Melatonin Improves the Quality of Inferior Bovine Oocytes and Promoted Their Subsequent IVF Embryo Development: Mechanisms and Results
Abstract
:1. Introduction
2. Results
2.1. The Gene Expression Level of Pro-Apoptotic Genes Caspase-3, -9, and Bax (Relative mRNA) in IOs and COCs
2.2. The Effect of Melatonin on the Nuclear Maturation of Bovine IOs
2.3. The Effects of Melatonin on the ROS and GSH Levels in MII Oocytes
2.4. Effects of Melatonin on the Function of Mitochondria
2.5. Effect of Melatonin on Expression of HSP90 in Bovine IOs
2.6. The Effect of Melatonin on Expressions of GPX-4, SOD-1, and Bcl-2
2.7. The Effect of Melatonin on Expression of Oocytes Maturation-Related Genes (GDF-9, BMP-15, ATPase 6, and ATPase 8)
2.8. The Effects of Melatonin on IVF Embryo Developmental Potential and Cell Number of Blastocyst Obtained from IOs
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Animal Studies
4.3. Oocytes Collection, In Vitro Maturation, Fertilization, and In Vitro Embryo Development
4.4. Classification and Grouping of the Retrieved Oocytes
4.5. Assessment of Oocyte Maturation
4.6. Measurement of Reactive Oxygen Species (ROS) and Glutathione (GSH)
4.7. Oocytes Mitochondrial Distribution Assay
4.8. Detection of ATP Levels in Oocytes
4.9. Assessment of Embryo Quality
4.10. RNA Isolation and Reverse Transcriptional PCR
4.11. Detection of HSP90 in Oocyte via Immunofluorescence
4.12. Statistical Analysis
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Held-Hoelker, E.; Klein, S.L.; Rings, F.; Salilew-Wondim, D.; Saeed-Zidane, M.; Neuhoff, C.; Tesfaye, D.; Schellander, K.; Hoelker, M. Cryosurvival of in vitro produced bovine embryos supplemented with l-Carnitine and concurrent reduction of fatty acids. Theriogenology 2017, 96, 145–152. [Google Scholar] [CrossRef] [PubMed]
- Adona, P.R.; Pires, P.R.; Quetglas, M.D.; Schwarz, K.R.; Leal, C.L. Prematuration of bovine oocytes with butyrolactone, I: Effects on meiosis progression, cytoskeleton, organelle distribution and embryo development. Anim. Reprod. Sci. 2008, 108, 49–65. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.Y.; Jung, Y.G.; Seo, B.B. Effects of culture media conditions on production of eggs fertilized in vitro of embryos derived from ovary of high grade Hanwoo. J. Anim. Sci. Technol. 2016, 58, 11. [Google Scholar] [CrossRef] [PubMed]
- Ohlweiler, L.U.; Brum, D.S.; Leivas, F.G.; Moyses, A.B.; Ramos, R.S.; Klein, N.; Mezzalira, J.C.; Mezzalira, A. Intracytoplasmic sperm injection improves in vitro embryo production from poor quality bovine oocytes. Theriogenology 2013, 79, 778–783. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.W.; Hwang, K.J.; Kwon, H.C.; Kim, H.S.; Choi, K.W.; Oh, K.S. Detection of reactive oxygen species (ROS) and apoptosis in human fragmented embryos. Hum. Reprod. 1998, 13, 998–1002. [Google Scholar] [CrossRef] [PubMed]
- Luberda, Z. The role of glutathione in mammalian gametes. Reprod. Biol. 2005, 5, 5–17. [Google Scholar] [PubMed]
- Sugino, N. Reactive oxygen species in ovarian physiology. Reprod. Med. Biol. 2005, 4, 31–44. [Google Scholar]
- Chen, D.; Li, X.; Liu, X.; Liu, X.; Jiang, X.; Du, J.; Wang, Q.; Liang, Y.; Ma, W. NQO2 inhibition relieves ROS effects on mouse oocyte meiotic maturation and embryo development. Biol. Reprod. 2017, 4, 11–15. [Google Scholar]
- Devine, P.J.; Perreault, S.D.; Luderer, U. Roles of reactive oxygen species and antioxidants in ovarian toxicity. Biol. Reprod. 2012, 86, 27. [Google Scholar] [CrossRef] [PubMed]
- Mishra, A.; Reddy, I.J.; Gupta, P.S.; Mondal, S. l-Carnitine Mediated Reduction in Oxidative Stress and Alteration in Transcript Level of Antioxidant Enzymes in Sheep Embryos Produced In Vitro. Reprod. Domest. Anim. 2016, 51, 311–321. [Google Scholar] [CrossRef] [PubMed]
- Somfai, T.; Ozawa, M.; Noguchi, J. Developmental competence of in vitro-fertilized porcine oocytes after in vitro maturation and solid surface vitrification: Effect of cryopreservation on oocyte antioxida tive system and cell cycle stag. Cryobiology 2007, 55, 115–126. [Google Scholar] [CrossRef] [PubMed]
- Xiao, X.; Li, Y. The effect of different concentration DTT or GSH treatment porcine sperm. Anim. Med. Adv. 2007, 28, 27–32. [Google Scholar]
- Zhang, H.M.; Zhang, Y. Melatonin: A well-documented antioxidant with conditional pro-oxidant actions. J. Pineal Res. 2014, 57, 131–146. [Google Scholar] [CrossRef] [PubMed]
- Slominski, A.T.; Zmijewski, M.A.; Semak, I.; Kim, T.K.; Janjetovic, Z.; Slominski, R.M.; Zmijewski, J.W. Melatonin, mitochondria, and the skin. Cell. Mol. Life Sci. 2017, 74, 3913–3925. [Google Scholar] [CrossRef] [PubMed]
- Suofu, Y.; Li, W.; Jean-Alphonse, F.G.; Jia, J.; Khattar, N.K.; Li, J.; Baranov, S.V.; Leronni, D.; Mihalik, A.C.; He, Y.; et al. Dual role of mitochondria in producing melatonin and driving GPCR signaling to block cytochrome c release. Proc. Natl. Acad. Sci. USA 2017, 114, E7997–E8806. [Google Scholar] [CrossRef] [PubMed]
- He, C.; Wang, J.; Zhang, Z.; Yang, M.; Li, Y.; Tian, X.; Ma, T.; Tao, J.; Zhu, K.; Song, Y.; et al. Mitochondria Synthesize Melatonin to Ameliorate Its Function and Improve Mice Oocyte’s Quality under in Vitro Conditions. Int. J. Mol. Sci. 2016, 17. [Google Scholar] [CrossRef] [PubMed]
- Tamura, H.; Takasaki, A.; Miwa, I.; Taniguchi, K.; Maekawa, R.; Asada, H.; Taketani, T.; Matsuoka, A.; Yamagata, Y.; Shimamura, K.; et al. Oxidative stress impairs oocyte quality and melatonin protects oocytes from free radical damage and improves fertilization rate. J. Pineal Res. 2008, 44, 280–287. [Google Scholar] [CrossRef] [PubMed]
- Brzezinski, A.; Seibel, M.M.; Lynch, H.J.; Deng, M.H.; Wurtman, R.J. Melatonin in human preovulatory follicular fluid. J. Clin. Endocrinol. Metab. 1987, 64, 865–867. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, Y.; Tamura, H.; Takayama, H.; Kato, H. Increased endogenous level of melatonin in preovulatory human follicles does not directly influence progesterone production. Fertil. Steril. 2003, 80, 1012–1016. [Google Scholar] [CrossRef]
- Shi, J.M.; Tian, X.Z.; Zhou, G.B.; Wang, L.; Gao, C.; Zhu, S.E.; Zeng, S.M.; Tian, J.H.; Liu, G.S. Melatonin exists in porcine follicular fluid and improves in vitro maturation and parthenogenetic development of porcine oocytes. J. Pineal Res. 2009, 47, 318–323. [Google Scholar] [CrossRef] [PubMed]
- Tian, X.; Wang, F.; He, C.; Zhang, L.; Tan, D.; Reiter, R.J.; Xu, J.; Ji, P.; Liu, G. Beneficial effects of melatonin on bovine oocytes maturation: A mechanistic approach. J. Pineal Res. 2014, 57, 239–247. [Google Scholar] [CrossRef] [PubMed]
- Tamura, H.; Nakamura, Y.; Korkmaz, A.; Manchester, L.C.; Tan, D.X.; Sugino, N.; Reiter, R.J. Melatonin and the ovary: Physiological and pathophysiological implications. Fertil. Steril. 2009, 92, 328–343. [Google Scholar] [CrossRef] [PubMed]
- Tamura, H.; Nakamura, Y.; Takiguchi, S.; Kashida, S.; Yamagata, Y.; Sugino, N.; Kato, H. Melatonin directly suppresses steroid production by preovulatory follicles in the cyclic hamster. J. Pineal Res. 1998, 25, 135–141. [Google Scholar] [CrossRef] [PubMed]
- Kang, J.; Koo, O.; Kwon, D.; Park, H.; Jang, G.; Kang, S.; Lee, B. Effects of melatonin on in vitro maturation of porcine oocyte and expression of melatonin receptor RNA in cumulus and granulosa cells. J. Pineal Res. 2009, 46, 22–28. [Google Scholar] [CrossRef] [PubMed]
- El-Raey, M.; Geshi, M.; Somfai, T.; Kaneda, M.; Hirako, M.; Abdel-Ghaffar, A.E.; Sosa, G.A.; El-Roos, M.E.; Nagai, T. Evidence of melatonin synthesis in the cumulus oocyte complexes and its role in enhancing oocyte maturation in vitro in cattle. Mol. Reprod. Dev. 2011, 78, 250–262. [Google Scholar] [CrossRef] [PubMed]
- Tan, D.X.; Manchester, L.C.; Qin, L.; Reiter, R.J. Melatonin: A Mitochondrial Targeting Molecule Involving Mitochondrial Protection and Dynamics. Int. J. Mol. Sci. 2016, 17. [Google Scholar] [CrossRef] [PubMed]
- Bormann, C.L.; Ongeri, E.M.; Krisher, R.L. The effect of vitamins during maturation of caprine oocytes on subsequent developmental potential in vitro. Theriogenology 2003, 59, 1373–1380. [Google Scholar] [CrossRef]
- Wang, F.; Tian, X.; Zhang, L.; He, C.; Ji, P.; Li, Y.; Tan, D.; Liu, G. Beneficial effect of resveratrol on bovine oocyte maturation and subsequent embryonic development after in vitro fertilization. Fertil. Steril. 2014, 101, 577–586. [Google Scholar] [CrossRef] [PubMed]
- Sakaguchi, K.; Itoh, M.T.; Takahashi, N.; Tarumi, W.; Ishizuka, B. The rat oocyte synthesises melatonin. Reprod. Fertil. Dev. 2013, 25, 674. [Google Scholar] [CrossRef] [PubMed]
- Antolin, I.; Rodriguez, C.; Sainz, R.M.; Mayo, J.C.; Uria, H.; Kotler, M.L.; Rodriguez-Colunga, M.J.; Tolivia, D.; Menendez-Pelaez, A. Neurohormone melatonin prevents cell damage: Effect on gene expression for antioxidant enzymes. FASEB J. 1996, 10, 882–890. [Google Scholar] [PubMed]
- Mayo, J.C.; Sainz, R.M.; Antoli, I.; Herrera, F.; Martin, V.; Rodriguez, C. Melatonin regulation of antioxidant enzyme gene expression. Cell. Mol. Life Sci. 2002, 59, 1706–1713. [Google Scholar] [CrossRef] [PubMed]
- Castello, P.R.; Drechsel, D.A.; Patel, M. Mitochondria Are a Major Source of Paraquat-induced Reactive Oxygen Species Production in the Brain. J. Biol. Chem. 2007, 282, 14186–14193. [Google Scholar] [CrossRef] [PubMed]
- Izyumov, D.S.; Domnina, L.V.; Nepryakhina, O.K.; Avetisyan, A.V.; Golyshev, S.A.; Ivanova, O.Y.; Korotetskaya, M.V.; Lyamzaev, K.G.; Pletjushkina, O.Y.; Popova, E.N.; et al. Mitochondria as source of reactive oxygen species under oxidative stress. Study with novel mitochondria-targeted antioxidants—The “Skulachev-ion” derivatives. Biochemistry 2010, 75, 123–129. [Google Scholar] [CrossRef] [PubMed]
- Jou, M.; Peng, T.; Yu, P.; Jou, S.; Reiter, R.J.; Chen, J.; Wu, H.; Chen, C.; Hsu, L. Melatonin protects against common deletion of mitochondrial DNA-augmented mitochondrial oxidative stress and apoptosis. J. Pineal Res. 2007, 43, 389–403. [Google Scholar] [CrossRef] [PubMed]
- Ren, L.; Wang, Z.; An, L.; Zhang, Z.; Tan, K.; Miao, K.; Tao, L.; Cheng, L.; Zhang, Z.; Yang, M.; et al. Dynamic comparisons of high-resolution expression profiles highlighting mitochondria-related genes between in vivo and in vitro fertilized early mouse embryos. Hum. Reprod. 2015, 30, 2892–2911. [Google Scholar] [PubMed]
- Semak, I.; Naumova, M.; Korik, E.; Terekhovich, V.; Wortsman, J.; Slominski, A. A Novel Metabolic Pathway of Melatonin: Oxidation by Cytochrome C. Biochemistry 2005, 44, 9300–9307. [Google Scholar] [CrossRef] [PubMed]
- Yamochi, T.; Hashimoto, S.; Amo, A.; Goto, H.; Yamanaka, M.; Inoue, M.; Nakaoka, Y.; Morimoto, Y. Mitochondrial dynamics and their intracellular traffic in porcine oocytes. Zygote 2016, 24, 517–528. [Google Scholar] [CrossRef] [PubMed]
- Nagai, S.; Mabuchi, T.; Hirata, S.; Shoda, T.; Kasai, T.; Yokota, S.; Shitara, H.; Yonekawa, H.; Hoshi, K. Correlation of abnormal mitochondrial distribution in mouse oocytes with reduced developmental competence. Tohoku J. Exp. Med. 2006, 210, 137–144. [Google Scholar] [CrossRef] [PubMed]
- Brevini, T.A.; Cillo, F.; Antonini, S.; Gandolfi, F. Cytoplasmic remodelling and the acquisition of developmental competence in pig oocytes. Anim. Reprod. Sci. 2007, 98, 23–38. [Google Scholar] [CrossRef] [PubMed]
- Bavister, B.D.; Squirrell, J.M. Mitochondrial distribution and function in oocytes and early embryos. Hum. Reprod. 2000, 15 (Suppl. S2), 189–198. [Google Scholar] [CrossRef] [PubMed]
- Selesniemi, K.; Lee, H.J.; Muhlhauser, A.; Tilly, J.L. Prevention of maternal aging-associated oocyte aneuploidy and meiotic spindle defects in mice by dietary and genetic strategies. Proc. Natl. Acad. Sci. USA 2011, 108, 12319–12324. [Google Scholar] [CrossRef] [PubMed]
- Thouas, G.A.; Trounson, A.O.; Wolvetang, E.J.; Jones, G.M. Mitochondrial dysfunction in mouse oocytes results in preimplantation embryo arrest in vitro. Biol. Reprod. 2004, 71, 1936–1942. [Google Scholar] [CrossRef] [PubMed]
- Nollen, E.A.; Morimoto, R.I. Chaperoning signaling pathways: Molecular chaperones as stress-sensing ‘heat shock’ proteins. J. Cell Sci. 2002, 115, 2809–2816. [Google Scholar] [PubMed]
- Qiu, X.B.; Shao, Y.M.; Miao, S.; Wang, L. The diversity of the DnaJ/Hsp40 family, the crucial partners for Hsp70 chaperones. Cell. Mol. Life Sci. 2006, 63, 2560–2570. [Google Scholar] [CrossRef] [PubMed]
- Valleh, M.V.; Hyttel, P.; Rasmussen, M.A.; Strobech, L. Insulin-like growth factor 2: A modulator of anti-apoptosis related genes (HSP70, BCL2-L1) in bovine preimplantation embryos. Theriogenology 2014, 82, 942–950. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.G.; Hu, S.; Han, C.; Zhu, Q.C.; Yan, G.J.; Hu, J.H. Association of heat shock protein 90 with motility of post-thawed sperm in bulls. Cryobiology 2015, 70, 164–169. [Google Scholar] [CrossRef] [PubMed]
- Flores, E.; Cifuentes, D.; Fernandez-Novell, J.M.; Medrano, A.; Bonet, S.; Briz, M.D.; Pinart, E.; Pena, A.; Rigau, T.; Rodriguez-Gil, J.E. Freeze-thawing induces alterations in the protamine-1/DNA overall structure in boar sperm. Theriogenology 2008, 69, 1083–1094. [Google Scholar] [CrossRef] [PubMed]
- Wei, Y.; Hu, W.; Wang, Q.; Zeng, H.; Li, X.; Yan, Y.; Reiter, R.J.; He, C.; Shi, H. Identification, transcriptional and functional analysis of heat-shock protein 90s in banana (Musa acuminata L.) highlight their novel role in melatonin-mediated plant response to Fusarium wilt. J. Pineal Res. 2017, 62, e12367f. [Google Scholar]
- Leja-Szpak, A.; Pierzchalski, P.; Goralska, M.; Nawrot-Porabka, K.; Bonior, J.; Link-Lenczowski, P.; Jastrzebska, M.; Jaworek, J. Kynuramines induce overexpression of heat shock proteins in pancreatic cancer cells via 5-hydroxytryptamine and MT1/MT2 receptors. J. Physiol. Pharmacol. 2015, 66, 711–718. [Google Scholar] [PubMed]
- Hsieh, R.H.; Au, H.K.; Yeh, T.S.; Chang, S.J.; Cheng, Y.F.; Tzeng, C.R. Decreased expression of mitochondrial genes in human unfertilized oocytes and arrested embryos. Fertil. Steril. 2004, 81 (Suppl. S1), 912–918. [Google Scholar] [CrossRef] [PubMed]
- Su, Y.; Wu, X.; O’Brien, M.J.; Pendola, F.L.; Denegre, J.N.; Matzuk, M.M.; Eppig, J.J. Synergistic roles of BMP15 and GDF9 in the development and function of the oocyte-cumulus cell complex in mice: Genetic evidence for an oocyte-granulosa cell regulatory loop. Dev. Biol. 2004, 276, 64–73. [Google Scholar] [CrossRef] [PubMed]
- Wei, L.; Liang, X.; Fang, C.; Zhang, M. Abnormal expression of growth differentiation factor 9 and bone morphogenetic protein 15 in stimulated oocytes during maturation from women with polycystic ovary syndrome. Fertil. Steril. 2011, 96, 464–468. [Google Scholar] [CrossRef] [PubMed]
- Hussein, T.S.; Thopmson, J.G.; Gilchrist, R.B. Oocyte-secreted factors enhance oocyte developmental competence. Dev. Biol. 2006, 296, 514–521. [Google Scholar] [CrossRef] [PubMed]
- Yeo, C.X.; Gilchrist, R.B.; Thompson, J.G.; Lane, M. Exogenous growth differentiation factor 9 in oocyte maturation media enhances subsequent embryo development and fetal viability in mice. Hum. Reprod. 2007, 23, 67–73. [Google Scholar] [CrossRef] [PubMed]
- Miao, Y.; Zhou, C.; Bai, Q.; Cui, Z.; ShiYang, X.; Lu, Y.; Zhang, M.; Dai, X.; Xiong, B. The protective role of melatonin in porcine oocyte meiotic failure caused by the exposure to benzo(a)pyrene. Hum. Reprod. 2017, 3, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Rosse, T.; Olivier, R.; Monney, L.; Rager, M.; Conus, S.; Fellay, I.; Jansen, B.; Borner, C. Bcl-2 prolongs cell survival after Bax-induced release of cytochrome C. Nature 1998, 391, 496–499. [Google Scholar] [CrossRef] [PubMed]
- Porter, A.G.; Jänicke, R.U. Emerging roles of caspase-3 in apoptosis. Cell Death Differ. 1999, 6, 99–104. [Google Scholar] [CrossRef] [PubMed]
- Brackett, B.G.; Oliphant, G. Capacitation of rabbit spermatozoa in vitro. Biol. Reprod. 1975, 12, 260–274. [Google Scholar] [CrossRef] [PubMed]
- Chauhan, M.S.; Singla, S.K.; Palta, P.; Manik, R.S.; Madan, M.L. In vitro maturation and fertilization, and subsequent development of buffalo (Bubalus bubalis) embryos: Effects of oocyte quality and type of serum. Reprod. Fertil. Dev. 1998, 10, 173–177. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.M.; Min, J.T.; Du, W.H.; Hao, H.S.; Liu, Y.; Qin, T.; Wang, D.; Zhu, H.B. Melatonin enhances the in vitro maturation and developmental potential of bovine oocytes denuded of the cumulus oophorus. Zygotzx 2015, 23, 525–536. [Google Scholar] [CrossRef] [PubMed]
Sample Availability: Not available. |









| Groups | No. of Oocytes Observed | No. of MII Oocytes (%) |
|---|---|---|
| IOs | 293 | 174 (59.4 ± 3.14) Aa |
| IOs + MT | 311 | 222 (71.4 ± 1.88) Ab |
| COCs | 421 | 370 (87.9 ± 0.64) Bc |
| Groups | No. of MII Oocytes | No. of Cleavage Embryos (%) | No. of Blastocysts (%) | No. of D8 Hatched Blastocysts (%) |
|---|---|---|---|---|
| IOs | 215 | 142 (66.15 ± 2.64) Aa | 47 (33.1 ± 0.87) Aa | 3 (6.4 ± 2.36) Aa |
| IOs + MT | 228 | 182 (79.8 ± 2.42) ABb | 70 (38.5 ± 1.11) ABb | 9 (12.9 ± 2.99) ABa |
| COCs | 369 | 334 (90.5 ± 0.60) Bc | 147 (44.0 ± 0.74) Bc | 42 (28.6 ± 1.01) Bb |
| Groups | Cell Number/Blastocyst | Pooled SEM |
|---|---|---|
| IOs | 104.9 Aa | 3.51 |
| IOs + MT | 115.8 ABb | 1.71 |
| COCs | 122.3 Bb | 3.57 |
| Genes | Primer Sequence(5′-3′) | Tm (°C) | Product Size (bp) |
|---|---|---|---|
| β-Actin | Forward:TGACGTTGACATCCGTAAAGACC | 60 | 117 |
| Reverse: GTGCTAGGAGCCAGGGCAG | |||
| Gpx-4 | Forward: TGTGCTCGCTCCATGCACGA | 60 | 224 |
| Reverse: CCTGGCTCCTGCCTCCCAA | |||
| SOD1 | Forward: GCTGTACCAGTGCAGGTCCTCA | 60 | 228 |
| Reverse: CATTTCCACCTCTGCCCAAGTC | |||
| Caspase-3 | Forward: CAGACAGTGGTGCTGAGGATGA | 60 | 211 |
| Reverse: GCTACCTTTCGGTTAACCCGA | |||
| Bcl-2 | Forward: GACTGACACTGAGTTTGGCTACG | 60 | 152 |
| Reverse: GAGTCCTTTCCACTTCGTCCTG | |||
| Bax | Forward: GGCTGGACATTGGACTTCCTTC | 60 | 161 |
| Reverse:TGGTCACTGTCTGCCATGTGG | |||
| BMP-15 | Forward: GAGGCTCCTGGCACATACAGAC | 60 | 134 |
| Reverse:CTCCACATGGCAGGAGAGGT | |||
| GDF-9 | Forward: CAGAAGCCACCTCTACAACACTG | 60 | 95 |
| Reverse: CTGATGGAAGGGTTCCTGCTG | |||
| ATPase6 | Forward: GAACACCCACTCCACTAATCCCAAT | 60 | 147 |
| Reverse: GTGCAAGTGTAGCTCCTCCGATT | |||
| ATPase8 | Forward: CACAATCCAGAACTGACACCAACAA | 60 | 129 |
| Reverse: CGATAAGGGTTACGAGAGGGAGAC | |||
| HSP90 | Forward: TCATTGGCTATCCCATCACTCT | 60 | 324 |
| Reverse: AATCGTTGGTCAGGCTCTTGTA |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, M.; Tao, J.; Chai, M.; Wu, H.; Wang, J.; Li, G.; He, C.; Xie, L.; Ji, P.; Dai, Y.; et al. Melatonin Improves the Quality of Inferior Bovine Oocytes and Promoted Their Subsequent IVF Embryo Development: Mechanisms and Results. Molecules 2017, 22, 2059. https://doi.org/10.3390/molecules22122059
Yang M, Tao J, Chai M, Wu H, Wang J, Li G, He C, Xie L, Ji P, Dai Y, et al. Melatonin Improves the Quality of Inferior Bovine Oocytes and Promoted Their Subsequent IVF Embryo Development: Mechanisms and Results. Molecules. 2017; 22(12):2059. https://doi.org/10.3390/molecules22122059
Chicago/Turabian StyleYang, Minghui, Jingli Tao, Menglong Chai, Hao Wu, Jing Wang, Guangdong Li, Changjiu He, Lu Xie, Pengyun Ji, Yunping Dai, and et al. 2017. "Melatonin Improves the Quality of Inferior Bovine Oocytes and Promoted Their Subsequent IVF Embryo Development: Mechanisms and Results" Molecules 22, no. 12: 2059. https://doi.org/10.3390/molecules22122059
APA StyleYang, M., Tao, J., Chai, M., Wu, H., Wang, J., Li, G., He, C., Xie, L., Ji, P., Dai, Y., Yang, L., & Liu, G. (2017). Melatonin Improves the Quality of Inferior Bovine Oocytes and Promoted Their Subsequent IVF Embryo Development: Mechanisms and Results. Molecules, 22(12), 2059. https://doi.org/10.3390/molecules22122059

