Exogenous Melatonin Mitigates Methyl Viologen-Triggered Oxidative Stress in Poplar Leaf
Abstract
1. Introduction
2. Results
2.1. Exogenous Melatonin Alleviates Oxidative Stress in Poplar Leaf Exposed to MV
2.2. Exogenous Melatonin Reduces MV-Mediated Accumulation of ROS in Poplar Leaf
2.3. Exogenous Melatonin Alleviates MV-Triggered Oxidative Damage to Cell Membranes in Poplar Leaf
2.4. Exogenous Melatonin Increases Activities of Antioxidant Enzymes and Levels of Non-Enzymatic Antioxidants in Poplar Leaf Discs Exposed to MV
2.5. Exogenous Melatonin Promotes Expression of Genes for Antioxidant Enzymes
2.6. Exogenous Melatonin Enhances Proline Accumulation, P5CS Activity, and P5CS Transcript Abundance
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Treatment
4.2. Measurement of ROS Accumulation
4.3. Measurement of Malonaldehyde (MDA) Content
4.4. Measurement of Electrolyte Leakage
4.5. Measurement of Antioxidant Enzyme Activities
4.6. Measurement of AsA and GSH
4.7. Measurement of Proline
4.8. Measurement of P5CS Activity
4.9. Measurement of Transcript Abundance by Quantitative Real-Time PCR
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Zhu, J.K. Abiotic stress signaling and responses in plants. Cell 2016, 167, 313–324. [Google Scholar] [CrossRef] [PubMed]
- Allen, D.J.; Ort, D.R. Impacts of chilling temperatures on photosynthesis in warm-climate plants. Trends Plant Sci. 2001, 6, 36–42. [Google Scholar] [CrossRef]
- Apel, K.; Hirt, H. Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 2004, 55, 373–399. [Google Scholar] [CrossRef] [PubMed]
- Foyer, C.H.; Shigeoka, S. Understanding oxidative stress and antioxidant functions to enhance photosynthesis. Plant Physiol. 2011, 155, 93–100. [Google Scholar] [CrossRef] [PubMed]
- Asada, K. The water-water cycle in chloroplasts: Scavenging of active oxygens and dissipation of excess photons. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1999, 50, 601–639. [Google Scholar] [CrossRef] [PubMed]
- Krasensky, J.; Jonak, C. Drought, salt, and temperature stress-induced metabolic rearrangements and regulatory networks. J. Exp. Bot. 2015, 63, 1593–1608. [Google Scholar] [CrossRef] [PubMed]
- Bartels, D.; Sunkar, R. Drought and salt tolerance in plants. Crit. Rev. Plant Sci. 2005, 24, 23–58. [Google Scholar] [CrossRef]
- Most, P.; Papenbrock, J. Possible roles of plant sulfurtransferases in detoxification of cyanide, reactive oxygen species, selected heavy metals and arsenate. Molecules 2015, 20, 1410–1423. [Google Scholar] [CrossRef] [PubMed]
- Yarmolinsky, D.; Brychkova, G.; Kurmanbayeva, A.; Bekturova, A.; Ventura, Y.; Khozin-Goldberg, I.; Eppel, A.; Fluhr, R.; Sagi, M. Impairment in sulfite reductase leads to early leaf senescence in tomato plants. Plant Physiol. 2014, 165, 1505–1520. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, P.; Jaleel, C.A.; Salem, M.A.; Nabi, G.; Sharma, S. Roles of enzymatic and nonenzymatic antioxidants in plants during abiotic stress. Crit. Rev. Biotechnol. 2010, 30, 161–175. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, R.; Redman, R. Balancing the generation and elimination of reactive oxygen species. Proc. Natl. Acad. Sci. USA 2005, 102, 3175–3176. [Google Scholar] [CrossRef] [PubMed]
- Verbruggen, N.; Hermans, C. Proline accumulation in plants: A review. Amino Acids 2008, 35, 753–759. [Google Scholar] [CrossRef] [PubMed]
- Szabados, L.; Savouré, A. Proline: A multifunctional amino acid. Trends Plant Sci. 2010, 15, 89–97. [Google Scholar] [CrossRef] [PubMed]
- Sharma, S.; Villamor, J.G.; Verslues, P.E. Essential role of tissue-specific proline synthesis and catabolism in growth and redox balance at low water potential. Plant Physiol. 2011, 157, 292–304. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Tang, X.; Wang, H.; Shao, H.-B. Proline accumulation and metabolism-related genes expression profiles in Kosteletzkya virginica seedlings under salt stress. Front. Plant Sci. 2015, 6, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Dubbels, R.; Reiter, R.J.; Klenke, E.; Goebel, A.; Schnakenberg, E.; Ehlers, C.; Schiwara, H.W.; Schloot, W. Melatonin in edible plants identified by radioimmunoassay and by high performance liquid chromatography-mass spectrometry. J. Pineal Res. 1995, 18, 28–31. [Google Scholar] [CrossRef] [PubMed]
- Hattori, A.; Migitaka, H.; Iigo, M.; Itoh, M.; Yamamoto, K.; Ohtani-Kaneko, R.; Hara, M.; Suzuki, T.; Reiter, R.J. Identification of melatonin in plants and its effects on plasma melatonin levels and binding to melatonin receptors in vertebrates. Biochem. Mol. Biol. Int. 1995, 35, 627–634. [Google Scholar] [PubMed]
- Arnao, M.B.; Hernández-Ruiz, J. Functions of melatonin in plants: A review. J. Pineal Res. 2015, 59, 133–150. [Google Scholar] [CrossRef] [PubMed]
- Reiter, R.J.; Tan, D.X.; Zhou, Z.; Cruz, M.H.C.; Fuentes-Broto, L.; Galano, A. Phytomelatonin: Assisting plants to survive and thrive. Molecules 2015, 20, 7396–7437. [Google Scholar] [CrossRef] [PubMed]
- Marta, B.; Szafrańska, K.; Posmyk, M.M. Exogenous melatonin improves antioxidant defense in cucumber seeds (Cucumis sativus L.) germinated under chilling stress. Front. Plant Sci. 2016, 7, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Posmyk, M.M.; Janas, K.M. Melatonin in plants. Acta Physiol. Plant. 2009, 31, 1–11. [Google Scholar] [CrossRef]
- Ding, F.; Liu, B.; Zhang, S. Exogenous melatonin ameliorates cold-induced damage in tomato plants. Sci. Hortic. 2017, 219, 264–271. [Google Scholar] [CrossRef]
- Fan, J.; Xie, Y.; Zhang, Z.; Chen, L. Melatonin: A multifunctional factor in plants. Int. J. Mol. Sci. 2018, 19, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Wang, P.; Wei, Z.; Liang, D.; Liu, C.; Yin, L.; Jia, D.; Fu, M.; Ma, F. The mitigation effects of exogenous melatonin on salinity-induced stress in Malus hupehensis. J. Pineal Res. 2012, 53, 298–306. [Google Scholar] [CrossRef] [PubMed]
- Shi, H.; Wang, X.; Ye, T.; Chen, F.; Deng, J.; Yang, P.; Zhang, Y.; Chan, Z. The Cysteine2/Histidine2-type transcription factor zinc finger of arabidopsis thalian6 modulates biotic and abiotic stress responses by activating salicylic acid-related genes and C-repeat-binding factor genes in Arabidopsis. Plant Physiol. 2014, 165, 1367–1379. [Google Scholar] [CrossRef] [PubMed]
- Shi, H.; Wang, X.; Tan, D.X.; Reiter, R.J.; Chan, Z. Comparative physiological and proteomic analyses reveal the actions of melatonin in the reduction of oxidative stress in Bermuda grass (Cynodon dactylon (L). Pers.). J. Pineal Res. 2015, 59, 120–131. [Google Scholar] [CrossRef] [PubMed]
- Li, M.Q.; Hasan, M.K.; Li, C.X.; Ahammed, G.J.; Xia, X.J.; Shi, K.; Zhou, Y.H.; Reiter, R.J.; Yu, J.Q.; Xu, M.X.; et al. Melatonin mediates selenium-induced tolerance to cadmium stress in tomato plants. J. Pineal Res. 2016, 61, 291–302. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.; Cai, S.Y.; Zhang, Y.; Wang, Y.; Ahammed, G.J.; Xia, X.J.; Shi, K.; Zhou, Y.H.; Yu, J.Q.; Reiter, R.J.; et al. Melatonin enhances thermotolerance by promoting cellular protein protection in tomato plants. J. Pineal Res. 2016, 61, 457–469. [Google Scholar] [CrossRef] [PubMed]
- Szafrańska, K.; Reiter, R.J.; Posmyk, M.M. Melatonin improves the photosynthetic apparatus in pea leaves stressed by paraquat via chlorophyll breakdown regulation and its accelerated de novo synthesis. Front. Plant Sci. 2017, 8, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Sun, X.; Chang, C.; Feng, F.; Liang, D.; Cheng, L.; Ma, F. Delay in leaf senescence of Malus hupehensis by long-term melatonin application is associated with its regulation of metabolic status and protein degradation. J. Pineal Res. 2013, 55, 424–434. [Google Scholar] [CrossRef] [PubMed]
- Ding, F.; Wang, G.; Wang, M.; Zhang, S. Exogenous melatonin improves tolerance to water deficit by promoting cuticle formation in tomato plants. Molecules 2018, 23. [Google Scholar] [CrossRef] [PubMed]
- Hawkes, T.R. Mechanisms of resistance to paraquat in plants. Pest Manag. Sci. 2014, 70, 1316–1323. [Google Scholar] [CrossRef] [PubMed]
- Sétif, P. Electron-transfer kinetics in cyanobacterial cells: Methyl viologen is a poor inhibitor of linear electron flow. Biochim. Biophys. Acta Bioenerg. 2015, 1847, 212–222. [Google Scholar] [CrossRef] [PubMed]
- Bajwa, V.S.; Shukla, M.R.; Sherif, S.M.; Murch, S.J.; Saxena, P.K. Role of melatonin in alleviating cold stress in Arabidopsis thaliana. J. Pineal Res. 2014, 56, 238–245. [Google Scholar] [CrossRef] [PubMed]
- Fan, J.; Hu, Z.; Xie, Y.; Chan, Z.; Chen, K.; Amombo, E.; Chen, L.; Fu, J. Alleviation of cold damage to photosystem II and metabolisms by melatonin in Bermudagrass. Front. Plant Sci. 2015, 6, 925. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Wang, W.; Wang, L.; Sun, Y. Exogenous melatonin improves seedling health index and drought tolerance in tomato. Plant Growth Regul. 2015, 77, 317–326. [Google Scholar] [CrossRef]
- Liu, N.; Jin, Z.; Wang, S.; Gong, B.; Wen, D.; Wang, X.; Wei, M.; Shi, Q. Sodic alkaline stress mitigation with exogenous melatonin involves reactive oxygen metabolism and ion homeostasis in tomato. Sci. Hortic. 2015, 181, 18–25. [Google Scholar] [CrossRef]
- Zhou, X.; Zhao, H.; Cao, K.; Hu, L.; Du, T.; Baluška, F.; Zou, Z. Beneficial roles of melatonin on redox regulation of photosynthetic electron transport and synthesis of D1 Protein in tomato seedlings under salt stress. Front. Plant Sci. 2016, 7, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Ding, F.; Wang, M.; Liu, B.; Zhang, S. Exogenous melatonin mitigates photoinhibition by accelerating non-photochemical quenching in tomato seedlings exposed to moderate light during chilling. Front. Plant Sci. 2017, 8, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Wei, Z.; Gao, T.; Liang, B.; Zhao, Q.; Ma, F.; Li, C. Effects of exogenous melatonin on methyl viologen-mediated oxidative stress in apple leaf. Int. J. Mol. Sci. 2018, 19. [Google Scholar] [CrossRef]
- Cano, A.; Alcaraz, O.; Arnao, M.B. Free radical-scavenging activity of indolic compounds in aqueous and ethanolic media. Anal. Bioanal. Chem. 2003, 376, 33–37. [Google Scholar] [CrossRef] [PubMed]
- Shi, H.; Chan, Z. The cysteine2/histidine2-type transcription factor zinc finger of arabidopsis thaliana 6-activated C-repeat-binding factor pathway is essential for melatonin-mediated freezing stress resistance in Arabidopsis. J. Pineal Res. 2014, 57, 185–191. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Dickman, M.B. From The Cover: Proline suppresses apoptosis in the fungal pathogen Colletotrichum trifolii. Proc. Natl. Acad. Sci. USA 2005, 102, 3459–3464. [Google Scholar] [CrossRef] [PubMed]
- Signorelli, S. The Fermentation Analogy: A point of view for understanding the intriguing role of proline accumulation in stressed plants. Front. Plant Sci. 2016, 7, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Patterson, B.D.; MacRae, E.A.; Ferguson, I.B. Estimation of hydrogen peroxide in plant extracts using titanium(IV). Anal. Biochem. 1984, 139, 487–492. [Google Scholar] [CrossRef]
- Jabs, T.; Dietrich, R.A.; Dang, J.L. Initiation of runaway cell death in an arabidopsis mutant by extracellular superoxide. Science 1996, 273, 1853–1856. [Google Scholar] [CrossRef] [PubMed]
- Hodges, D.M.; Delong, J.M.; Forney, C.F.; Prange, R.K.; Delong, J.M.; Hodges, D.M.; Forney, C.F.; Prange, R.K. Improving the thiobarbituric anthocyanin for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 2015, 207, 604–611. [Google Scholar] [CrossRef]
- Ishitani, M.; Xiong, L.; Lee, H.; Stevenson, B.; Zhu, J.K. HOS1, a genetic locus involved in cold-responsive gene expression in arabidopsis. Plant Cell 1998, 10, 1151–1161. [Google Scholar] [CrossRef] [PubMed]
- Beauchamp, C.; Fridovich, I. Superoxide dismutase: Improved assays and an assay applicable to acrylamide gels. Anal. Biochem. 1971, 44, 276–287. [Google Scholar] [CrossRef]
- Nakano, Y.; Asada, K. Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar] [CrossRef]
- Cakmak, I.; Marschner, H. Magnesium deficiency and high light intensity enhance activities of superoxide dismutase, ascorbate peroxidase, and glutathione reductase in bean leaves. Plant Physiol. 1992, 98, 1222–1227. [Google Scholar] [CrossRef] [PubMed]
- Logan, B.A.; Grace, S.C.; Adams, W.W.; Demmig-Adams, B. Seasonal differences in xanthophyll cycle characteristics and antioxidants in Mahonia repens growing in different light environments. Oecologia 1998, 116, 9–17. [Google Scholar] [CrossRef] [PubMed]
- Griffith, O.W. Determination of glutathione and glutathione disulfide using glutathione reductase and 2-vinylpyridine. Anal. Biochem. 1980, 106, 207–212. [Google Scholar] [CrossRef]
- Bates, L.S.; Waldren, R.P.; Teare, I.D. Rapid determination of free proline for water-stress studies. Plant Soil 1973, 39, 205–207. [Google Scholar] [CrossRef]
- García-Ríos, M.; Fujita, T.; LaRosa, P.C.; Locy, R.D.; Clithero, J.M.; Bressan, R.A.; Csonka, L.N. Cloning of a polycistronic cDNA from tomato encoding gamma-glutamyl kinase and gamma-glutamyl phosphate reductase. Proc. Natl. Acad. Sci. USA 1997, 94, 8249–8254. [Google Scholar] [CrossRef] [PubMed]
Sample Availability: Samples of the compounds are commercially available from companies referred. |
| 1 | R: TAGCGCTCTGCAATTTGACAAC R: TAGCGCTCTGCAATTTGACAAC |






| Gene | Primer Sequence (5′–3′) |
|---|---|
| Actin | F: AGGGCAGTGTTTCCAAGTATTG |
| R: GTGTGATGCCAAATCTTCTCCAT | |
| CAT | F: ATGGATCCTTACAAGCATCGTT |
| R: GCACTAGCACCTCTAGCATGAAT | |
| Chloroplast APX | F: ATGGCTTCTTTAACTATCCTCGG |
| R: TTGGCCCGAAATTTGACAGTT | |
| P5CS | F: AGTCTCGACCAGATGCACTAGT |
| R: CTAGCCCAATAAGTCTTCCACC | |
| POD | F: ATGGGATTAGGGTACTGCACG |
| R: AGATATAAGGGTCTGCCTCTGG | |
| Cu/Zn-SOD | F: AGCTTCAAGCTTCATTTCCGTG |
| R: TAGCGCTCTGCAATTTGACAAC |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ding, F.; Wang, G.; Zhang, S. Exogenous Melatonin Mitigates Methyl Viologen-Triggered Oxidative Stress in Poplar Leaf. Molecules 2018, 23, 2852. https://doi.org/10.3390/molecules23112852
Ding F, Wang G, Zhang S. Exogenous Melatonin Mitigates Methyl Viologen-Triggered Oxidative Stress in Poplar Leaf. Molecules. 2018; 23(11):2852. https://doi.org/10.3390/molecules23112852
Chicago/Turabian StyleDing, Fei, Gang Wang, and Shuoxin Zhang. 2018. "Exogenous Melatonin Mitigates Methyl Viologen-Triggered Oxidative Stress in Poplar Leaf" Molecules 23, no. 11: 2852. https://doi.org/10.3390/molecules23112852
APA StyleDing, F., Wang, G., & Zhang, S. (2018). Exogenous Melatonin Mitigates Methyl Viologen-Triggered Oxidative Stress in Poplar Leaf. Molecules, 23(11), 2852. https://doi.org/10.3390/molecules23112852
