Next Article in Journal
Solvent-Free Iron(III) Chloride-Catalyzed Direct Amidation of Esters
Next Article in Special Issue
Psoralen Derivatives as Inhibitors of Mycobacterium tuberculosis Proteasome
Previous Article in Journal
Ceiba speciosa (A. St.-Hil.) Seeds Oil: Fatty Acids Profiling by GC-MS and NMR and Bioactivity
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Sulfonamide Inhibition Studies of the β-Class Carbonic Anhydrase CAS3 from the Filamentous Ascomycete Sordaria macrospora

1
Dipartimento di Chimica Ugo Schiff, Università degli Studi di Firenze, 50019 Sesto Fiorentino (Florence), Italy
2
Institute of Microbiology and Genetics, Department of Genetics of Eukaryotic Microorganisms, Georg-August-University, 37077 Gottingen, Germany
3
University of New South Wales, School of Chemistry, Sydney, NSW 2052, Australia
4
Neurofarba Dept., Section of Pharmaceutical and Nutriceutical Sciences, Università degli Studi di Firenze, 50019 Sesto Fiorentino (Florence), Italy
*
Author to whom correspondence should be addressed.
Molecules 2020, 25(5), 1036; https://doi.org/10.3390/molecules25051036
Submission received: 10 February 2020 / Revised: 23 February 2020 / Accepted: 23 February 2020 / Published: 25 February 2020

Abstract

A new β-class carbonic anhydrase was cloned and purified from the filamentous ascomycete Sordaria macrospora, CAS3. This enzyme has a higher catalytic activity compared to the other two such enzymes from this fungus, CAS1 and CAS2, which were reported earlier, with the following kinetic parameters: kcat of (7.9 ± 0.2) × 105 s−1, and kcat/Km of (9.5 ± 0.12) × 107 M−1∙s−1. An inhibition study with a panel of sulfonamides and one sulfamate was also performed. The most effective CAS3 inhibitors were benzolamide, brinzolamide, dichlorophnamide, methazolamide, acetazolamide, ethoxzolamide, sulfanilamide, methanilamide, and benzene-1,3-disulfonamide, with KIs in the range of 54–95 nM. CAS3 generally shows a higher affinity for this class of inhibitors compared to CAS1 and CAS2. As S. macrospora is a model organism for the study of fruiting body development in fungi, these data may be useful for developing antifungal compounds based on CA inhibition.

Graphical Abstract

1. Introduction

The filamentous ascomycete Sordaria macrospora is a coprophilous fungus that naturally lives on herbivore dung. For many years S. macrospora served as a model organism to study fruiting body development in fungi [1]. Previous studies identified four carbonic anhydrase (CA, EC 4.2.1.1) genes in the genome of S. macrospora that are designated as cas1, cas2, cas3, and cas4 [2,3,4,5]. The two β-CA genes cas1 and cas2 have high sequence identity and encode enzymes with characteristics of the plant-like sub-class of β‑CAs [2]. The β-CA cas3 belongs to the cab-like [6] sub‑class, whereas cas4 encodes for an α-class CA. CAS1 and CAS3 are cytoplasmic enzymes, while CAS2 is located in the mitochondria, and CAS4 is a secreted protein [3,4,5]. The three β-CAs cas1, cas2, and cas3 are involved in the sexual development of S. macrospora [3]. Deletion of the α-CA cas4 resulted in a significantly reduced rate of ascospore germination but showed no significant involvement in sexual development and vegetative growth [5]. Thus, the detailed physiological roles of all these enzymes are not yet entirely elucidated.
The CA metalloenzymes are ubiquitous in most life forms, with eight distinct genetic families encoding the α-, β-, γ-, δ-, ζ-, η-, θ-, and ι-CAs [7,8,9,10,11,12,13]. By catalyzing the hydration of CO2 to bicarbonate and protons, CAs are involved in various processes, starting with pH regulation and ending with metabolism [4,7,8,9,10,11,12,13]. In fungi, they play crucial roles in growth, development, virulence, and survival [10,11], and modulation of their activity with inhibitors and/or activators was proposed as a new approach for designing antifungals [10,11,14,15,16]. The metal ion from the enzyme active site is usually coordinated by three amino-acid residues, whereas the fourth ligand is a water molecule or hydroxide ion which acts as a nucleophile in the hydrolytic reactions [4,7,8,9,10,11,12,13]. In β-CAs the Zn(II) is coordinated by two Cys residues, one His residue, and one water molecule/hydroxide ion [17,18].
The two β-class CA proteins CAS1 and CAS2 representing the major CA proteins of S. macrospora were biochemically and structurally characterized by our groups [3,17,18]. Both proteins could be easily produced in Escherichia coli and obtained in high purity (5–10 mg of CAS1 and 10–20 mg of CAS2 per L of culture) and exhibited noticeable in vitro CO2 hydration activity with kcat/Km for CAS1 of 1.30 × 106 M−1∙s−1 and for CAS2 of 1.21 × 106 M−1∙s−1 [17]. The crystal structures of CAS1 and CAS2 were determined to a resolution of 2.7 Å and 1.8 Å, respectively [17]. The oligomeric state of both proteins was tetrameric. With exception of the active site composition, no further major differences could be observed between the structures of CAS1 and CAS2. The activity of both CAs was only weakly inhibited by nitrite and nitrate anions and some other anions, making them good candidates for industrial applications [17]. In addition, both enzymes were recently investigated for their inhibition with a panel of 39 aromatic, heterocyclic, and aliphatic sulfonamides and one sulfamate, which acted in some cases as rather efficient inhibitors [18]. Dorzolamide, brinzolamife, and acetazolamide (AAZ) were medium-potency, high-micromolar inhibitors of these enzymes, being among the most effective ones detected so far [18]. However, no studies on the purification, catalytic activity, and inhibition of CAS3 are available to date. Here, we describe the purification, kinetic characterization, and inhibition studies of the cab-like β-CA of S. macrospora CAS3, with a panel of sulfonamides/sulfamates.

2. Results and Discussion

The protein encoded by the cas3 gene belongs to the cab-like sub-class of β-CAs and is localized to the cytoplasm [3]. Indeed, the cab-like CAs take their name from the enzyme discovered in the archaeon Methanobacterium thermoautotrophicum, which has only one such enzyme, called cab [9], and they are amongst the smallest CAs ever reported. Similar to cab, CAS3 that is reported here is composed of 174 amino-acid residues, with a calculated molecular mass of 19.2 kDa. CAS3 was synthesized in E. coli Rosetta (DE3) cells as a C-terminal His-tag fusion protein (Figure 1). After purification, 5–7.5 mg CAS3 could be obtained per L of culture. The purified enzyme was dialyzed against 50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) pH 8.3, 50 mM NaCl. To analyze the state of CAS3-His in solution, size‑exclusion chromatography and multi-angle laser light scattering (SEC-MALLS) was performed (Figure 1). The calculated molar mass of CAS3 amounts to 38,650 g∙mol−1 (±0.1%), which corresponds to 1.9 times of the CAS3 monomer (20.36 kDa) (Figure 1). These findings suggest that the biological unit of CAS3 is a homo-dimer in solution, which is the same as for cab and other β-CAs from fungi or bacteria that have been investigated to date [19,20,21,22,23].
The catalytic activity for the physiological CO2 hydration reaction that is catalyzed by these enzymes was investigated for the purified CAS3 by using a stopped-flow assay [24]. The activity of CAS3 was compared to those of the other two β-CAs present in the genome of this organism (CAS1 and 2), as well as with other similar enzymes from fungi/yeasts (Can2 from Cryptococcus neoformans [22], CalCA from Candida albicans [25], SceCA from Saccharomyces cerevisiae [26]), as well as the widespread human isoforms hCA I and II, belonging to the α-class [7]. As seen from data of Table 1, CAS3 has a catalytic activity that is an order of magnitude higher than CAS1 and CAS2, with the following kinetic parameters: kcat of (7.9 ± 0.2) × 105 s−1, and kcat/Km of (9.5 ± 0.12) × 107 M−1∙s−1. The activity of CAS3 is, thus, similar to that of CalCA and SceCA, being almost two times higher than that of the “slow” human isoform hCA I, a highly abundant enzyme in red blood cells [27]. Only hCA II among the investigated enzymes shown in Table 1 has a higher catalytic activity, but this enzyme is known to be one of the most effective catalysts in nature [7,8,9]. In addition, the CO2 hydrase activity was effectively inhibited by the clinically used sulfonamide acetazolamide, one of the most investigated CA inhibitors (CAIs) to date [7,8] (Table 1). Thus, apparently, CAS3 also has a higher affinity for sulfonamide inhibitors compared to CAS1 and 2, for which acetazolamide was a rather weak inhibitor, with KIs in the range of 445–816 nM (Table 1) [17,18].
We, thus, conducted a detailed inhibition study of CAS3 with a panel of sulfonamides and one sulfamate, of types 1–24 and AAZ–HCT (Figure 2). The latter compounds are in fact clinically used drugs as diuretics, antiglaucoma, antiepileptic, and antiobesity agents. They target some of the many human isoforms involved in these pathologies [28,29,30,31,32,33,34].
As seen from data of Table 2, sulfonamides/sulfamates 1–24 and AAZ–HCT inhibit CAS3 with various efficacies. Generally, they are active in the high nanomolar range, except sulthiame SLT and 8 which were micromolar inhibitors (KIs in the range of 2.07–4.83 µM). Many of the investigated compounds, both among the simple derivatives 1–18 or the more complex structures 19–24 or the clinically used agents, inhibited CAS3 with KIs < 100 nM, typically in the range of 54–95 nM. To this category of effective inhibitors belong the following derivatives: 1–3 (simple amino-benzenesulfonamides and benzene-1,3-disulfonamide); 12–14 (again, a benzene-1,3-disulfonamide derivative, 12, and the deacetylated precursors of acetazolamide and methazolamide, 13 and 14); 16 (4-hydroxymethyl-benzenesulfonamide); 19–24 (an amino-pyrimidinyl-sulfanilamide, 19, and the sulfanilyl-substituted aromatic/heterocyclic sulfonamides 20–24, all of them possessing a quite elongated moiety); AAZ, MZA, EZA, DCP, BRZ, BZA, and IND (clinically used or preclinical (IND) CAIs, possessing simple or more elaborated scaffolds). Thus, the structure–activity relationship (SAR) for CAS3 inhibition is not simple, since a rather large number of structurally different compounds show this profile of effective inhibitors. However, it may be observed that, with few exceptions, CAS3 is the isoform with the highest affinity for sulfonamides among the three S. macrospora isoforms investigated to date. Only CAS2 in some cases is more effectively inhibited by some compounds (compared to CAS3) [17,18], for example, with 13, 15, 17, and SLT (Table 2).
The remaining compounds showed less effective inhibition of CAS3, with KIs ranging between 191 and 831 nM. In this category of weak–medium inhibitors were the following compounds: 4–7; 9–11; 15; 17; 18; DZA; TPM–SLP; VLX; CLX; SAC; HCT. Again, they belong to a large variety of structural classes, from simple aromatic derivatives (4–7, 15, 17, 18) to heterocyclic ones, incorporating mono- or bicyclic ring systems (DZA, ZNS, VLX, CLX) to a sugar sulfamate (TPM), and the SAR is not straightforward.

3. Materials and Methods

3.1. Construction of the cas3 Overexpression Vector

RNA from S. macrospora was isolated as described in Reference [3]. To remove obsolete genomic DNA, the RNA was treated with DNase I (Thermo Scientific, EN0521, Waltham, MA, USA) according to the manufacturer’s manual. The “Transcriptor High Fidelity cDNA Synthesis kit” (Roche, Basil, Switzerland) was used for the reverse transcription reaction. Template concentration was 2 µg of RNA. The complementary DNA (cDNA) of the cas3 open reading frame (ORF; 525 bp) was amplified with primer pair CAS-pet-f (GGAGATATACATAATGATGCCCGTCACCAACGAAGA) and Cas3-pet-r (GGTGGTGGTGCTCGAGAACAACCCTCACCGTCTTGC). The obtained PCR fragment was cloned into the pET22b(+) expression plasmid (Novagen, Madison, WI, USA) linearized with NdeI and XhoI to create a 6×His fusion protein. The plasmid was named pET-CAS3.

3.2. Heterologous Expression of the cas3 Gene in E. coli

The production of the CAS3 protein was performed in E. coli strain Rosetta (DE3) (Invitrogen, Carlsbad, Germany). An overnight pre-culture was used to inoculate 4 × 0.5 L of Luria broth (LB) medium supplemented with 100 mg/L ampicillin and 0.5 mM ZnSO4. The cultures were grown to an OD600 of 0.1. Heterologous gene expression was then induced by the addition of 1 mM IPTG during the exponential phase of growth and lasted for 3–4 h at 30 °C. Subsequently, the cells were harvested (4000× g, 30 min, 4 °C) and flash‑frozen with liquid nitrogen and stored at −20 °C.
For determination of the protein concentration, 10 µL of the protein was mixed with 990 µL of Bradford reagent [35] and incubated for 2 min at RT. Then, the absorption was determined at 595 nm in a “Libra S12” (biochrom, Cambridge, UK) spectrophotometer in a 1-mL cuvette. Prior to this, a calibration line with bovine serum albumin was recorded.
The completeness of CAS3 was analyzed by mass spectrometry using the “LCQ DecaXP mass spectrometer” (Thermo Scientific, Waltham, MA, USA) and by SDS polyacrylamide gel electrophoresis (PAGE) [36]. CAS3 was separated on a 15% SDS PAGE with the protein standard (Pageruler™ Prestained Protein Ladder, SM0671, Thermo Fisher, Waltham, MA, USA). For visualization of the proteins after the electrophoresis, the gel was incubated for 30 min in SDS-gel staining solution (0.02% (w/v) Coomassie brilliant blue R250, 0.02% (w/v) Coomassie brilliant blue G250, 42.5% (v/v) ethanol, 0.5% (v/v) methanol, 10% (v/v) acetic acid), and afterward in SDS-gel distaining solution (45% (v/v) ethanol, 10% (v/v) acetic acid) for 30 min.

3.3. Purification of CAS3-His

For purification of CAS3, 10 g of E. coli cells were re-suspended in 30 mL of lysis buffer (20 mM imidazole, 50 mM NaH2PO4 pH 8, 300 mM NaCl, 0.02 mM MgCl2, one “Protease Inhibitor Cocktail” Tablet (Roche, Basil, Switzerland) and subsequently incubated for 30 min at 4 °C with a spatula tip of lysozyme (Serva, Heidelberg, Germany, 28262.03) and DNase I. After incubation, the cells were disrupted using a microfluidizer 110S (Microfluids, bonn, Germany). After centrifugation (50,000× g, 30 min, 4 °C), the clarified lysate was applied on an Ni-NTA agarose (Qiagen, Hilden, Germany, 1018244) column equilibrated with lysis buffer. Unbound proteins were removed by washing gradually with three column volumes (CV) of lysis buffer containing 40 mM, 60mM, 80 mM, and 100 mM imidazole. Bound CAS3 was eluted with lysis buffer containing 250 mM imidazole. Elution fractions were analyzed by SDS-PAGE, pooled, concentrated in a “Spin-X® UF 20” (Corning, Kaiserslautern, Germany), and stored at 4 °C. After purification, 5–7.5 mg of CAS3 could be obtained per L of culture.

3.4. Size-Exclusion Chromatography Coupled with Multi-Angle Laser Light Scattering

Four hundred microliters CAS3 (3 mg/mL) were loaded separately on a 24-mL analytical “Superdex 200 (10/300)” gel filtration column using an “Äkta purifier” coupled to a “miniDAWN MALS” detector (Wyatt Technology, Santa Barbara, CA, USA). The column was pre-equilibrated with 50 mM NaH2PO4 pH 8.0, 250 mM imidazole, 300 mM NaCl. Multi-angle laser light-scattering analysis was performed continuously on the column eluate at 291 K (size-exclusion chromatography coupled with multi-angle laser light scattering, SEC-MALLS). Data analysis was carried out with Astra software (Wyatt Technology, Santa Barbara, CA, USA).

3.5. CA Inhibition Assay

An Applied Photophysics stopped-flow instrument was used for assaying the CA catalyzed CO2 hydration activity [24]. The pH indicator used was bromothymol blue at a concentration of 0.2 mM, working at the absorbance maximum of 557 nm. The buffer used was 20 mM Tris (pH 8.3), and 20 mM Na2SO4 was added to this buffer for maintaining constant the ionic strength (sulfate is not inhibitory and has a KI > 200 mM against this enzyme; data not shown). The initial rates of the CA-catalyzed CO2 hydration were followed for a period of 10–100 s for each assay. The CO2 concentrations ranged from 1.7 to 17 mM for determining kinetic parameters of the reaction and the inhibition constants of tested inhibitors. For each measurement, six traces of the initial 5%–10% of the reaction were used for determining the initial velocity. Then, 10-fold decreasing dilution of inhibitor solutions, ranging from 1 nM and 100 µM were employed for determining the inhibition constants. Uncatalyzed rates were determined in the same manner and subtracted from total observed rates. Stock solutions of inhibitor (0.1 mM) were prepared in distilled deionized water, and dilutions up to 1 nM were done thereafter with the assay buffer. Inhibitor and enzyme solutions were preincubated together for 15 min at room temperature before to assay for allowing for the formation of E–I complexes. The inhibition constants were obtained by non-linear least-squares methods using the Cheng–Prusoff equation, and they represent the mean from at least three different determinations. The human isoforms hCA I, II were assayed in the same conditions as above except that the working pH was 7.4 HEPES buffer with phenol red as an indicator [21,22]. The inhibition constants measured by this method are in excellent agreement with the dissociation constants measured by native mass spectrometry [37,38].

4. Conclusions

Fungal CAs are of great interest both for biotechnological and pharmaceutical applications [10] because some of these enzymes are stable, relatively easy to produce, and may be used as model enzymes for testing inhibitors/activators. The organism Sordaria macrospora, used as a genetic model to study fruiting body development of filamentous fungi, encodes for at least four different CAs, two of which were thoroughly investigated earlier, CAS1 and CAS2. Here, we prove that CAS3, another representative enzyme from this organism, belonging to the β-CA class, may be of interest for better understanding the roles these proteins play in various physiologic processes of fungi. Unlike CAS1 and CAS2, which showed rather low catalytic activity for the hydration of CO2 to bicarbonate and protons, CAS3 is a highly effective catalyst, showing kinetic parameters comparable to those of other fungal/mammalian enzymes, i.e., kcat of (7.9 ± 0.2) × 105 s−1, and kcat/Km of (9.5 ± 0.12) × 107 M−1∙s−1. A detailed inhibition study of CAS3 with sulfonamides and one sulfamate allowed us to demonstrate that this enzyme has higher affinity for these inhibitors compared to CAS1 and CAS2, with clinically used agents such as benzolamide, brinzolamide, dichlorophnamide, methazolamide, acetazolamide, ethoxzolamide, sulfamilamide, metanilamide, and benzene-1,3-disulfonamide possessing KIs under 100 nM.

Author Contributions

D.V. performed the enzyme kinetics and all the inhibition assays; R.L. performed the cloning, expression, and purification of the recombinant coral enzyme; W.A.D., C.T.S., and S.P. supervised the experiments and checked the results of performed experiments, as well as wrote and edited the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Deutsche Forschungsgemienschaft grant number PO523/5-1 to S.P.

Acknowledgments

This research was financed in part by the Australian Research Council for funding to W.A.D. and C.T.S., and by the Deutsche Forschungsgemienschaft PO523/5-1 to S.P.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Teichert, I.; Nowrousian, M.; Pöggeler, S.; Kück, U. The filamentous fungus Sordaria macrospora as a genetic model to study fruiting body development. Adv. Genet. 2014, 87, 201–246. [Google Scholar]
  2. Elleuche, S.; Pöggeler, S. Evolution of carbonic anhydrases in fungi. Curr. Genet. 2009, 55, 211–222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Elleuche, S.; Pöggeler, S. β-Carbonic anhydrases play a role in fruiting body development and ascospore germination in the filamentous fungus Sordaria macrospora. PLoS ONE 2009, 4, e5177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Elleuche, S.; Pöggeler, S. Carbonic anhydrases in fungi. Microbiology 2010, 156, 23–29. [Google Scholar] [CrossRef] [Scilit]
  5. Lehneck, R.; Elleuche, S.; Pöggeler, S. The filamentous ascomycete Sordaria macrospora can survive in ambient air without carbonic anhydrases. Mol. Microbiol. 2014, 95, 931–944. [Google Scholar] [CrossRef] [Scilit]
  6. Innocenti, A.; Zimmerman, S.; Ferry, J.G.; Scozzafava, A.; Supuran, C.T. Carbonic anhydrase inhibitors. Inhibition of the beta-class enzyme from the methanoarchaeon Methanobacterium thermoautotrophicum (cab) with anions. Bioorg. Med. Chem. Lett. 2004, 14, 4563–4567. [Google Scholar]
  7. Supuran, C.T. Structure and function of carbonic anhydrases. Biochem. J. 2016, 473, 2023–2032. [Google Scholar] [CrossRef] [Scilit]
  8. Supuran, C.T. Carbonic anhydrases: Novel therapeutic applications for inhibitors and activators. Nature Rev. Drug Discov. 2008, 7, 168–181. [Google Scholar] [CrossRef] [Scilit]
  9. Zimmerman, S.A.; Ferry, J.G.; Supuran, C.T. Inhibition of the archaeal beta-class (Cab) and gamma-class (Cam) carbonic anhydrases. Curr. Top. Med. Chem. 2007, 7, 901–908. [Google Scholar] [CrossRef] [Scilit]
  10. Lehneck, R.; Pöggeler, S. Fungal carbonic anhydrases and their inhibition. In Zinc Enzyme Inhibitor -Volume 1: Enzymes from microorganisms; Supuran, C.T., Capasso, C., Eds.; Topics in Medicinal Chemistry; Springer International Publishing AG: Cham, Swizerland, 2017; Volume 22, pp. 95–110. [Google Scholar]
  11. Supuran, C.T. Advances in structure-based drug discovery of carbonic anhydrase inhibitors. Expert Opin. Drug Discov. 2017, 12, 61–88. [Google Scholar] [CrossRef] [Scilit]
  12. Supuran, C.T.; Capasso, C. Biomedical applications of prokaryotic carbonic anhydrases. Expert Opin. Ther. Pat. 2018, 28, 745–754. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Nocentini, A.; Supuran, C.T. Advances in the structural annotation of human carbonic anhydrases and impact on future drug discovery. Expert Opin. Drug Discov. 2019, 14, 1175–1197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Annunziato, G.; Giovati, L.; Angeli, A.; Pavone, M.; Del Prete, S.; Pieroni, M.; Capasso, C.; Bruno, A.; Conti, S.; Magliani, W.; et al. Discovering a new class of antifungal agents that selectively inhibits microbial carbonic anhydrases. J. Enzyme Inhib. Med. Chem. 2018, 33, 1537–1544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Nocentini, A.; Vullo, D.; Del Prete, S.; Osman, S.M.; Alasmary, F.A.S.; AlOthman, Z.; Capasso, C.; Carta, F.; Gratteri, P.; Supuran, C.T. Inhibition of the beta-carbonic anhydrase from the dandruff-producing fungus Malassezia globosa with monothiocarbamates. J. Enzyme Inhib. Med. Chem. 2017, 32, 1064–1070. [Google Scholar] [CrossRef] [Scilit]
  16. Del Prete, S.; Angeli, A.; Ghobril, C.; Hitce, J.; Clavaud, C.; Marat, X.; Supuran, C.T.; Capasso, C. Sulfonamide Inhibition Profile of the β-Carbonic Anhydrase from Malassezia restricta, An Opportunistic Pathogen Triggering Scalp Conditions. Metabolites 2020, 10, E39. [Google Scholar] [CrossRef] [Scilit]
  17. Lehneck, R.; Neumann, P.; Vullo, D.; Elleuche, S.; Supuran, C.T.; Ficner, R.; Pöggeler, S. Crystal structures of two tetrameric β-carbonic anhydrases from the filamentous ascomycete Sordaria macrospora. FEBS J. 2014, 281, 1759–1772. [Google Scholar] [CrossRef] [Scilit]
  18. Vullo, D.; Lehneck, R.; Pöggeler, S.; Supuran, C.T. Sulfonamide inhibition studies of two β-carbonic anhydrases from the ascomycete fungus Sordaria macrospora, CAS1 and CAS2. J. Enzyme Inhib. Med. Chem. 2018, 33, 390–396. [Google Scholar] [CrossRef] [Scilit]
  19. Del Prete, S.; De Luca, V.; Vullo, D.; Osman, S.M.; AlOthman, Z.; Carginale, V.; Supuran, C.T.; Capasso, C. A new procedure for the cloning, expression and purification of the beta-carbonic anhydrase from the pathogenic yeast Malassezia globosa, an anti-dandruff drug target. J. Enzyme Inhib. Med. Chem. 2016, 31, 1156–1161. [Google Scholar] [CrossRef] [Scilit]
  20. Ferraroni, M.; Del Prete, S.; Vullo, D.; Capasso, C.; Supuran, C.T. Crystal structure and kinetic studies of a tetrameric type II beta-carbonic anhydrase from the pathogenic bacterium Vibrio cholerae. Acta Crystallogr. D Biol. Crystallogr. 2015, 71, 2449–2456. [Google Scholar] [CrossRef] [Scilit]
  21. Nishimori, I.; Minakuchi, T.; Vullo, D.; Scozzafava, A.; Innocenti, A.; Supuran, C.T. Carbonic anhydrase inhibitors. Cloning, characterization, and inhibition studies of a new beta-carbonic anhydrase from Mycobacterium tuberculosis. J. Med. Chem. 2009, 52, 3116–3120. [Google Scholar] [CrossRef] [Scilit]
  22. Schlicker, C.; Hall, R.A.; Vullo, D.; Middelhaufe, S.; Gertz, M.; Supuran, C.T.; Muhlschlegel, F.A.; Steegborn, C. Structure and inhibition of the CO2-sensing carbonic anhydrase Can2 from the pathogenic fungus Cryptococcus neoformans. J. Mol. Biol. 2009, 385, 1207–1220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Supuran, C.T.; Capasso, C. An Overview of the Bacterial Carbonic Anhydrases. Metabolites. 2017, 7, E56. [Google Scholar] [CrossRef] [Scilit]
  24. Khalifah, R.G. The carbon dioxide hydration activity of carbonic anhydrase. I. Stop-flow kinetic studies on the native human isoenzymes B and C. J. Biol. Chem. 1971, 246, 2561–2573. [Google Scholar] [PubMed]
  25. Innocenti, A.; Hall, R.A.; Schlicker, C.; Scozzafava, A.; Steegborn, C.; Mühlschlegel, F.A.; Supuran, C.T. Carbonic anhydrase inhibitors. Inhibition and homology modeling studies of the fungal beta-carbonic anhydrase from Candida albicans with sulfonamides. Bioorg. Med. Chem. 2009, 17, 4503–4509. [Google Scholar] [PubMed]
  26. Isik, S.; Kockar, F.; Arslan, O.; Guler, O.O.; Innocenti, A.; Supuran, C.T. Carbonic anhydrase inhibitors. Inhibition of the beta-class enzyme from the yeast Saccharomyces cerevisiae with anions. Bioorg. Med. Chem. Lett. 2008, 18, 6327–6331. [Google Scholar] [CrossRef] [Scilit]
  27. Durdagi, S.; Vullo, D.; Pan, P.; Kähkönen, N.; Määttä, J.A.; Hytönen, V.P.; Scozzafava, A.; Parkkila, S.; Supuran, C.T. Protein-protein interactions: Inhibition of mammalian carbonic anhydrases I-XV by the murine inhibitor of carbonic anhydrase and other members of the transferrin family. J. Med. Chem. 2012, 55, 5529–5535. [Google Scholar] [CrossRef] [Scilit]
  28. Carta, F.; Scozzafava, A.; Supuran, C.T. Sulfonamides: A patent review (2008–2012). Expert Opin. Ther. Pat. 2012, 22, 747–758. [Google Scholar] [CrossRef] [Scilit]
  29. Supuran, C.T. Applications of carbonic anhydrases inhibitors in renal and central nervous system diseases. Expert Opin. Ther. Pat. 2018, 28, 713–721. [Google Scholar] [CrossRef] [Scilit]
  30. Supuran, C.T. Carbonic anhydrase inhibitors and their potential in a range of therapeutic areas. Expert Opin. Ther. Pat. 2018, 28, 709–712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Supuran, C.T. Carbonic anhydrase inhibitors as emerging drugs for the treatment of obesity. Expert Opin. Emerg. Drugs 2012, 17, 11–15. [Google Scholar] [CrossRef] [Scilit]
  32. Supuran, C.T.; Altamimi, A.S.A.; Carta, F. Carbonic anhydrase inhibition and the management of glaucoma: A literature and patent review 2013–2019. Expert Opin. Ther. Pat. 2019, 29, 781–792. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Supuran, C.T. Carbonic anhydrase inhibitors as emerging agents for the treatment and imaging of hypoxic tumors. Expert Opin. Investig. Drugs 2018, 27, 963–970. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Supuran, C.T. The management of glaucoma and macular degeneration. Expert Opin. Ther. Pat. 2019, 29, 745–747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  36. Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680–685. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Nguyen, G.T.H.; Tran, T.N.; Podgorski, M.N.; Bell, S.G.; Supuran, C.T.; Donald, W.A. Nanoscale Ion Emitters in Native Mass Spectrometry for Measuring Ligand-Protein Binding Affinities. ACS. Cent. Sci. 2019, 5, 308–318. [Google Scholar] [CrossRef] [Scilit]
  38. Nocentini, A.; Donald, W.A.; Supuran, C.T. Human carbonic anhydrases: Tissue distribution, physiological role, and druggability. In Carbonic Anhydrases–Biochemistry and Pharmacology of an Evergreen Pharmaceutical Target; Supuran, C.T., Nocentini, A., Eds.; Elsevier–Academic Press: London, UK, 2019; pp. 151–185. [Google Scholar]
Sample Availability: Samples of the inhibitors are potentially available upon request from the authors.
Figure 1. Purification and size-exclusion chromatography (SEC) of carbonic anhydrase 3 (CAS3)-His on a Superdex 200 10/300 column coupled with multi-angle laser light scattering. (A) Coomassie-stained, 15% SDS gel of purified CAS3-His. After washing of unbound proteins, the His-tagged enzymes were eluted by addition of 500 µL of elution buffer. Then, 10 µL of the protein solution was separated by SDS-PAGE. The expected protein size is 20.36 kDa. (B) Size-exclusion chromatography CAS3-His (black line) on a Superdex 200 10/300 column coupled with multi-angle laser light scattering (gray line). The reference proteins for SEC had the following elution profile: 670 kDa = 8.16 mL (thyroglobulin), 158 kDa = 12.54 mL (γ-globulin), 44 kDa = 15.08 mL (ovalbumin), 17 kDa = 17.21 mL (myoglobin), 1.35 kDa = 20.46 mL (vitamin B12). The calculated molar mass of CAS3 amounts to 38,650 g∙mol−1 (±0.1%), which corresponds to 1.9 times of the CAS3 monomer (20.36 kDa) (C). Peak 1 in the CAS3 elution profile is very likely due to protein aggregates that eluted close to the void volume of the column. Peak 2 represents the CAS3-His protein.
Figure 1. Purification and size-exclusion chromatography (SEC) of carbonic anhydrase 3 (CAS3)-His on a Superdex 200 10/300 column coupled with multi-angle laser light scattering. (A) Coomassie-stained, 15% SDS gel of purified CAS3-His. After washing of unbound proteins, the His-tagged enzymes were eluted by addition of 500 µL of elution buffer. Then, 10 µL of the protein solution was separated by SDS-PAGE. The expected protein size is 20.36 kDa. (B) Size-exclusion chromatography CAS3-His (black line) on a Superdex 200 10/300 column coupled with multi-angle laser light scattering (gray line). The reference proteins for SEC had the following elution profile: 670 kDa = 8.16 mL (thyroglobulin), 158 kDa = 12.54 mL (γ-globulin), 44 kDa = 15.08 mL (ovalbumin), 17 kDa = 17.21 mL (myoglobin), 1.35 kDa = 20.46 mL (vitamin B12). The calculated molar mass of CAS3 amounts to 38,650 g∙mol−1 (±0.1%), which corresponds to 1.9 times of the CAS3 monomer (20.36 kDa) (C). Peak 1 in the CAS3 elution profile is very likely due to protein aggregates that eluted close to the void volume of the column. Peak 2 represents the CAS3-His protein.
Molecules 25 01036 g001
Figure 2. Structure of sulfonamide and sulfamate inhibitors of types 1–24 and AAZ–HCT investigated in the present study.
Figure 2. Structure of sulfonamide and sulfamate inhibitors of types 1–24 and AAZ–HCT investigated in the present study.
Molecules 25 01036 g002aMolecules 25 01036 g002b
Table 1. Kinetic parameters for the CO2 hydration reaction [24] catalyzed by the human cytosolic enzymes hCA I and II (α-class CAs) at 20 °C and pH 7.5, and the β-CAs Can2, CalCA (from Cryptococcus neoformans and Candida albicans, respectively), SceCA (from Saccharomyces cerevisiae), as well as the enzymes from Sordaria macrospora, CAS1–CAS3, measured at 20 °C, pH 8.3. Inhibition data with the clinically used sulfonamide acetazolamide (5-acetamido-1,3,4-thiadiazole-2-sulfonamide) are also provided.
Table 1. Kinetic parameters for the CO2 hydration reaction [24] catalyzed by the human cytosolic enzymes hCA I and II (α-class CAs) at 20 °C and pH 7.5, and the β-CAs Can2, CalCA (from Cryptococcus neoformans and Candida albicans, respectively), SceCA (from Saccharomyces cerevisiae), as well as the enzymes from Sordaria macrospora, CAS1–CAS3, measured at 20 °C, pH 8.3. Inhibition data with the clinically used sulfonamide acetazolamide (5-acetamido-1,3,4-thiadiazole-2-sulfonamide) are also provided.
IsozymeActivity LevelKcat (s−1)Kcat/Km (M−1∙s−1)KI (Acetazolamide) (nM)
hCA I aModerate2.0 × 1055.0 × 107250
hCA II aVery high1.4 × 1061.5 × 10812
Can2 bModerate3.9 × 1054.3 × 10710.5
CalCA cHigh8.0 × 1059.7 × 107132
SceCA cHigh9.4 × 1059.8 × 10782
CAS1 dLow1.2 × 1041.30 × 106445
CAS2 dLow1.3 × 1041.21 × 106816
CAS3 eHigh(7.9 ± 0.2) × 105(9.5 ± 0.12) × 10794 ± 3
a From References [7,8]; b from reference [22]; c from reference [12]; d from reference [17]; e this work: mean ± standard error, from three different assays.
Table 2. Inhibition of human isoforms hCA I and hCA II, and of the β-class fungal enzymes CAS1–CAS3 with sulfonamides 1–24 and the clinically used drugs AAZ–HCT, by a stopped flow CO2 hydrase assay [24].
Table 2. Inhibition of human isoforms hCA I and hCA II, and of the β-class fungal enzymes CAS1–CAS3 with sulfonamides 1–24 and the clinically used drugs AAZ–HCT, by a stopped flow CO2 hydrase assay [24].
Inhibitor/
Enzyme
Class
KI* (nM)
hCA IahCA II aCAS1bCAS2 bCAS3 c
ααβββ
128,00030036138690 ± 7.1
225,000240144348084 ± 5.6
379 c8225363083 ± 6.0
478,50032047.16900560 ± 21
525,0001703238720726 ± 30
621,0001602417650441 ± 14
783006043.27360585 ± 23
8980011079.691202078 ± 61
965004058012,000712 ± 28
10730054>50,00023,500350 ± 13
1158006389018,700235 ± 16
128400753350>50,00090 ± 5.7
13860060865048.188 ± 2.9
14930019721528094 ± 4.1
155500803160143605 ± 23
16950094452092.582 ± 3.7
1721,000125>50,000390507 ± 26
181644644353250226 ± 13
1910933475676091 ± 4.4
2062363988085 ± 2.7
2169114550406095 ± 3.9
2216446198525,20085 ± 2.6
2310933282>50,00089 ± 3.4
249530294>50,00084 ± 1.5
AAZ2501244581694 ± 3.0
MZA5014421814091 ± 6.2
EZA258440317095 ± 2.8
DCP1200381220579073 ± 3.0
DZA50,0009360742274 ± 14
BRZ45,000345173961 ± 1.4
BZA159211541054 ± 0.9
TPM25010414673363 ± 23
ZNS563518201885710 ± 40
SLP1200401715670493 ± 27
IND3115424021694 ± 4.6
VLX54,0004344253730831 ± 38
CLX50,000212513857669 ± 29
SLT374932104964838 ± 257
SAC18,540595952807075191 ± 12
HCT32829033506680545 ± 41
a From references [7,8]; b from reference [17]; c this work: mean ± standard error, from three different assays.

Share and Cite

MDPI and ACS Style

Vullo, D.; Lehneck, R.; Donald, W.A.; Pöggeler, S.; Supuran, C.T. Sulfonamide Inhibition Studies of the β-Class Carbonic Anhydrase CAS3 from the Filamentous Ascomycete Sordaria macrospora. Molecules 2020, 25, 1036. https://doi.org/10.3390/molecules25051036

AMA Style

Vullo D, Lehneck R, Donald WA, Pöggeler S, Supuran CT. Sulfonamide Inhibition Studies of the β-Class Carbonic Anhydrase CAS3 from the Filamentous Ascomycete Sordaria macrospora. Molecules. 2020; 25(5):1036. https://doi.org/10.3390/molecules25051036

Chicago/Turabian Style

Vullo, Daniela, Ronny Lehneck, William A. Donald, Stefanie Pöggeler, and Claudiu T. Supuran. 2020. "Sulfonamide Inhibition Studies of the β-Class Carbonic Anhydrase CAS3 from the Filamentous Ascomycete Sordaria macrospora" Molecules 25, no. 5: 1036. https://doi.org/10.3390/molecules25051036

APA Style

Vullo, D., Lehneck, R., Donald, W. A., Pöggeler, S., & Supuran, C. T. (2020). Sulfonamide Inhibition Studies of the β-Class Carbonic Anhydrase CAS3 from the Filamentous Ascomycete Sordaria macrospora. Molecules, 25(5), 1036. https://doi.org/10.3390/molecules25051036

Article Metrics

Back to TopTop