Water Extract of Lotus Leaf Alleviates Dexamethasone-Induced Muscle Atrophy via Regulating Protein Metabolism-Related Pathways in Mice
Abstract
1. Introduction
2. Results
2.1. LL Administration Has a Positive Effect on Calf Muscle Volume, Surface Area, and Density in DEX-Induced Muscle Atrophy Mice
2.2. Intake of LL Improves the Muscle Function in DEX-Induced Muscle Atrophy Mice
2.3. Oral Administration of LL Prevents DEX-Induced Calf Muscle Damage
2.4. LL Negatively Regulates a Proteolysis-Related Pathway
2.5. LL Administration Increases the Protein Synthesis-Related Pathway
2.6. LL Contains Q3G as a Major Active Component
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Preparation of LL
4.3. Animal Experiment
4.4. Cell Culture
4.5. Micro-Computed Tomography (CT) Imaging
4.6. Running Test
4.7. Grip Strength Test
4.8. Histology
4.9. Real-Time Polymerase Chain Reaction (PCR)
4.10. Western Blotting Analysis
4.11. High-Performance Liquid Chromatography (HPLC) Analysis
4.12. MTT Assay
4.13. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- McKinnell, I.W.; Rudnicki, M.A. Molecular mechanisms of muscle atrophy. Cell 2004, 119, 907–910. [Google Scholar] [CrossRef] [PubMed]
- Marcell, T.J. Sarcopenia: Causes, consequences, and preventions. J. Gerontol. A. Biol. Sci. Med. Sci. 2003, 58, M911–M916. [Google Scholar] [CrossRef] [PubMed]
- Engelke, K.; Museyko, O.; Wang, L.; Laredo, J.D. Quantitative analysis of skeletal muscle by computed tomography imaging-State of the art. J. Orthop. Translat. 2018, 15, 91–103. [Google Scholar] [CrossRef] [PubMed]
- Morley, J.E.; Thomas, D.R.; Wilson, M.M. Cachexia: Pathophysiology and clinical relevance. Am. J. Clin. Nutr. 2006, 83, 735–743. [Google Scholar] [CrossRef] [PubMed]
- Furrer, R.; Handschin, C. Muscle wasting diseases: Novel targets and treatments. Annu. Rev. Pharmacol. Toxicol. 2019, 59, 315–339. [Google Scholar] [CrossRef]
- Bodine, S.C.; Latres, E.; Baumhueter, S.; Lai, V.K.; Nunez, L.; Clarke, B.A.; Poueymirou, W.T.; Panaro, F.J.; Na, E.; Dharmarajan, K.; et al. Identification of ubiquitin ligases required for skeletal muscle atrophy. Science 2001, 294, 1704–1708. [Google Scholar] [CrossRef]
- Gomes, M.D.; Lecker, S.H.; Jagoe, R.T.; Navon, A.; Goldberg, A.L. Atrogin-1, a muscle-specific F-box protein highly expressed during muscle atrophy. Proc. Natl. Acad. Sci. USA 2001, 98, 14440–14445. [Google Scholar] [CrossRef]
- Foletta, V.C.; White, L.J.; Larsen, A.E.; Leger, B.; Russell, A.P. The role and regulation of MAFbx/atrogin-1 and MuRF1 in skeletal muscle atrophy. Pflügers Arch.-Eur. J. Physiol. 2011, 461, 325–335. [Google Scholar] [CrossRef]
- Sandri, M.; Sandri, C.; Gilbert, A.; Skurk, C.; Calabria, E.; Picard, A.; Walsh, K.; Schiaffino, S.; Lecker, S.H.; Goldberg, A.L. Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell 2004, 117, 399–412. [Google Scholar] [CrossRef]
- Senf, S.M.; Dodd, S.L.; Judge, A.R. FOXO signaling is required for disuse muscle atrophy and is directly regulated by Hsp70. Am. J. Physiol. Cell. Physiol. 2010, 298, C38–C45. [Google Scholar] [CrossRef]
- Wang, X.; Hu, S.; Liu, L. Phosphorylation and acetylation modifications of FOXO3a: Independently or synergistically? Oncol. Lett. 2017, 13, 2867–2872. [Google Scholar] [CrossRef] [PubMed]
- Greer, E.L.; Oskoui, P.R.; Banko, M.R.; Maniar, J.M.; Gygi, M.P.; Gygi, S.P.; Brunet, A. The energy sensor AMP-activated protein kinase directly regulates the mammalian FOXO3 transcription factor. J. Biol. Chem. 2007, 282, 30107–30119. [Google Scholar] [CrossRef] [PubMed]
- Hardie, D.G.; Carling, D.; Halford, N. Roles of the Snf1/Rkin1/AMP-activated protein kinase family in the response to environmental and nutritional stress. Semin. Cell Biol. 1994, 5, 409–416. [Google Scholar] [CrossRef]
- Yoon, M.-S. mTOR as a key regulator in maintaining skeletal muscle mass. Front. Physiol. 2017, 8, 788. [Google Scholar] [CrossRef] [PubMed]
- Nader, G.A.; McLoughlin, T.J.; Esser, K.A. mTOR function in skeletal muscle hypertrophy: Increased ribosomal RNA via cell cycle regulators. Am. J. Physiol. Cell. Physiol. 2005, 289, C1457–C1465. [Google Scholar] [CrossRef]
- Parkington, J.D.; LeBrasseur, N.K.; Siebert, A.P.; Fielding, R.A. Contraction-mediated mTOR, p70S6k, and ERK1/2 phosphorylation in aged skeletal muscle. J. Appl. Physiol. 2004, 97, 243–248. [Google Scholar] [CrossRef]
- Liu, X.; Joshi, S.K.; Samagh, S.P.; Dang, Y.X.; Laron, D.; Lovett, D.H.; Bodine, S.C.; Kim, H.T.; Feeley, B.T. Evaluation of Akt/mTOR activity in muscle atrophy after rotator cuff tears in a rat model. J. Orthop. Res. 2012, 30, 1440–1446. [Google Scholar] [CrossRef]
- Manning, B.D.; Tee, A.R.; Logsdon, M.N.; Blenis, J.; Cantley, L.C. Identification of the tuberous sclerosis complex-2 tumor suppressor gene product tuberin as a target of the phosphoinositide 3-kinase/akt pathway. Mol. Cell 2002, 10, 151–162. [Google Scholar] [CrossRef]
- Sancak, Y.; Thoreen, C.C.; Peterson, T.R.; Lindquist, R.A.; Kang, S.A.; Spooner, E.; Carr, S.A.; Sabatini, D.M. PRAS40 is an insulin-regulated inhibitor of the mTORC1 protein kinase. Mol. Cell 2007, 25, 903–915. [Google Scholar] [CrossRef]
- Mukherjee, P.K.; Mukherjee, D.; Maji, A.K.; Rai, S.; Heinrich, M. The sacred lotus (Nelumbo nucifera)—phytochemical and therapeutic profile. J. Pharm. Pharmacol. 2009, 61, 407–422. [Google Scholar] [CrossRef]
- Chopra, R.; Nayar, S.; Chopra, I. Glossary of Indian Medicinal Plants; Council of Scientific & Industrial Research: New Delhi, India, 1956. [Google Scholar]
- Liu, C.-P.; Tsai, W.-J.; Lin, Y.-L.; Liao, J.-F.; Chen, C.-F.; Kuo, Y.-C. The extracts from Nelumbo nucifera suppress cell cycle progression, cytokine genes expression, and cell proliferation in human peripheral blood mononuclear cells. Life Sci. 2004, 75, 699–716. [Google Scholar] [CrossRef] [PubMed]
- Wu, M.J.; Wang, L.; Weng, C.Y.; Yen, J.H. Antioxidant activity of methanol extract of the lotus leaf (Nelumbo nucifera Gertn.). Am. J. Chin. Med. 2003, 31, 687–698. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.-W.; Kim, Y.-H.; Shin, K.-O. In vitro antioxidant activities and antimicrobial activity of lotus (leaf, stem, and seed pod) extracts. Korean J. Food Nutr. 2017, 30, 771–779. [Google Scholar]
- Kashiwada, Y.; Aoshima, A.; Ikeshiro, Y.; Chen, Y.P.; Furukawa, H.; Itoigawa, M.; Fujioka, T.; Mihashi, K.; Cosentino, L.M.; Morris-Natschke, S.L.; et al. Anti-HIV benzylisoquinoline alkaloids and flavonoids from the leaves of Nelumbo nucifera, and structure-activity correlations with related alkaloids. Bioorg. Med. Chem. 2005, 13, 443–448. [Google Scholar] [CrossRef] [PubMed]
- Ono, Y.; Hattori, E.; Fukaya, Y.; Imai, S.; Ohizumi, Y. Anti-obesity effect of Nelumbo nucifera leaves extract in mice and rats. J. Ethnopharmacol. 2006, 106, 238–244. [Google Scholar] [CrossRef]
- Ábrigo, J.; Elorza, A.A.; Riedel, C.A.; Vilos, C.; Simon, F.; Cabrera, D.; Estrada, L.; Cabello-Verrugio, C. Role of oxidative stress as key regulator of muscle wasting during cachexia. Oxid. Med. Cell. Longev. 2018, 2018. [Google Scholar] [CrossRef]
- Jackson, M.J. Reactive oxygen species in sarcopenia: Should we focus on excess oxidative damage or defective redox signalling? Mol. Aspects Med. 2016, 50, 33–40. [Google Scholar] [CrossRef]
- Wei, X.; Luo, L.; Chen, J. Roles of mTOR signaling in tissue regeneration. Cells 2019, 8, 1075. [Google Scholar] [CrossRef]
- Bodine, S.C.; Stitt, T.N.; Gonzalez, M.; Kline, W.O.; Stover, G.L.; Bauerlein, R.; Zlotchenko, E.; Scrimgeour, A.; Lawrence, J.C.; Glass, D.J. Akt/mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo. Nat. Cell Biol. 2001, 3, 1014–1019. [Google Scholar] [CrossRef]
- Kumar, S.; Pandey, A.K. Chemistry and biological activities of flavonoids: An overview. Sci. World J. 2013, 2013, 162750. [Google Scholar] [CrossRef] [PubMed]
- Gullett, N.P.; Hebbar, G.; Ziegler, T.R. Update on clinical trials of growth factors and anabolic steroids in cachexia and wasting. Am. J. Clin. Nutr. 2010, 91, 1143S–1147S. [Google Scholar] [CrossRef] [PubMed]
- Ruiz Garcia, V.; Lopez-Briz, E.; Carbonell Sanchis, R.; Gonzalvez Perales, J.L.; Bort-Marti, S. Megestrol acetate for treatment of anorexia-cachexia syndrome. Cochrane Database Syst. Rev. 2013, CD004310. [Google Scholar] [CrossRef] [PubMed]
- Almaiman, A.A.; Almaiman, S.H.; Elagamy, E.I.; Al Wutayd, O.; Almarzuqi, M.; Alzunaidi, R.; Alhatlani, S.; Eid, E.E. Side effects of anabolic steroids used by athletes at Unaizah Gyms, Saudi Arabia: A pilot study. J. Sports Med. Phys. Fitness 2019, 59, 489–495. [Google Scholar] [CrossRef]
- Wang, L.; Luo, G.J.; Wang, J.J.; Hasselgren, P.O. Dexamethasone stimulates proteasome- and calcium-dependent proteolysis in cultured L6 myotubes. Shock 1998, 10, 298–306. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.F.; Zhang, Y.; Li, B.; Chen, N. Physical inactivity induces the atrophy of skeletal muscle of rats through activating AMPK/FoxO3 signal pathway. Eur. Rev. Med. Pharmacol. Sci. 2018, 22, 199–209. [Google Scholar] [PubMed]
- Wang, X.J.; Yang, X.; Wang, R.X.; Jiao, H.C.; Zhao, J.P.; Song, Z.G.; Lin, H. Leucine alleviates dexamethasone-induced suppression of muscle protein synthesis via synergy involvement of mTOR and AMPK pathways. Biosci. Rep. 2016, 36. [Google Scholar] [CrossRef] [PubMed]
- Ogasawara, R.; Fujita, S.; Hornberger, T.A.; Kitaoka, Y.; Makanae, Y.; Nakazato, K.; Naokata, I. The role of mTOR signalling in the regulation of skeletal muscle mass in a rodent model of resistance exercise. Sci. Rep. 2016, 6, 31142. [Google Scholar] [CrossRef]
- Drummond, M.J.; Rasmussen, B.B. Leucine-enriched nutrients and the regulation of mTOR signalling and human skeletal muscle protein synthesis. Curr. Opin. Clin. Nutr. Metab. Care 2008, 11, 222. [Google Scholar] [CrossRef]
- Bouktaib, M.; Atmani, A.; Rolando, C. Regio-and stereoselective synthesis of the major metabolite of quercetin, quercetin-3-O-β-d-glucuronide. Tetrahedron Lett. 2002, 43, 6263–6266. [Google Scholar] [CrossRef]
- Bentz, A.B. A Review of Quercetin: Chemistry, Antioxident Properties, and Bioavailability. Available online: https://www.jyi.org/2009-april/2017/10/15/a-review-of-quercetin-chemistry-antioxidant-properties-and-bioavailability (accessed on 2 October 2020).
- Uddin, S.; Ahmad, S. Dietary antioxidants protection against oxidative stress. Biochem. Educ. 1995, 23, 2–7. [Google Scholar] [CrossRef]
- Mukai, R.; Nakao, R.; Yamamoto, H.; Nikawa, T.; Takeda, E.; Terao, J. Quercetin prevents unloading-derived disused muscle atrophy by attenuating the induction of ubiquitin ligases in tail-suspension mice. J. Nat. Prod. 2010, 73, 1708–1710. [Google Scholar] [CrossRef] [PubMed]
- Mukai, R.; Matsui, N.; Fujikura, Y.; Matsumoto, N.; Hou, D.X.; Kanzaki, N.; Shibata, H.; Horikawa, M.; Iwasa, K.; Hirasaka, K.; et al. Preventive effect of dietary quercetin on disuse muscle atrophy by targeting mitochondria in denervated mice. J. Nutr. Biochem. 2016, 31, 67–76. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Needs, P.W.; Lu, Y.; Kroon, P.A.; Ren, D.; Yang, X. Different antitumor effects of quercetin, quercetin-3’-sulfate and quercetin-3-glucuronide in human breast cancer MCF-7 cells. Food Funct. 2018, 9, 1736–1746. [Google Scholar] [CrossRef]
- Yamazaki, S.; Miyoshi, N.; Kawabata, K.; Yasuda, M.; Shimoi, K. Quercetin-3-O-glucuronide inhibits noradrenaline-promoted invasion of MDA-MB-231 human breast cancer cells by blocking beta(2)-adrenergic signaling. Arch. Biochem. Biophys. 2014, 557, 18–27. [Google Scholar] [CrossRef]
- Boesch-Saadatmandi, C.; Loboda, A.; Wagner, A.E.; Stachurska, A.; Jozkowicz, A.; Dulak, J.; Doring, F.; Wolffram, S.; Rimbach, G. Effect of quercetin and its metabolites isorhamnetin and quercetin-3-glucuronide on inflammatory gene expression: Role of miR-155. J. Nutr. Biochem. 2011, 22, 293–299. [Google Scholar] [CrossRef]
- Yoon, C.-S.; Kim, D.-C.; Ko, W.-M.; Kim, K.-S.; Lee, D.-S.; Kim, D.-S.; Cho, H.-K.; Seo, J.; Kim, S.Y.; Oh, H. Anti-neuroinflammatory effects of quercetin-3-O-glucuronide isolated from the leaf of Vitis labruscana on LPS-induced neuroinflammation in BV2 cells. Korean J. Pharmacogn. 2014, 45, 17–22. [Google Scholar]
- Fan, D.; Zhou, X.; Zhao, C.; Chen, H.; Zhao, Y.; Gong, X. Anti-inflammatory, antiviral and quantitative study of quercetin-3-O-β-d-glucuronide in Polygonum perfoliatum L. Fitoterapia 2011, 82, 805–810. [Google Scholar] [CrossRef]
- Guo, X.D.; Zhang, D.Y.; Gao, X.J.; Parry, J.; Liu, K.; Liu, B.L.; Wang, M. Quercetin and quercetin-3-O-glucuronide are equally effective in ameliorating endothelial insulin resistance through inhibition of reactive oxygen species-associated inflammation. Mol. Nutr. Food Res. 2013, 57, 1037–1045. [Google Scholar] [CrossRef]
- Otsuka, Y.; Egawa, K.; Kanzaki, N.; Izumo, T.; Rogi, T.; Shibata, H. Quercetin glycosides prevent dexamethasone-induced muscle atrophy in mice. Biochem. Biophys. Rep. 2019, 18, 100618. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.-L.; Xiao, N.; Li, X.-W.; Fan, Y.; Alolga, R.N.; Sun, X.-Y.; Wang, S.-L.; Li, P.; Qi, L.-W. Pharmacokinetic comparison between quercetin and quercetin 3-O-β-glucuronide in rats by UHPLC-MS/MS. Sci. Rep. 2016, 6, 35460. [Google Scholar] [CrossRef] [PubMed]
- Choi, E.; Kim, E.; Kim, J.H.; Yoon, K.; Kim, S.; Lee, J.; Cho, J.Y. AKT1-targeted proapoptotic activity of compound K in human breast cancer cells. J. Ginseng Res. 2019, 43, 692–698. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.O.; Kim, E.; Kim, J.H.; Hong, Y.H.; Kim, H.G.; Jeong, D.; Kim, J.; Kim, S.H.; Park, C.; Seo, D.B.; et al. Antimelanogenesis and skin-protective activities of Panax ginseng calyx ethanol extract. J. Ginseng Res. 2018, 42, 389–399. [Google Scholar] [CrossRef]
- Kim, M.; Yi, Y.S.; Kim, J.; Han, S.Y.; Kim, S.H.; Seo, D.B.; Cho, J.Y.; Shin, S.S. Effect of polysaccharides from a Korean ginseng berry on the immunosenescence of aged mice. J. Ginseng Res. 2018, 42, 447–454. [Google Scholar] [CrossRef]
- Hong, Y.H.; Kim, D.; Nam, G.; Yoo, S.; Han, S.Y.; Jeong, S.G.; Kim, E.; Jeong, D.; Yoon, K.; Kim, S.; et al. Photoaging protective effects of BIOGF1K, a compound-K-rich fraction prepared from Panax ginseng. J. Ginseng Res. 2018, 42, 81–89. [Google Scholar] [CrossRef]
Sample Availability: Samples of the compounds, water extract of lotus leaf and Q3G, are available from the authors. |










| Target | Sequences (5′ → 3′) | |
|---|---|---|
| Atrogin-1 | Forward | TTCAGCAGCCTGAACTACGA |
| Reverse | AGTATCCATGGCGCTCCTTC | |
| MuRF1 | Forward | GAGGGGCTACCTTCCTCTCA |
| Reverse | AGAGGAACGCTGCCTTTCAA | |
| FoxO1 | Forward | AGTGGATGGTGAAGAGCGTG |
| Reverse | GAAGGGACAGATTGTGGCGA | |
| FoxO3A | Forward | GAACCTGTCCTATGCCGACC |
| Reverse | TGGGACAAAGTGAGCCGTTT | |
| GAPDH | Forward | GGTTGTCTCCTGCGACTTCA |
| Reverse | CATTGAGAGCAATGCCAGCC | |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, S.H.; Oh, J.; Jo, M.; Kim, J.K.; Kim, D.S.; Kim, H.G.; Yoon, K.; Yang, Y.; Geum, J.-h.; Kim, J.-E.; et al. Water Extract of Lotus Leaf Alleviates Dexamethasone-Induced Muscle Atrophy via Regulating Protein Metabolism-Related Pathways in Mice. Molecules 2020, 25, 4592. https://doi.org/10.3390/molecules25204592
Park SH, Oh J, Jo M, Kim JK, Kim DS, Kim HG, Yoon K, Yang Y, Geum J-h, Kim J-E, et al. Water Extract of Lotus Leaf Alleviates Dexamethasone-Induced Muscle Atrophy via Regulating Protein Metabolism-Related Pathways in Mice. Molecules. 2020; 25(20):4592. https://doi.org/10.3390/molecules25204592
Chicago/Turabian StylePark, Sang Hee, Jieun Oh, Minkyeong Jo, Jin Kyeong Kim, Dong Seon Kim, Han Gyung Kim, Keejung Yoon, Yoonyong Yang, Jeong-ho Geum, Jung-Eun Kim, and et al. 2020. "Water Extract of Lotus Leaf Alleviates Dexamethasone-Induced Muscle Atrophy via Regulating Protein Metabolism-Related Pathways in Mice" Molecules 25, no. 20: 4592. https://doi.org/10.3390/molecules25204592
APA StylePark, S. H., Oh, J., Jo, M., Kim, J. K., Kim, D. S., Kim, H. G., Yoon, K., Yang, Y., Geum, J.-h., Kim, J.-E., Choi, S.-Y., Kim, J. H., & Cho, J. Y. (2020). Water Extract of Lotus Leaf Alleviates Dexamethasone-Induced Muscle Atrophy via Regulating Protein Metabolism-Related Pathways in Mice. Molecules, 25(20), 4592. https://doi.org/10.3390/molecules25204592

