Next Article in Journal
Asperaculanes A and B, Two Sesquiterpenoids from the Fungus Aspergillus aculeatus
Next Article in Special Issue
Stem Bark Extract and Fraction of Persea americana (Mill.) Exhibits Bactericidal Activities against Strains of Bacillus cereus Associated with Food Poisoning
Previous Article in Journal
Protective Effects of Lycium barbarum Polysaccharide on 6-OHDA-Induced Apoptosis in PC12 Cells through the ROS-NO Pathway
Previous Article in Special Issue
In Silico Affinity Profiling of Neuroactive Polyphenols for Post-Traumatic Calpain Inactivation: A Molecular Docking and Atomistic Simulation Sensitivity Analysis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Ag+ as a More Effective Elicitor for Production of Tanshinones than Phenolic Acids in Salvia miltiorrhiza Hairy Roots

1
College of Life Science, Zhejiang Sci-Tech University, 928 Second Avenue, Xiasha Higher Education Zone, Hangzhou 310018, Zhejiang, China
2
Tasly R&D Institute, Tasly Holding Group Co. Ltd, Tianjin 300410, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Molecules 2015, 20(1), 309-324; https://doi.org/10.3390/molecules20010309
Submission received: 3 October 2014 / Accepted: 5 December 2014 / Published: 24 December 2014

Abstract

Phenolic acids and tanshinones are two groups of bioactive ingredients in Salvia miltiorrhiza Bunge. As a heavy metal elicitor, it has been reported that Ag+ can induce accumulations of both phenolic acids and tanshinones in S. miltiorrhiza hairy roots. In this study, the effects of Ag+ treatment on accumulations of six phenolic acids and four tanshinones in S. miltiorrhiza hairy roots were investigated. To further elucidate the molecular mechanism, expressions of key genes involved in the biosynthesis of these ingredients were also detected. The results showed that although the total phenolic acids content was almost not affected by Ag+, accumulations of rosmarinic acid (RA), caffeic acid and ferulic acid were significantly increased, while accumulations of salvianolic acid B (LAB), danshensu (DSU) and cinnamic acid were decreased. We speculate that LAB probably derived from the branch pathway of DSU biosynthesis. Contents of four tanshinones were enhanced by Ag+ and their accumulations were more sensitive to Ag+ than phenolic acids. Genes in the upstream biosynthetic pathways of these ingredients responded to Ag+ earlier than those in the downstream biosynthetic pathways. Ag+ probably induced the whole pathways, upregulated gene expressions from the upstream pathways to the downstream pathways, and finally resulted in the enhancement of ingredient production. Compared with phenolic acids, tanshinone production was more sensitive to Ag+ treatments. This study will help us understand how secondary metabolism in S. miltiorrhiza responds to elicitors and provide a reference for the improvement of the production of targeted compounds in the near future.

Graphical Abstract

1. Introduction

Salvia miltiorrhiza Bunge, known as “Dan Shen” in Chinese, is famous for the prevention and treatment of coronary heart disease. It contains two major groups of bioactive ingredients, namely phenolic acids and tanshinones [1]. The phenolic acids mainly include (R)-2-Hydroxy-3-(3,4-dihydroxyphenyl) propionic acid (danshensu, DSU), caffeic acid, cinnamic acid, ferulic acid, protocatechuic aldehyde, rosemarinic acid (RA) and salvianolic acid B (LAB) [2] and the tanshinones include tanshinone I (T-I), dihydrotanshinone I (DT-I), cryptotanshinone (CT), tanshinone II A (T-IIA) and tanshinone IIB (T-IIB) [3] (Figure 1). Phenolic acids have been widely used because of their potential in the treatment of atherogenic dyslipidemia and cholestatic liver injury [4]. Tanshinones are reported to have anti-platelet, cardioprotective, and anti-inflammatory effects [5,6,7].
Figure 1. The chemical structure of ten compounds in S. miltiorrhiza have been studied in this article. Six water-soluble phenolic acids and four lipid-soluble tanshinones.
Figure 1. The chemical structure of ten compounds in S. miltiorrhiza have been studied in this article. Six water-soluble phenolic acids and four lipid-soluble tanshinones.
Phenolic acids are mainly produced from the phenylpropanoid and tyrosine-derived pathways [8] (Figure 2). The biosynthetic pathways of rosmarinic acid have been elucidated. Phenylalanine ammonia-lyase (PAL), cinnamic acid 4-hydroxylase (C4H) and hydroxycinnamate coenzyme A ligase (4CL) are key genes in the phenylpropanoid pathway. Tyrosine aminotransferase (TAT) and 4-hydroxyphenylpyruvate reductase (HPPR) are two key genes in the tyrosine-derived pathway. Rosmarinic acid synthase (RAS) and CYP98A14 are two important enzymes that convert 4-coumaroyl-CoA and 4-hydroxphenyllactic acid to RA [9].
Figure 2. The metabolic pathways of rosmarinic acid and salvianolic acid B in S. miltiorrhiza hairy roots. Multiple enzymatic steps are represented by dotted lines. C4H, cinnamic acid 4-hydroxylase; 4CL, hydroxycinnamate coenzyme A ligase; HPPR, 4-hydroxyphenylpyruvate reductase; PAL, phenylalanine ammonia-lyase; RAS, rosmarinic acid synthase; TAT, tyrosine aminotransferase; CYP98A14, acytochrome P450-dependent monooxygenase.
Figure 2. The metabolic pathways of rosmarinic acid and salvianolic acid B in S. miltiorrhiza hairy roots. Multiple enzymatic steps are represented by dotted lines. C4H, cinnamic acid 4-hydroxylase; 4CL, hydroxycinnamate coenzyme A ligase; HPPR, 4-hydroxyphenylpyruvate reductase; PAL, phenylalanine ammonia-lyase; RAS, rosmarinic acid synthase; TAT, tyrosine aminotransferase; CYP98A14, acytochrome P450-dependent monooxygenase.
Phenolic acids are important effective compounds in S. miltiorrhiza, and their biosynthetic regulation has been widely studied. Many elicitors (biotic and abiotic) have been used to enhance phenolic acid production, such as polysaccharides, glycoproteins, low-molecular weight organic acids, fungal cell-wall materials, ultraviolet irradiation and heavy metal salts [8,10,11,12]. Our studies showed that salicylic acid (SA), abscisic acid (ABA), gibberellinic acid (GA), yeast extract (YE), methyl jasmonate (MeJA) and fungi extract could induce phenolic acid accumulation [8,13,14]. Overexpression of key genes in the biosynthetic pathway could promote secondary metabolite production [15]. Overexpression of key genes in LAB biosynthesis pathways (PAL, C4H, 4CL, TAT, HPPR and RAS) could increase accumulation of phenolic acids, and the downregulation of these genes could reduce their accumulation in S. miltiorrhiza [16].
Terpenoids are biosynthesized via two pathways in plants: the mevalonate (MVA) pathway in the cytosol and the methylerythritol phosphate (MEP) pathway in plastids [7,17,18]. 3-Hydroxy-3-methylglutaryl CoA reductase (HMGR) is a rate-limiting enzyme and catalyzes formation of mevalonate (MVA) from 3-hydroxy-3-methylglutaryl CoA. 1-deoxy-D-xylulose 5-phosphate synthase (DXS) and 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) are the first two key enzymes in the MEP pathway. Geranylgeranyl diphosphate synthase (GGPPS) catalyzes the consecutive condensation of the dimethylallyl diphosphate (DMAPP) with three molecules of IPP to produce geranylgeranyl diphosphate (GGPP), the universal precursor for the biosynthesis of diterpenoids such as the tanshinones. GGPPS has been considered an important regulatory target in the tanshinone biosynthetic pathway [19]. GGPP is then converted by copalyl diphosphate synthase (CPS) and kaurene synthase-like (KSL) to miltiradiene, which has recently been identified as a precursor of tanshinone biosynthesis [20]. Elicitors such as La, MeJA, YE, SA and Ag+ can stimulate tanshinone accumulation in S. miltiorrhiza hairy roots [21,22,23]. Although expressions of HMGR, DXR, DXS, GGPPS, CPS and KSL can be induced by MeJA, we found that the MEP pathway probably plays a more important role in tanshinone accumulation [18]. Overexpression of GGPPS, HMGR and DXS in transgenic hairy root lines can significantly enhance tanshinone production [24]. RNA interference (RNAi) of CPS reduced dihydrotanshinone I and cryptotanshinone accumulations [20].
As a group of efficient abiotic elicitors, the use of metal ions including Ca2+, Co2+, Ag+, Cd2+, Cu2+, Ce3+, La+, Mn2+ and Zn2+ to induce bioactive ingredient production in plants has been widely researched [21,25,26]. Among them, Ag+ was the mostly studied. In Vitis vinifera cell suspension cultures, Ag+ at a low concentration (5.0 μM) stimulated 3-O-glucosylresveratrol production, but it did not affect cell growth [26]. High concentrations of Ag+ (30 μM) can enhance paclitaxel yield in suspension culture of Taxus spp. Cells [27]. Ag+ can also improve echinacoside and acteoside production in cell suspension cultures of Cistanchede serticola [28]. In S. miltiorrhiza hairy roots, treatment with 15 μM Ag+ significantly increased RA accumulation, as well as total phenolic acid content [12]. However, Xiao reported that LAB is more sensitive to Ag+ than RA, and the content of RA was not affected [29]. In terms of tanshinone accumulation, the previous work showed that tanshinone production was significantly enhanced by Ag+ probably via the non-MVA pathway [30]. There is currently a lack of information regarding the comparison of how the two groups of bioactive compounds in S. miltiorrhiza respond to Ag+.
In this study, to reveal the effects of Ag+ treatments on both phenolic acid and tanshinone production, and elucidate the regulatory mechanisms of the biosynthesis of these ingredients, accumulations of six phenolic compounds and four tanshinone compounds were examined. Simultaneously, expressions of 15 genes involved in biosynthesis of these ingredients were investigated.

2. Results and Discussion

2.1. Effects of Ag+ Elicitor on Cell Growth of S. miltiorrhiza Hairy Roots

Treatments with Ag+, the biomass of S. miltiorrhiza hairy roots in shake-flask cultures showed an increasing trend in both the control and the treatment groups (Figure 3A). Compared with the control, the hairy roots growth was almost not affected by Ag+ in the first 6 days after treatment and was slightly depressed on day 9. However, the dry weight (DW)/fresh weight (FW) was significantly increased at 1, 2, 6 and 9 days after treatment. This means that Ag+ elicitor decreased the growth of S. miltiorrhiza hairy roots and reduced the water content in hairy roots (Figure 3B).
Figure 3. Effects of Ag+ elicitor on cell growth of S. miltiorrhiza hairy roots. (A) Dry weight (DW) of the S. miltiorrhiza hairy roots after Ag+ treatment; (B) Dry weight/Fresh weight (FW) ratio of the S. miltiorrhiza hairy roots after Ag+ treatment. The vertical bars show the SD values (n = 3). The asterisks indicate statistically significant differences at p < 0.05 (*, 0.01 < p < 0.05; **, 0.001 < p < 0.01.) between the content in the elicitor treated cultures and that in the corresponding controls.
Figure 3. Effects of Ag+ elicitor on cell growth of S. miltiorrhiza hairy roots. (A) Dry weight (DW) of the S. miltiorrhiza hairy roots after Ag+ treatment; (B) Dry weight/Fresh weight (FW) ratio of the S. miltiorrhiza hairy roots after Ag+ treatment. The vertical bars show the SD values (n = 3). The asterisks indicate statistically significant differences at p < 0.05 (*, 0.01 < p < 0.05; **, 0.001 < p < 0.01.) between the content in the elicitor treated cultures and that in the corresponding controls.

2.2. Effects of Ag+ Elicitor on Accumulation of Phenolic Acids in S. miltiorrhiza Hairy Roots

In this study, six phenolic acids compounds were examined (RA, LAB, DSU, caffeic acid, ferulic acid and cinnamic acid).
Figure 4. Effects of Ag+ on accumulations of phenolic acids in S. miltiorrhiza hairy roots. Content of RA (rosmarinic acid), LAB (salvianolic acid B), DSU, caffeic acid, ferulic acid, cinnamic acid and total phenolic acids. The vertical bars show the SD values (n = 3). The asterisks indicate statistically significant differences at p < 0.05 (*, 0.01 < p < 0.05; **, 0.001 < p < 0.01.) between the content in the elicitor treated cultures and that in the corresponding controls.
Figure 4. Effects of Ag+ on accumulations of phenolic acids in S. miltiorrhiza hairy roots. Content of RA (rosmarinic acid), LAB (salvianolic acid B), DSU, caffeic acid, ferulic acid, cinnamic acid and total phenolic acids. The vertical bars show the SD values (n = 3). The asterisks indicate statistically significant differences at p < 0.05 (*, 0.01 < p < 0.05; **, 0.001 < p < 0.01.) between the content in the elicitor treated cultures and that in the corresponding controls.
With Ag+ treatment, RA content was significantly increased to 15.27 mg/g DW on day 6 after treatment (1.3-fold of the control). Accumulations of caffeic acid and ferulic acid were also stimulated by Ag+, and the maximum contents were 0.37 mg/g DW and 0.11 mg/g DW, respectively. However, contents of DSU, cinnamic acid and LAB were significantly inhibited by Ag+, and were just 22%, 65% and 70% of the control levels, respectively. The results indicated that Ag+ induced accumulations of RA, caffeic acid and ferulic acid, but decreased contents of LAB, DSU and cinnamic acid. However, accumulation of the total phenolic acids was almost not affected by Ag+ treatment (Figure 4).

2.3. Effects of Ag+ Elicitor on Tanshinones Accumulation in S. miltiorrhiza Hairy Roots

Contents of four lipid-soluble tanshinones components (T-I, T-IIA, CT and DT-I) were examined in this study. The results showed that the four tanshinone components were induced by Ag+ and their contents reached a maximum on day 6 post-treatment (Figure 5). Contents of T-I, T-IIA, CT and DT-I reached to 0.82 mg/g DW (1.46-fold of the control), 0.34 mg/g DW (1.42-fold of the control), 0.42 mg/g DW (4.4-fold of the control) and 0.60 mg/g DW (2.56-fold of the control), respectively. The total tanshinone accumulation was significantly induced by Ag+. The maximum content of total tanshinones reached to 2.37 mg/g DW on day 6 post-treatment (2.2-fold of the control) (Figure 5).
Figure 5. Effects of Ag+ on accumulations of tanshinones in S. miltiorrhiza hairy roots. Content of T-I (tanshinone I), T-IIA (tanshinone IIA), CT (cryptotanshinone), DT-I (dihydrotanshinone I) and total tanshinones. The vertical bars show the SD values (n = 3). The asterisks indicate statistically significant differences at p < 0.05 (*, 0.01 < p <0.05; **, 0.001 < p < 0.01; ***, p < 0.001.) between the content in the elicitor treated cultures and that in the corresponding controls.
Figure 5. Effects of Ag+ on accumulations of tanshinones in S. miltiorrhiza hairy roots. Content of T-I (tanshinone I), T-IIA (tanshinone IIA), CT (cryptotanshinone), DT-I (dihydrotanshinone I) and total tanshinones. The vertical bars show the SD values (n = 3). The asterisks indicate statistically significant differences at p < 0.05 (*, 0.01 < p <0.05; **, 0.001 < p < 0.01; ***, p < 0.001.) between the content in the elicitor treated cultures and that in the corresponding controls.

2.4. Effects of Ag+ Elicitor on Genes Expressions Involved in the Two Parallel Pathways of LAB Biosynthesis

Expressions of seven key genes in RA biosynthesis pathways were determined in this study, including PAL, C4H, 4CL, TAT, HPPR, RAS and CYP98A14 (Figure 6).
Figure 6. Effects of Ag+ on the expression level of seven key enzyme genes of RA biosynthesis pathway (phenylpropanoid pathway and the tyrosine pathway) in S. miltiorrhiza hairy roots. The vertical bars show the SD values (n = 3). The asterisks indicate statistically significant differences at p < 0.05 (*, 0.01 < p <0.05; **, 0.001 < p < 0.01; ***, p < 0.001.) between the content in the elicitor treated cultures and that in the corresponding controls.
Figure 6. Effects of Ag+ on the expression level of seven key enzyme genes of RA biosynthesis pathway (phenylpropanoid pathway and the tyrosine pathway) in S. miltiorrhiza hairy roots. The vertical bars show the SD values (n = 3). The asterisks indicate statistically significant differences at p < 0.05 (*, 0.01 < p <0.05; **, 0.001 < p < 0.01; ***, p < 0.001.) between the content in the elicitor treated cultures and that in the corresponding controls.
The results showed that expression levels of genes in the upstream pathway (PAL, C4H, 4CL, TAT and HPPR) were greatly promoted by Ag+ and reached their maximum on day 1 post-treatment. Their expression levels were 29.18-fold, 5.43-fold, 12.76-fold, 13.15-fold and 22.83-fold of the control levels, respectively. Then, expressions of those genes decreased gradually (Figure 6). This indicated PAL was more sensitive to Ag+ than C4H, 4CL, TAT and HPPR. However, responses of two genes in the downstream pathway (RAS and CYP98A14) were later and reached to their maximum expression levels on day 6 after treatment, 16.14-fold (RAS) and 1.44-fold (CYP98A14) of the control levels, respectively (Figure 6). The results indicated that the upstream genes responded to Ag+ earlier than the downstream genes.
Figure 7. Effects of Ag+ on the expression level of seven key enzyme genes of RA tanshinones biosynthesis pathway (MEP pathway and MVA pathway) in S. miltiorrhiza hairy roots. The vertical bars show the SD values (n = 3). The asterisks indicate statistically significant differences at p < 0.05 (*, 0.01 < p <0.05; **, 0.001 < p < 0.01; ***, p < 0.001.) between the content in the elicitor treated cultures and that in the corresponding controls.
Figure 7. Effects of Ag+ on the expression level of seven key enzyme genes of RA tanshinones biosynthesis pathway (MEP pathway and MVA pathway) in S. miltiorrhiza hairy roots. The vertical bars show the SD values (n = 3). The asterisks indicate statistically significant differences at p < 0.05 (*, 0.01 < p <0.05; **, 0.001 < p < 0.01; ***, p < 0.001.) between the content in the elicitor treated cultures and that in the corresponding controls.

2.5. Effects of Ag+ Elicitor on Genes Expression Involved in Pathways of Tanshinones Biosynthesis

HMGR, DXS1, DXS2, DXR, GGPPS were key genes in the upstream pathways of tanshinones biosynthesis. CPS, KSL and CYP76AH1 were key genes in the downstream pathways. In this study, expression levels of these genes were detected by RT-qPCR. The results showed that expressions of HMGR, DXS1, DXS2 and DXR were dramatically induced by Ag+ on day 1 (Figure 7). Then their expressions decreased to control levels on day 2 and 6, but sharply increased on day 3 and 9. HMGR gene expression level increased by 9.32-fold, while DXS1, DXS2, DXR and GGPPS increased by 5.12-fold, 39.13-fold, 88.38-fold and 37.10-fold on day 1 post-treatment, respectively. However, CPS, KSL and CYP76AH1 reached their maximum expression levels until day 9 after treatment, and increased by 78.67-fold, 220.50-fold and 4.02-fold of the control level, respectively. The results indicated that genes in the upstream pathway responded to Ag+ earlier than the downstream genes.

2.6. Discussion

Phenolics and tanshinones are two important groups of bioactive compounds in S. miltiorrhiza. The biosynthetic mechanisms of these compounds has been widely studied because of their medicinal value. Phenolic acids were mainly produced through the phenylpropanoid and tyrosine pathways, and tanshinones are biosynthesized via the MVA and MEP pathways. Various elicitors have been used to improve the accumulation of these bioactive ingredients in S. miltiorrhiza [31]. However, the regulation mechanisms of phenolic acid and tanshinone biosynthesis by elicitors is still unclear.
Among abiotic elicitors, heavy metals have a significant impact on plant growth and secondary metabolism. It was reported that Ca2+, Ag+, and Cd2+ could improve the production of tropane alkaloids in hairy roots cultures of Brugmansia candida [32]. Many kinds of heavy metal were also used as elicitors to induce accumulations of bioactive compounds in S. miltiorrhiza, such as Co2+, Ag+, Cd2+, Cu2+, Ce3+, La, Mn2+ and Zn2+ etc., [12,21,24,33]. Among them, Ag+ was considered as an effective elicitor for phenolic compound and tanshinone production in S. miltiorrhiza hairy roots, and could improve RA, LAB and tanshinones production. But it was also reported that RA accumulation was almost not affected by Ag+ [29], so whether Ag+ have significant effect on phenolic acids remains unclear. No report compares how the two groups of bioactive compounds respond to Ag+.
LAB was considered as a derivative of RA, and its accumulation was affected by RA content [9]. In this study, we found that accumulations of all the six phenolic compounds were influenced by Ag+ (Figure 4). RA content reached 1.57-fold of the control (on day 9), but LAB content was reduced to 70% of the control. This result was the same as Yan’s report [12]. DSU was derived from 4-hydroxphenyllactic acid, and is a main degradation product of LAB [34]. In this work, we found that DSU accumulation was decreased by Ag+ as well as LAB. In another experiment of our lab, overexpression of RAS resulted in a decrease of LAB content, but increased RA content (unpublished data). Therefore, we speculated that DSU was probably a precursor of LAB biosynthesis and LAB was probably not biosynthesized from RA pathway but from DSU branch pathway (Figure 2). However, Xiao found that LAB was dramatically induced by Ag+ while RA content was not affected [29]. The reason of inconsistency may be the difference between bacterial strains used to obtain the hairy roots and the different harvest time we selected. Caffeic acid, ferulic acid and cinnamic acid are three upstream metabolites in the phenyl-propanoid pathway. Cinnamic acid is a precursor of caffeic acid and ferulic acid biosynthesis. Cinnamic acid accumulation was decreased, while accumulations of the two derivatives (caffeic acid and ferulic acid) were increased by Ag+. However, content of total phenolic acids was almost unaffected by Ag+ (Figure 5). It was probably because that metabolic flux among various phenolic acids was influenced by Ag+.
Changes of the six phenolic acids’ accumulations may be caused by gene expression in the phenylpropanoid and tyrosine pathways. PAL is the first key enzyme in the phenylpropanoid pathway, and its expression is closely related to accumulations of RA and other phenolics. Down-regulation of PAL markedly reduced accumulations of RA and LAB [35]. C4H, TAT and HPPR expressions were also related to accumulations of RA and LAB [36]. Our gene expression results indicated that both the phenylpropanoid and tyrosine pathways were affected by Ag+. Gene expressions in the upstream pathway responded to Ag+ earlier than those in the downstream pathway (Figure 7). This demonstrated Ag+ probably induced the whole phenolic acid biosynthesis pathway, and up-regulated gene expression from the upstream pathway to the downstream pathway, and this finally resulted in an enhancement of phenolic acid production.
As another group of bioactive compounds in S. miltiorrhiza, tanshinone production was also promoted by various elicitors (YE, fungi, PEG and ABA etc.) [10,33,37]. Ag+ has been widely reported to enhance tanshinone production in S. miltiorrhiza hairy roots [22,24,38]. Ge used 30 µM Ag+ to treat S. miltiorrhiza hairy roots, and found that the maximum content of the total tanshinones was 1.2-fold of the control [30]. In another report, 25 µM Ag+ could improve CT, T-I and T-IIA contents by 30-fold, 0.87-fold, 3.9-fold, respectively [33]. In this study, accumulations of four tanshinones components were also induced by Ag+ (Figure 5), and the maximum contents of T-I, T-IIA, CT and DT-I was 1.45-fold, 1.63-fold, 4.4-fold and 2.55-fold of the control, respectively. The maximum content of the total tanshinones was increased by 2-fold, which was much higher than the present reports. This indicated that Ag+ was an effective elicitor of tanshinone production, and CT was more sensitive to Ag+ than other tanshinone compounds.
The increase of tanshinone accumulation probably resulted from up-regulation of gene expression in the MEP and MVA pathways. With 30 µM Ag+ treatment, expression of many genes such as HMGR, DXS2, GGPPS and CPS in S. miltiorrhiza hairy roots was induced [22,39]. Our results showed that key genes in the two pathways were all induced by Ag+ (Figure 7). Expression of HMGR was increased by 9.31-fold (day 1) and expressions of DXS1, DXS2, DXR increased by 5.12-fold, 39.13-fold, 88.38-fold and 37.10-fold, respectively (day 1). It was indicated that the MEP pathway was more sensitive to Ag+ than the MVA pathway. This result was similar to previous reports [18]. However, expression of genes in the downstream pathway responded later than the upstream genes. The results were the same as those of the genes involved in phenolic acid biosynthesis.

3. Experimental Section

3.1. Hairy Roots Culture

Agrobacterium rhizogenes (ATCC15834) with Ri (root inducing) T-DNA (transfer DNA) was used to infect S. miltiorrhiza aseptic leaves, then the hairy roots of S. miltiorrhiza were obtained. 6,7-V liquid medium (with 30 g·L−1 sucrose) was used to culture the hairy roots. The hairy roots were maintained in a 100 mL beaker flask with 50 mL 6,7-V liquid medium. Each beaker flask was inoculated with 0.2 g fresh hairy roots and placed on an orbital shaker at 110 rpm·min−1, 25 °C in the dark. Elicitation was performed on the 18th day after inoculation. The hairy roots were harvested from the culture medium on days 1, 2, 3, 6 and 9 post-treatment. The fresh weight of each sample was recorded. Take half of each sample to isolate RNA, while the others were dried at 50 °C in an oven until constant dry weight for metabolites content analysis. Untreated hairy roots were designated as the control. The experiment was performed in triplicate, and the results are means ± SD.

3.2. Preparation of Ag+ Elicitor

Silver ions (Ag+) were supplied to the culture at a final concentration of 15 μM, using a concentrated silver thiosulfate (Ag2S2O3) solution prepared by mixing AgNO3 and Na2S2O3 at a molar ratio of 1:4. Then it was sterilized by filtration (0.22 μm membrane).

3.3. Metabolite Extraction and HPLC Analysis

Compound extraction and analysis followed the methods described by Yang [10] with minor modifications. The dried hairy root was ground to a powder with a mortar and pestle. The sample powder (50 mg) was extracted with 70% methanol (5 mL) under sonication for 45 min, then centrifuged at 8000 rpm (6010× g) for 10 min. The supernatant was ready to use for HPLC analysis. The metabolite contents were determined on a Waters HPLC system (Waters, Milford, MA, USA) equipped with a 1525 binary pump, a manual sample injector and a Waters 2996 photodiode array detector (PDA). Chromatography separation was performed with a SunFire C18 column (4.6 mm × 250 mm, 5 mm particle size) at 30 °C. Empower 2 software was used for data acquisition and processing. The sample injection volume was 20 µL and the PDA detection wavelength for the lipid-soluble diterpenoids were 270 nm, and for the water-soluble phenolic acids was 280 nm. Separation was achieved by elution using a linear gradient with solvent-A (acetonitrile) and solvent-B (0.02% phosphoric acid solution). The gradient was as follows: t = 0 min, 5% A; t = 10 min, 20% A; t = 15 min, 25% A; t = 20 min, 25% A; t = 25 min, 20% A; t = 28 min, 30% A; t = 36 min, 30% A. The flow rate was 1.0 mL·min−1. Standards of metabolite compounds were purchased from the National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China) [8].

3.4. RNA Isolation and Real-Time Quantitative PCR Analysis

Total RNAs from S. miltiorrhiza hairy roots were extracted at selected time points using RNAisoTM Plus (Takara, Tokyo, Japan) according to the manufacturer’s instructions. The quality and concentration of RNA were examined by ethidium bromide (EB)-stained agarose gel electrophoresis and spectrophotometer analysis (Thermo Scientific NanoDrop 2000). The first strand cDNA for RT-qPCR was synthesized from 1 µg total RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time, Takara, Tokyo, Japan). Primers used for RT-qPCR were list at Table 1. The constitutively expressed 18S rRNA with specific primers F18S (5’-ATGATAACTCGACGGATCGC-3’) and R18S (5’-CTTGGATGTGGTAGCCGTTT-3’) were used as control. Real-time PCR was performed according to the manufacturer’s instruction of SYBR® Premix Ex Taq™ II (TliRNaseH Plus, Takara) using the following protocol: 95 °C, 30 s, 1 cycle; 95 °C, 5 s, annealing temperature (Tm), 30 s, 40 cycles. The program was performed on the Mastercyclerep realplex4 system (Eppendorf, Hamburg, Germany). Quantification of the gene expression was done with comparative CT method (2−ΔΔCT). Experiments were performed in triplicate, and the results were represented by their means ± SD.
Table 1. List of RT-qPCR primers.
Table 1. List of RT-qPCR primers.
GeneSense Primer (5’ to 3’)Reverse Prime (5’ to 3’)Genbank ID
PALGGCGGCGATTGAGAGCAGGAATCAGCAGATAGGAAGAGGAGCACCGQ249111
4CLTCGCCAAATACGACCTTTCCTGCTTCAGTCATCCCATACCCAY237164
C4HCCAGGAGTCCAAATAACAGAGCCGAGCCACCAAGCGTTCACCAAEF377337
TATTTCAACGGCTACGCTCCAACTAAACGGACAATGCTATCTCAATDQ334606
HPPRGACTCCAGAAACAACCCACATTCCCAGACGACCCTCCACAAGADQ099741
CYP98A14CTAAGGAGGTGCTGAAGGAGGTGGAGTCGTTGTAGATGGAHQ316179
RASCGCCCTAGTTGAGTTCTACCCTTACGCTCGGATAGGTGGTGCTCGTTTGCFJ906696
HMGRGCAACATCGTCTCCGCCGTCTACAGATGGTGGCCAGCAGCCTGGAGTTFJ747636
DXS1CGACCAGGTAGTGCACGACGTCATCTGAAGGAGCCATCACCACEU670744
DXS2TTGGAGATTGGGAAGGGAAGGATAGGCTTGCAGAATCTCGCATCAGFJ643618
DXRGAGAATCTACTGCTCCGAGACTGGTCGTAGTGGATGATCTDQ991431
GGPPSGGGGCTATTTTGGGAGGTGGAACAGCAGCTTGGGATACGTGGTCFJ178784
CPSGAGGGAGAGGTGAGGAAGGAAAGGGAACAAAAGTTGAAAAGGEU003997
KSLCATGTCGAACAAGGACGTAAATCATCCAAGGTTAGTGCCEF635966
CYP76AH1CAGGAGGTGAACGGCTATCTGTTATGAACCAGAGTCGCAGTAGJX422213

4. Conclusions

In conclusion, the production of both phenolic acids and tanshinones except DSU, LAB and cinnamic acid were enhanced by Ag+ treatment, but Ag+ was more effective at stimulating tanshinone production than that of phenolic acids. LAB was probably derived from the branch pathway of DSU biosynthesis, and the MEP pathway was more sensitive to Ag+ than the MVA pathway. Genes in the upstream pathways responded to Ag+ earlier than those in the downstream pathway. Ag+ probably induced the whole pathways of those ingredients’ biosyntheses, upregulated gene expressions from the upstream pathway to the downstream pathway, and this finally resulted in the enhancement of ingredient production. This study will help us understand how secondary metabolism in S. miltiorrhiza responds to elicitors and provide a reference for the improvement of targeted compound production in the near future.

Acknowledgments

This material is based upon work funded by National Natural Science Foundation of China (No.81373908 and No.81403033), Science Foundation of Zhejiang Sci-Tech University (No.1204806-Y), Public Project of Technological Application in Zhejiang Province (No.2014C32108) and China Postdoctoral Science Foundation Funded Project (No.2014M551771). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Author Contributions

Z.L. designed experiments. B.X. and D.Y. carried out most the experiments and analyzed the data. W.G. and D.Y. analyzed the data. B.X., D.Y. and Z.L. wrote the paper. X.Y., Y.Z. and Y.L. provided materials and revised the paper. All authors have read and approved the final manuscript.

Abbreviation

ABA
abscisic acid
C4H
cinnamic acid 4-hydroxylase
CPS
copalyl diphosphate synthase
CT
cryptotanshinone
CYP98A14
cytochrome P450-dependent monooxygenase
CYP76AH1
cytochrome P450-dependent monooxygenase
DMAPP
dimethylallyl diphosphate
DTI I
dihydrotanshinone I
DXR
1-deoxy-d-xylulose 5-phosphate reductoisomerase
DXS
1-deoxy-d-xylulose 5-phosphate synthase
DW
dry weight
EB
ethidium bromide
FW
fresh weight
GA
gibberellins acid
GGPP
geranylgeranyl diphosphate
GGPPS
Geranylgeranyl diphosphate synthase
HMGR
3-hydroxy-3-methylglutaryl CoA reductase
HPLC
high performance liquid chromatography
HPPR
4-hydroxyphenylpyruvate reductase
IPP
isopentenl diphosphate
KSL
kaurene synthase-like
LAB
salvianolic acid B
MeJA
methyl jasmonate
MEP
methylerythritol phosphate
MVA
mevalonate
PAL
Phenylalanine ammonia-lyase
PDA
photodiode array detector
PEG
polyethylene glycol
RA
rosmarinic acid
RAS
rosmarinic acid synthase
RNAi
RNA interference
RT-qPCR
quantitative real-time PCR
SA
salicylic acid
Salvia miltiorrhiza
Salvia miltiorrhiza
TAT
tyrosine aminotransferase
T I
tanshinone I
T II A
tanshinone II A
YE
yeast extract
4CL
hydroxycinnamate coenzyme A ligase

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Cheng, H.T.; Li, X.L.; Li, X.; Li, Y.; Wang, L.; Xue, M. Simultaneous quantification of selected compounds from Salvia herbs by HPLC method and their application. Food Chem. 2012, 130, 1031–1035. [Google Scholar]
  2. Liu, A.H.; Li, L.; Xu, M.; Lin, Y.H.; Guo, H.Z.; Guo, D.A. Simultaneous quantification of six major phenolic acids in the roots of Salvia miltiorrhiza and four related traditional Chinese medicinal preparations by HPLC-DAD method. J. Pharm. Biomed. Anal. 2006, 41, 48–56. [Google Scholar]
  3. Shi, Z.H.; He, J.T.; Yao, T.T.; Chang, W.B.; Zhao, M.P. Simultaneous determination of cryptotanshinone, tanshinone I and tanshinone II A in traditional chinese medicinal preparations containing Radix Salvia miltiorrhiza by HPLC. J. Pharm. Biomed. Anal. 2005, 37, 481–486. [Google Scholar]
  4. Zhou, Y.Q.; Li, W.Z.; Xu, L.; Chen, L.Y. In Salvia miltiorrhiza, phenolic acids possess protective properties against amyloid β-induced cytotoxicity, and tanshinones act as acetylcholinesterase inhibitors. Environ. Toxicol. Pharmacol. 2011, 31, 443–452. [Google Scholar]
  5. Chen, X.P.; Guo, J.J.; Bao, J.L.; Lu, J.J.; Wang, Y.T. The anticancer properties of Salvia miltiorrhiza Bunge (danshen): A systematic review. Med. Res. Rev. 2014, 34, 768–794. [Google Scholar]
  6. Wang, X.; Lee, W.Y.W.; Zhou, X.L.; Or, P.M.Y.; Yeung, J.H.K. A pharmacodynamics-pharmacokinetic (PD-PK) study on the effects of Danshen (Salvia miltiorrhiza) on midazolam, a model CYP3A probe substrate, in the rat. Phytomedicine 2010, 17, 876–883. [Google Scholar]
  7. Kai, G.Y.; Hao, X.L.; Cui, L.J.; Ni, X.L.; Zekria, D.; Wu, J.Y. Metabolic engineering and biotechnological approaches for production of bioactive diterpene tanshinones in Salvia miltiorrhiza. Biotechnol. Adv. 2014. [Google Scholar] [CrossRef]
  8. Zhang, S.C.; Yan, Y.; Wang, B.Q.; Liang, Z.S.; Liu, Y.; Liu, F.H.; Qi, Z.H. Selective responses of enzymes in the two parallel pathways of rosmarinic acid biosynthetic pathway to elicitors in Salvia miltiorrhiza hairy root cultures. J. Biosci. Bioeng. 2014, 117, 645–651. [Google Scholar]
  9. Di, P.; Zhang, L.; Chen, J.F.; Tan, H.X.; Xiao, Y.; Dong, X.; Zhou, X.; Chen, W.S. 13C tracer reveals phenolic acids biosynthesis in hairy root cultures of Salvia miltiorrhiza. ACS Chem. Biol. 2013, 8, 1537–1548. [Google Scholar]
  10. Yang, D.F.; Sheng, D.F.; Duan, Q.M.; Liang, X.; Liang, Z.S.; Liu, Y. PEG and ABA trigger the burst of reactive oxygen species to increase tanshinone production in Salvia miltiorrhiza hairy roots. J. Plant Growth Regul. 2012, 31, 579–587. [Google Scholar]
  11. Xiao, Y.; Gao, S.H.; Di, P.; Chen, J.F.; Chen, W.S.; Zhang, L. Methyl jasmonate dramatically enhances the accumulation of phenolic acids in Salvia miltiorrhiza hairy root cultures. Physiol. Plant 2009, 137, 1–9. [Google Scholar]
  12. Yan, Q.; Shi, M.; Ng, J.; Wu, J.Y. Elicitor-induced rosmarinic acid accumulation and secondary metabolism enzyme activities in Salvia miltiorrhiza hairy roots. Plant Sci. 2006, 170, 853–858. [Google Scholar]
  13. Liang, Z.S.; Ma, Y.N.; Xu, T.; Cui, B.M.; Liu, Y.; Guo, Z.X.; Yang, D.F. Effects of Abscisic Acid, Gibberellin, Ethylene and Their Interactions on Production of Phenolic Acids in Salvia miltiorrhiza Bunge Hairy Roots. PLoS One 2013, 8, e72806. [Google Scholar]
  14. Jiao, M.L; Cao, R.R.; Chen, H.Y.; Hao, W.F.; Dong, J.E. Effects of salicylic acid on synthesis of rosmarinic acid and related enzymes in the suspension cultures of Salvia miltiorrhiza. Sheng Wu Gong Cheng Xue Bao 2012, 28, 320–328. [Google Scholar]
  15. Kai, G.Y.; Zhang, A.; Guo, Y.Y.; Li, L.; Cui, L.J.; Luo, X.Q.; Liu, C.; Xiao, J.B. Enhancing the production of tropane alkaloids in transgenic Anisodus acutangulus hairy root cultures by over-expressing tropinone reductase I and hyoscyamine-6β-hydroxylase. Mol. Biosyst. 2012, 8, 2883–2890. [Google Scholar]
  16. Song, J.; Wang, Z.Z. RNAi-mediated suppression of the phenylalanine ammonia-lyase gene in Salvia miltiorrhiza causes abnormal phenotypes and a reduction in rosmarinic acid biosynthesis. J. Plant Res. 2011, 124, 183–192. [Google Scholar]
  17. Kai, G.Y.; Xu, H.; Zhou, C.C.; Liao, P.; Xiao, J.B.; Luo, X.Q.; You, L.J.; Zhang, L. Metabolic engineering tanshinone biosynthetic pathway in Salvia miltiorrhiza hairy root cultures. Metab. Eng. 2011, 13, 319–327. [Google Scholar]
  18. Yang, D.F.; Du, X.H.; Liang, X.; Han, R.L.; Liang, Z.S.; Liu, Y.; Liu, F.H.; Zhao, J. Different roles of the mevalonate and methylerythritol phosphate pathways in cell growth and tanshinone production of Salvia miltiorrhiza hairy roots. PLoS One 2012, 7, e46797. [Google Scholar]
  19. Kai, G.Y.; Liao, P.; Zhang, T.; Zhou, W.; Wang, J.; Xu, H.; Liu, Y.Y.; Zhang, L. Characterization, expression profiling, and functional identification of a gene encoding geranylgeranyl diphosphate synthase from Salvia miltiorrhiza. Biotechnol. Bioprocess Eng. 2010, 15, 236–245. [Google Scholar]
  20. Cheng, Q.Q.; Su, P.; Hu, Y.T.; He, Y.F.; Gao, W.; Huang, L.Q. RNA interference-mediated repression of SmCPS (copalyldiphosphate synthase) expression in hairy roots of Salvia miltiorrhiza causes a decrease of tanshinones and sheds light on the functional role of SmCPS. Biotechnol. Lett. 2014, 36, 363–369. [Google Scholar]
  21. Zhou, J.; Fang, L.; Wang, X.; Guo, L.P.; Huang, L.Q. La dramaticaly enhances the accumulation of tanshinones in Salvia miltiorrhiza hairy root cultures. Earth Sci. Res. 2012, 2. [Google Scholar] [CrossRef]
  22. Kai, G.Y.; Liao, P.; Xu, H.; Wang, J.; Zhou, C.C.; Zhou, W.; Qi, Y.P.; Xiao, J.B.; Wang, Y.L.; Zhang, L. Molecular mechanism of elicitor-induced tanshinone accumulation in Salvia miltiorrhiza hairy root cultures. Acta Physiol. Plant. 2012, 34, 1421–1433. [Google Scholar]
  23. Hao, X.L.; Shi, M.; Cui, L.J.; Xu, C.; Zhang, Y.J.; Kai, G.Y. Effects of methyl jasmonate and salicylic acid on tanshinone production and biosynthetic gene expression in transgenic Salvia miltiorrhiza hairy roots. Biotechnol. Appl. Biochem. 2014. [Google Scholar] [CrossRef]
  24. Shi, M.; Luo, X.Q.; Ju, G.H.; Yu, X.H.; Hao, X.L.; Huang, Q.; Xiao, J.B.; Cui, L.J.; Kai, G.Y. Increased accumulation of the cardio-cerebrovascular disease treatment drug tanshinone in Salvia miltiorrhiza hairy roots by the enzymes 3-hydroxy-3-methylglutaryl CoA reductase and 1-deoxy-d-xylulose 5-phosphate reductoisomerase. Funct. Integr. Genomics 2014, 14, 603–615. [Google Scholar]
  25. Peng, X.; He, J.Y. The inhibitory effect of Ca2+ on the flavonoid production of Tetrastigma hemsleyanum suspension cells induced by metal elicitors. In Vitro Cell. Dev. Biol. Plant 2013, 49, 550–559. [Google Scholar]
  26. Cai, Z.Z.; Kastell, A.; Speiser, C.; Smetanska, I. Enhanced resveratrol production in Vitis vinifera cell suspension cultures by heavy metals without loss of cell viability. Appl. Biochem. Biotechnol. 2013, 171, 330–340. [Google Scholar]
  27. Zhang, C.H.; Wu, J.Y. Ethylene inhibitors enhance elicitor-induced paclitaxel production in suspension cultures of Taxus spp. Cells. Enzym. Microb. Technol. 2003, 32, 71–77. [Google Scholar]
  28. Chen, W.H.; Xu, C.M.; Zeng, J.L.; Zhao, B.; Wang, X.-D.; Wang, Y.C. Improvement of echinacoside and acteoside production by two-stage elicitation in cell suspension culture of Cistanche deserticola. World J. Microbiol. Biotechnol. 2007, 23, 1451–1458. [Google Scholar]
  29. Xiao, Y.; Gao, S.H.; Di, P.; Chen, J.F.; Chen, W.S.; Zhang, L. Lithospermic acid b is more responsive to silver ions (Ag+) than rosmarinic acid in Salvia miltiorrhiza hairy root cultures. Biosci. Rep. 2010, 30, 33–40. [Google Scholar]
  30. Ge, X.C.; Wu, J.Y. Tanshinone production and isoprenoid pathways in salvia miltiorrhiza hairy roots induced by Ag+ and yeast elicitor. Plant Sci. 2005, 168, 487–491. [Google Scholar]
  31. Ma, P.D.; Liu, J.L.; Zhang, C.L.; Liang, Z.S. Regulation of water-soluble phenolic acid biosynthesis in Salvia miltiorrhiza Bunge. Appl. Biochem. Biotechnol. 2013, 170, 1253–1262. [Google Scholar]
  32. Pitta-Alvarez, S.I.P.; Spollansky, T.C.; Giulietti, A.M. The influence of different biotic and abiotic elicitors on the production and profile of tropane alkaloids in hairy root cultures of Brugmansia candida. Enzym. Microb. Technol. 2000, 26, 252–258. [Google Scholar]
  33. Zhao, J.L.; Zhou, L.G.; Wu, J.Y. Effects of biotic and abiotic elicitors on cell growth and tanshinone accumulation in Salvia miltiorrhiza cell cultures. Appl. Microbiol. Biotechnol. 2010, 87, 137–144. [Google Scholar]
  34. Guo, Y.X.; Zhang, D.J.; Wang, H.; Xiu, Z.L.; Wang, L.X.; Xiao, H.B. Hydrolytic kinetics of lithospermic acid b extracted from roots of Salvia miltiorrhiza. J. Pharm. Biomed. Anal. 2007, 43, 435–439. [Google Scholar]
  35. Song, J.; Ji, Y.Y.; Xu, K.; Wang, Z.Z. An integrated analysis of the rosmarinic acid-biosynthetic genes to uncover the regulation of rosmarinic acid pathway in Salvia miltiorrhiza. Acta Physiol. Plant. 2012, 34, 1501–1511. [Google Scholar]
  36. Xiao, Y.; Zhang, L.; Gao, S.H.; Saechao, S.; Di, P.; Chen, J.F.; Chen, W.S. The c4h, tat, hppr and hppd genes prompted engineering of rosmarinic acid biosynthetic pathway in Salvia miltiorrhiza hairy root cultures. PLoS One 2011, 6, e29713. [Google Scholar]
  37. Ming, Q.L.; Su, C.Y.; Zheng, C.J.; Jia, M.; Zhang, Q.Y.; Zhang, H.; Rahman, K.; Han, T.; Qin, L. Elicitors from the endophytic fungus trichoderma atroviride promote Salvia miltiorrhiza hairy root growth and tanshinone biosynthesis. J. Exp. Bot. 2013, 64, 5687–5694. [Google Scholar]
  38. Zhang, C.H.; Yan, Q.; Cheuk, W.K.; Wu, J.Y. Enhancement of tanshinone production in Salvia miltiorrhiza hairy root culture by Ag+ elicitation and nutrient feeding. Plant. Med. 2004, 70, 147–151. [Google Scholar]
  39. Zhang, X.N.; Guo, J.; Shen, Y.; Huang, L.Q. Cloning and expression analysis of a new 3-hydroxy-3-methylglutaryl coenzyme A reductase gene from Salvia miltiorrhiza (SmHMGR3). Zhongguo Zhong Yao Za Zhi 2012, 37, 2378–2382. [Google Scholar]
  • Sample Availability: Samples of the compounds are available from the authors.

Share and Cite

MDPI and ACS Style

Xing, B.; Yang, D.; Guo, W.; Liang, Z.; Yan, X.; Zhu, Y.; Liu, Y. Ag+ as a More Effective Elicitor for Production of Tanshinones than Phenolic Acids in Salvia miltiorrhiza Hairy Roots. Molecules 2015, 20, 309-324. https://doi.org/10.3390/molecules20010309

AMA Style

Xing B, Yang D, Guo W, Liang Z, Yan X, Zhu Y, Liu Y. Ag+ as a More Effective Elicitor for Production of Tanshinones than Phenolic Acids in Salvia miltiorrhiza Hairy Roots. Molecules. 2015; 20(1):309-324. https://doi.org/10.3390/molecules20010309

Chicago/Turabian Style

Xing, Bingcong, Dongfeng Yang, Wanli Guo, Zongsuo Liang, Xijun Yan, Yonghong Zhu, and Yan Liu. 2015. "Ag+ as a More Effective Elicitor for Production of Tanshinones than Phenolic Acids in Salvia miltiorrhiza Hairy Roots" Molecules 20, no. 1: 309-324. https://doi.org/10.3390/molecules20010309

APA Style

Xing, B., Yang, D., Guo, W., Liang, Z., Yan, X., Zhu, Y., & Liu, Y. (2015). Ag+ as a More Effective Elicitor for Production of Tanshinones than Phenolic Acids in Salvia miltiorrhiza Hairy Roots. Molecules, 20(1), 309-324. https://doi.org/10.3390/molecules20010309

Article Metrics

Back to TopTop