Atypical Antipsychotic Drug Ziprasidone Protects against Rotenone-Induced Neurotoxicity: An In Vitro Study
Abstract
1. Introduction
2. Results
2.1. Influence of ZPD on Cell Viability
2.2. Evaluation of Nrf2 Gene and Protein Expression Modulated by ZPD in PC12 Cells
2.3. ZPD Enhanced the Gene Expression of Antioxidative Enzymes in PC12 Cells
2.4. Effect of ZPD on ROT-Induced Neurotoxicity
2.5. Effect of ZPD on ROT-Induced Oxidative Stress
2.6. Role of 5-HT1A-R in the Protective Effect of ZPD
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Cell Culture
4.3. Cell Viability Assay
4.4. Semiquantitative RT-PCR Analysis
4.5. Western Blot Analysis
4.6. Detection of ROS Production
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Goadsby, P.J.; Burke, D. Deficits in the function of small and large afferent fibers in confirmed cases of carpal tunnel syndrome. Muscle Nerve 1994, 17, 614–622. [Google Scholar] [CrossRef]
- Perälä, J.; Suvisaari, J.; Saarni, S.I.; Kuoppasalmi, K.; Isometsä, E.T.; Pirkola, S.; Partonen, T.; Tuulio-Henriksson, A.; Hintikka, J.; Kieseppä, T.; et al. Lifetime Prevalence of Psychotic and Bipolar I Disorders in a General Population. Arch. Gen. Psychiatry 2007, 64, 19–28. [Google Scholar] [CrossRef]
- Tamminga, C.A.; Holcomb, H.H. Phenotype of schizophrenia: A review and formulation. Mol. Psychiatry 2004, 10, 27–39. [Google Scholar] [CrossRef]
- Johnstone, E.C. Schizophrenia: Manifestations, Incidence and Course in Different Cultures. WHO Ten-Country Study; Jablensky, A., Sartorius, N., Ernberg, G., Anker, M., Korten, A., Cooper, J.E., Day, R., Bertelsen, A., Eds.; Psychological Medicine Monograph Supplement 20; Cambridge University Press: Cambridge, UK, 1991; pp. 254–255. [Google Scholar]
- Carlsson, A.; Lindqvist, M. Effect of Chlorpromazine or Haloperidol on Formation of 3-Methoxytyramine and Normetanephrine in Mouse Brain. Acta Pharmacol. Toxicol. (Copenh) 2009, 20, 140–144. [Google Scholar] [CrossRef]
- Seeman, P.; Kapur, S. Schizophrenia: More dopamine, more D2 receptors. Proc. Natl. Acad. Sci. USA 2000, 97, 7673–7675. [Google Scholar] [CrossRef]
- Zhang, M.; Zhao, Z.; He, L.; Wan, C. A meta-analysis of oxidative stress markers in schizophrenia. Sci. China Life Sci. 2010, 53, 112–124. [Google Scholar] [CrossRef]
- Flatow, J.; Buckley, P.; Miller, B.J. Meta-analysis of oxidative stress in schizophrenia. Boil. Psychiatry 2013, 74, 400–409. [Google Scholar] [CrossRef]
- Brennand, K.J.; Landek-Salgado, M.A.; Sawa, A. Modeling Heterogeneous Patients with a Clinical Diagnosis of Schizophrenia With Induced Pluripotent Stem Cells. Boil. Psychiatry 2014, 75, 936–944. [Google Scholar] [CrossRef]
- Hirose, K.; Chan, P.H. Blockade of glutamate excitotoxicity and its clinical applications. Neurochem. Res. 1993, 18, 479–483. [Google Scholar] [CrossRef]
- Kohen, R.; Nyska, A. Invited Review: Oxidation of Biological Systems: Oxidative Stress Phenomena, Antioxidants, Redox Reactions, and Methods for Their Quantification. Toxicol. Pathol. 2002, 30, 620–650. [Google Scholar] [CrossRef]
- Grima, G. Dopamine-induced oxidative stress in neurons with glutathione deficit: Implication for schizophrenia. Schizophr. Res. 2003, 62, 213–224. [Google Scholar] [CrossRef]
- Reddy, R.; Yao, J.K. Free radical pathology in schizophrenia: A review. Schizophr. Res. 1997, 24, 67. [Google Scholar] [CrossRef]
- Li, N.; Ragheb, K.; Lawler, G.; Sturgis, J.; Rajwa, B.; Melendez, J.A.; Robinson, J.P. Mitochondrial Complex I Inhibitor Rotenone Induces Apoptosis through Enhancing Mitochondrial Reactive Oxygen Species Production. J. Boil. Chem. 2002, 278, 8516–8525. [Google Scholar] [CrossRef] [PubMed]
- Won, J.-H.; Park, S.; Hong, S.; Son, S.; Yu, J.-W. Rotenone-induced Impairment of Mitochondrial Electron Transport Chain Confers a Selective Priming Signal for NLRP3 Inflammasome Activation. J. Boil. Chem. 2015, 290, 27425–27437. [Google Scholar] [CrossRef] [PubMed]
- Ren, Y.; Feng, J. Rotenone selectively kills serotonergic neurons through a microtubule-dependent mechanism. J. Neurochem. 2007, 103, 303–311. [Google Scholar] [CrossRef]
- Zhou, Q.; Chen, B.; Wang, X.; Wu, L.; Yang, Y.; Cheng, X.; Hu, Z.; Cai, X.; Yang, J.; Sun, X.; et al. Sulforaphane protects against rotenone-induced neurotoxicity in vivo: Involvement of the mTOR, Nrf2 and autophagy pathways. Sci. Rep. 2016, 6, 32206. [Google Scholar] [CrossRef]
- Siebert, A.; Desai, V.; Chandrasekaran, K.; Fiskum, G.; Jafri, M.S. Nrf2 activators provide neuroprotection against 6-hydroxydopamine toxicity in rat organotypic nigrostriatal cocultures. J. Neurosci. Res. 2009, 87, 1659–1669. [Google Scholar] [CrossRef]
- Terada, K.; Migita, K.; Matsushima, Y.; Sugimoto, Y.; Kamei, C.; Matsumoto, T.; Mori, M.; Matsunaga, K.; Takata, J.; Karube, Y. Cholinesterase inhibitor rivastigmine enhances nerve growth factor-induced neurite outgrowth in PC12 cells via sigma-1 and sigma-2 receptors. PLoS ONE 2018, 13, e0209250. [Google Scholar] [CrossRef]
- Park, S.-W.; Lee, C.H.; Lee, J.G.; Kim, L.W.; Shin, B.S.; Lee, B.J.; Kim, Y.H. Protective effects of atypical antipsychotic drugs against MPP+-induced oxidative stress in PC12 cells. Neurosci. Res. 2011, 69, 283–290. [Google Scholar] [CrossRef]
- Yama, K.; Sato, K.; Abe, N.; Murao, Y.; Tatsunami, R.; Tampo, Y. Epalrestat increases glutathione, thioredoxin, and heme oxygenase-1 by stimulating Nrf2 pathway in endothelial cells. Redox Boil. 2014, 4, 87–96. [Google Scholar] [CrossRef]
- Tonelli, C.; Chio, I.I.C.; Tuveson, D.A. Transcriptional Regulation by Nrf2. Antioxid. Redox Signal. 2018, 29, 1727–1745. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Song, W.; Wang, Z.; Wang, Z.; Jin, X.; Xu, J.; Bai, L.; Li, Y.; Cui, J.; Cai, L. Resveratrol attenuates testicular apoptosis in type 1 diabetic mice: Role of Akt-mediated Nrf2 activation and p62-dependent Keap1 degradation. Redox Boil. 2018, 14, 609–617. [Google Scholar] [CrossRef] [PubMed]
- De Vries, H.E.; Witte, M.; Hondius, D.; Rozemuller, A.J.; Drukarch, B.; Hoozemans, J.J.M.; Van Horssen, J. Nrf2-induced antioxidant protection: A promising target to counteract ROS-mediated damage in neurodegenerative disease? Free. Radic. Boil. Med. 2008, 45, 1375–1383. [Google Scholar] [CrossRef]
- Schmidt, A.W.; Lebel, L.A.; Howard, H.R.; Zorn, S.H. Ziprasidone: A novel antipsychotic agent with a unique human receptor binding profile. Eur. J. Pharmacol. 2001, 425, 197–201. [Google Scholar] [CrossRef]
- Maurer, I.; Zierz, S.; Möller, H.-J. Evidence for a mitochondrial oxidative phosphorylation defect in brains from patients with schizophrenia. Schizophr. Res. 2001, 48, 125–136. [Google Scholar] [CrossRef]
- Zhao, X.-Y.; Lu, M.-H.; Yuan, D.-J.; Xu, D.-E.; Yao, P.-P.; Ji, W.-L.; Chen, H.; Liu, W.-L.; Yan, C.-X.; Xia, Y.-Y.; et al. Mitochondrial Dysfunction in Neural Injury. Front. Mol. Neurosci. 2019, 13, 14. [Google Scholar] [CrossRef]
- Prabakaran, S.; Swatton, J.E.; Ryan, M.M.; Huffaker, S.J.; Huang, J.-J.; Griffin, J.L.; Wayland, M.; Freeman, T.; Dudbridge, F.; Lilley, K.S.; et al. Mitochondrial dysfunction in schizophrenia: Evidence for compromised brain metabolism and oxidative stress. Mol. Psychiatry 2004, 9, 684–697. [Google Scholar] [CrossRef]
- Atmaca, M.; Tezcan, E.; Kuloglu, M.; Ustundag, B.; Kirtas, O. The effect of extract of ginkgo biloba addition to olanzapine on therapeutic effect and antioxidant enzyme levels in patients with schizophrenia. Psychiatry Clin. Neurosci. 2005, 59, 652–656. [Google Scholar] [CrossRef]
- Dakhale, G.N.; Khanzode, S.D.; Saoji, A.; Khanzode, S.S. Supplementation of vitamin C with atypical antipsychotics reduces oxidative stress and improves the outcome of schizophrenia. Psychopharmacology 2005, 182, 494–498. [Google Scholar] [CrossRef]
- Berk, M.; Copolov, D.; Dean, O.; Lu, K.; Jeavons, S.; Schapkaitz, I.; Anderson-Hunt, M.; Judd, F.; Katz, F.; Katz, P.; et al. N-Acetyl Cysteine as a Glutathione Precursor for Schizophrenia—A Double-Blind, Randomized, Placebo-Controlled Trial. Boil. Psychiatry 2008, 64, 361–368. [Google Scholar] [CrossRef]
- Sunitha, K.; Hemshekhar, M.; Thushara, R.M.; Santhosh, M.S.; Yariswamy, M.; Kemparaju, K.; Girish, K.S. N-Acetylcysteine amide: A derivative to fulfill the promises of N-Acetylcysteine. Free. Radic. Res. 2013, 47, 357–367. [Google Scholar] [CrossRef] [PubMed]
- Ramsey, C.P.; Glass, C.A.; Montgomery, M.B.; Lindl, K.A.; Ritson, G.P.; Chia, L.A.; Hamilton, R.L.; Chu, C.T.; Jordan-Sciutto, K.L. Expression of Nrf2 in Neurodegenerative Diseases. J. Neuropathol. Exp. Neurol. 2007, 66, 75–85. [Google Scholar] [CrossRef] [PubMed]
- Jakel, R.J.; Townsend, J.A.; Kraft, A.D.; Johnson, J.A. Nrf2-mediated protection against 6-hydroxydopamine. Brain Res. 2007, 1144, 192–201. [Google Scholar] [CrossRef] [PubMed]
- Shiina, A.; Kanahara, N.; Sasaki, T.; Oda, Y.; Hashimoto, T.; Hasegawa, T.; Yoshida, T.; Iyo, M.; Hashimoto, K. An Open Study of Sulforaphane-rich Broccoli Sprout Extract in Patients with Schizophrenia. Clin. Psychopharmacol. Neurosci. 2015, 13, 62–67. [Google Scholar] [CrossRef]
- Dietrich-Muszalska, A.; Kolińska-Łukaszuk, J. Comparative effects of aripiprazole and selected antipsychotic drugs on lipid peroxidation in plasma. Psychiatry Clin. Neurosci. 2018, 72, 329–336. [Google Scholar] [CrossRef]
- Assis, L.C.; Scaini, G.; Castro, A.A.; Comim, C.M.; Streck, E.L.; Quevedo, J.; Di-Pietro, P.B. Effect of Antipsychotics on Creatine Kinase Activity in Rat Brain. Basic Clin. Pharmacol. Toxicol. 2007, 101, 315–319. [Google Scholar] [CrossRef]
- Gardner, D.M.; Baldessarini, R.J.; Waraich, P. Modern antipsychotic drugs: A critical overview. Can. Med. Assoc. J. 2005, 172, 1703–1711. [Google Scholar] [CrossRef]
- Polydoro, M.; Schröder, N.; Lima, M.N.M.; Caldana, F.; Laranja, D.C.; Bromberg, E.; Roesler, R.; Quevedo, J.; Moreira, J.C.F.; Dal-Pizzol, F. Haloperidol- and clozapine-induced oxidative stress in the rat brain. Pharmacol. Biochem. Behav. 2004, 78, 751–756. [Google Scholar] [CrossRef]
- Brinholi, F.F.; De Farias, C.C.; Bonifacio, K.L.; Higachi, L.; Casagrande, R.; Moreira, E.G.; Barbosa, D.S. Clozapine and olanzapine are better antioxidants than haloperidol, quetiapine, risperidone and ziprasidone in in vitro models. Biomed. Pharmacother. 2016, 81, 411–415. [Google Scholar] [CrossRef]
- Mauler, F.; Horváth, E. Neuroprotective Efficacy of Repinotan HCl, a 5-HT1A Receptor Agonist, in Animal Models of Stroke and Traumatic Brain Injury. Br. J. Pharmacol. 2005, 25, 451–459. [Google Scholar] [CrossRef]
- Salazar-Colocho, P.; Del Río, J.; Frechilla, D. Neuroprotective effects of serotonin 5-HT1A receptor activation against ischemic cell damage in gerbil hippocampus: Involvement of NMDA receptor NR1 subunit and BDNF. Brain Res. 2008, 1199, 159–166. [Google Scholar] [CrossRef] [PubMed]
- Collier, R.J.; Patel, Y.; Martin, E.A.; Dembinska, O.; Hellberg, M.; Krueger, D.S.; Kapin, M.A.; Romano, C. Agonists at the Serotonin Receptor (5-HT1A) Protect the Retina from Severe Photo-Oxidative Stress. Investig. Opthalmol. Vis. Sci. 2011, 52, 2118–2126. [Google Scholar] [CrossRef] [PubMed]
- Dekeyne, A.; Rivet, J.-M.; Gobert, A.; Millan, M.J. Generalization of serotonin (5-HT)1A agonists and the antipsychotics, clozapine, ziprasidone and S16924, but not haloperidol, to the discriminative stimuli elicited by PD128,907 and 7-OH-DPAT. Neuropharmacology 2001, 40, 899–910. [Google Scholar] [CrossRef]
- Jordan, S.; Koprivica, V.; Chen, R.; Tottori, K.; Kikuchi, T.; Altar, C.A. The antipsychotic aripiprazole is a potent, partial agonist at the human 5-HT1A receptor. Eur. J. Pharmacol. 2002, 441, 137–140. [Google Scholar] [CrossRef]
- Tong, Y.; Bai, L.; Gong, R.; Chuan, J.; Duan, X.; Zhu, Y. Shikonin Protects PC12 Cells Against β-amyloid Peptide-Induced Cell Injury Through Antioxidant and Antiapoptotic Activities. Sci. Rep. 2018, 8, 26. [Google Scholar] [CrossRef] [PubMed]
Sample Availability: Samples of the compounds ZPD, ROT and NGF are available from the authors. |
Gene | Accession No. | Sense (5′-3′) | Antisense (5′-3′) |
---|---|---|---|
Nrf2 | NM_031789 | GGACCTAAAGCACAGCCAAC | ATCTCTGGTCTGCTGCAGAG |
NQO-1 | NM_017000 | ATGGGAGGTGGTCGAATCTG | TCTCCAGACGCTTCTTCCAC |
HO-1 | NM_012580 | CTTACACACCAGCCACACAG | ACTGAGTGTGAGGACCCATC |
CAT | NM_012520 | GATGAAGCAGTGGAAGGAGC | TCGGTCGCTGAACAAGAAAG |
GAPDH | NM_017008 | AGGCTGAGAATGGGAAGCTG | TAGGAACACGGAAGGCCATG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Terada, K.; Murata, A.; Toki, E.; Goto, S.; Yamakawa, H.; Setoguchi, S.; Watase, D.; Koga, M.; Takata, J.; Matsunaga, K.; et al. Atypical Antipsychotic Drug Ziprasidone Protects against Rotenone-Induced Neurotoxicity: An In Vitro Study. Molecules 2020, 25, 4206. https://doi.org/10.3390/molecules25184206
Terada K, Murata A, Toki E, Goto S, Yamakawa H, Setoguchi S, Watase D, Koga M, Takata J, Matsunaga K, et al. Atypical Antipsychotic Drug Ziprasidone Protects against Rotenone-Induced Neurotoxicity: An In Vitro Study. Molecules. 2020; 25(18):4206. https://doi.org/10.3390/molecules25184206
Chicago/Turabian StyleTerada, Kazuki, Ayumi Murata, Erina Toki, Shotaro Goto, Hirofumi Yamakawa, Shuichi Setoguchi, Daisuke Watase, Mitsuhisa Koga, Jiro Takata, Kazuhisa Matsunaga, and et al. 2020. "Atypical Antipsychotic Drug Ziprasidone Protects against Rotenone-Induced Neurotoxicity: An In Vitro Study" Molecules 25, no. 18: 4206. https://doi.org/10.3390/molecules25184206
APA StyleTerada, K., Murata, A., Toki, E., Goto, S., Yamakawa, H., Setoguchi, S., Watase, D., Koga, M., Takata, J., Matsunaga, K., & Karube, Y. (2020). Atypical Antipsychotic Drug Ziprasidone Protects against Rotenone-Induced Neurotoxicity: An In Vitro Study. Molecules, 25(18), 4206. https://doi.org/10.3390/molecules25184206