenzaldehyde inhibits adipogenesis in 3T3-L1 adipocytes by regulating expression of adipogenic transcription factors and AMPK activation. Chem. Biol. Interact. 2018, 287, 27–31. [Google Scholar] [CrossRef]
- Jang, Y.J.; Koo, H.J.; Sohn, E.H.; Kang, S.C.; Rhee, D.K.; Pyo, S. Theobromine inhibits differentiation of 3T3-L1 cells during the early stage of adipogenesis via AMPK and MAPK signaling pathways. Food Funct. 2015, 6, 2365–2374. [Google Scholar] [CrossRef]
- Yan, Y.; Zhou, X.E.; Xu, H.E.; Melcher, K. Structure and physiological regulation of AMPK. Int. J. Mol. Sci. 2018. [Google Scholar] [CrossRef]
- Eberle, D.; Hegarty, B.; Bossard, P.; Ferre, P.; Foufelle, F. SREBP transcription factors: Master regulators of lipid homeostasis. Biochimie 2004, 86, 839–848. [Google Scholar] [CrossRef]
- Li, Y.; Xu, S.Q.; Mihaylova, M.M.; Zheng, B.; Hou, X.Y.; Jiang, B.B.; Park, O.; Luo, Z.J.; Lefai, E.; Shyy, J.Y.J.; et al. AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice. Cell Metab. 2011, 13, 376–388. [Google Scholar] [CrossRef]
- Xiao, X.; Song, B.L. SREBP: A novel therapeutic target. Acta Biochim. Biophys. Sin. 2013, 45, 2–10. [Google Scholar] [CrossRef]
- Fajas, L.; Schoonjans, K.; Gelman, L.; Kim, J.B.; Najib, J.; Martin, G.; Fruchart, J.C.; Briggs, M.; Spiegelman, B.M.; Auwerx, J. Regulation of peroxisome proliferator-activated receptor gamma expression by adipocyte differentiation and determination factor 1/sterol regulatory element binding protein 1. Implications for adipocyte differentiation and metabolism. Mol. Cell Biol. 1999, 19, 5495–5503. [Google Scholar] [CrossRef]
- Shimomura, L.; Bashmakov, Y.; Ikemoto, S.; Horton, J.D.; Brown, M.S.; Goldstein, J.L. Insulin selectively increases SREBP-1c mRNA in the livers of rats with streptozotocin-induced diabetes. P. Natl. Acad. Sci. USA 1999, 96, 13656–13661. [Google Scholar] [CrossRef] [PubMed]
- Magana, M.M.; Lin, S.S.; Dooley, K.A.; Osborne, T.F. Sterol regulation of acetyl coenzyme A carboxylase promoter requires two interdependent binding sites for sterol regulatory element binding proteins. J. Lipid Res. 1997, 38, 1630–1638. [Google Scholar] [PubMed]
- Cao, Z.; Umek, R.M.; McKnight, S.L. Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev. 1991, 5, 1538–1552. [Google Scholar] [CrossRef] [PubMed]
- Tontonoz, P.; Spiegelman, B.M. Fat and beyond: The diverse biology of PPAR gamma. Annu. Rev. Biochem. 2008, 77, 289–312. [Google Scholar] [CrossRef]
- Sato, R.; Okamoto, A.; Inoue, J.; Miyamoto, W.; Sakai, Y.; Emoto, N.; Shimano, H.; Maeda, M. Transcriptional regulation of the ATP citrate-lyase gene by sterol regulatory element-binding proteins. J. Bio. Chem. 2000, 275, 12497–12502. [Google Scholar] [CrossRef]
- Aziz, S.A.; Wakeling, L.A.; Miwa, S.; Alberdi, G.; Hesketh, J.E.; Ford, D. Metabolic programming of a beige adipocyte phenotype by genistein. Mol. Nutr. Food Res. 2017, 61, 1600574. [Google Scholar] [CrossRef]
- Valli, V.; Heilmann, K.; Danesi, F.; Bordoni, A.; Gerhauser, C. Modulation of adipocyte differentiation and proadipogenic gene expression by sulforaphane, genistein, and docosahexaenoic acid as a first step to counteract obesity. Oxid. Med. Cell Longev. 2018, 2018, 1617202. [Google Scholar] [CrossRef]
- Kim, M.H.; Park, J.S.; Seo, M.S.; Jung, J.W.; Lee, Y.S.; Kang, K.S. Genistein and daidzein repress adipogenic differentiation of human adipose tissue-derived mesenchymal stem cells via Wnt/beta-catenin signalling or lipolysis. Cell Proliferat. 2010, 43, 594–605. [Google Scholar] [CrossRef]
- Li, X.H.; Zhang, J.C.; Sui, S.F.; Yang, M.S. Effect of daidzin, genistin, and glycitin on osteogenic and adipogenic differentiation of bone marrow stromal cells and adipocytic transdifferentiation of osteoblasts. Acta Pharmacol. Sin. 2005, 26, 1081–1086. [Google Scholar] [CrossRef]
- Yang, H.; Lee, S.H.; Ji, H.; Kim, J.E.; Yoo, R.; Kim, J.H.; Suk, S.; Huh, C.S.; Park, J.H.Y.; Heo, Y.S.; et al. Orobol, an enzyme-convertible product of genistein, exerts anti-obesity effects by targeting casein kinase 1 epsilon. Sci. Rep 2019. [Google Scholar] [CrossRef]
- Seo, S.G.; Yang, H.; Shin, S.H.; Min, S.; Kim, Y.A.; Yu, J.G.; Lee, D.E.; Chung, M.Y.; Heo, Y.S.; Kwon, J.Y.; et al. A metabolite of daidzein, 6,7,4 ‘-trihydroxyisoflavone, suppresses adipogenesis in 3T3-L1 preadipocytes via ATP-competitive inhibition of PI3K. Mol. Nutr. Food Res. 2013, 57, 1446–1455. [Google Scholar] [CrossRef] [PubMed]
- Yanagisawa, M.; Sugiya, M.; Iijima, H.; Nakagome, I.; Hirono, S.; Tsuda, T. Genistein and daidzein, typical soy isoflavones, inhibit TNF-alpha-mediated downregulation of adiponectin expression via different mechanisms in 3T3-L1 adipocytes. Mol. Nutr. Food Res. 2012, 56, 1783–1793. [Google Scholar] [CrossRef]
Sample Availability: Samples of the compounds, daidzein, glycitein, genistein, and genistin, are available from the authors. |







| Gene | Primer Sequence (5′-3′) | |
|---|---|---|
| C/EBPα | Forward | CAAGAACAGCAACGAGTACC |
| Reverse | TTGACCAAGGAGCTCTCA | |
| PPARγ | Forward | AGGCTTCCACTATGGAGTTC |
| Reverse | CCAACAGCTTCTCCTTCTC | |
| aP2/FABP4 | Forward | GGATTTGGTCACCATCCGGT |
| Reverse | TTCACCTTCCTGTCGTCTGC | |
| SREBP-1c | Forward | CACTTCTGGAGACATCGCAAAC |
| Reverse | ATGGTAGACAACAGCCGCATC | |
| ACC1 | Forward | GGAGATGTACGCTGACCGAGAA |
| Reverse | ACCCGACGCATGGTTTTCA | |
| ACL | Forward | TGGATGCCACAGCTGACTAC |
| Reverse | GGTTCAGCAAGGTCAGCTTC | |
| FAS | Forward | AGGGGTCGACCTGGTCCTCA |
| Reverse | GCCATGCCCAGAGGGTGGTT | |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Choi, Y.R.; Shim, J.; Kim, M.J. Genistin: A Novel Potent Anti-Adipogenic and Anti-Lipogenic Agent. Molecules 2020, 25, 2042. https://doi.org/10.3390/molecules25092042
Choi YR, Shim J, Kim MJ. Genistin: A Novel Potent Anti-Adipogenic and Anti-Lipogenic Agent. Molecules. 2020; 25(9):2042. https://doi.org/10.3390/molecules25092042
Chicago/Turabian StyleChoi, Yae Rim, Jaewon Shim, and Min Jung Kim. 2020. "Genistin: A Novel Potent Anti-Adipogenic and Anti-Lipogenic Agent" Molecules 25, no. 9: 2042. https://doi.org/10.3390/molecules25092042
APA StyleChoi, Y. R., Shim, J., & Kim, M. J. (2020). Genistin: A Novel Potent Anti-Adipogenic and Anti-Lipogenic Agent. Molecules, 25(9), 2042. https://doi.org/10.3390/molecules25092042

