Next Article in Journal
Comparative Analysis of Sectional Anatomy, Computed Tomography and Magnetic Resonance of the Cadaveric Six-Banded Armadillo (Euphractus sexcintus) Head
Previous Article in Journal
Comparative Evaluation of Takhrai (Cymbopogon citratus) Leaf Extracts with Commercial Antioxidants for Oxidative Stress Mitigation in Ruminants Under Heat Stress
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Veterinary Sciences
Volume 12
Issue 5
10.3390/vetsci12050434
vetsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of 1,25-Dihydroxycholecalciferol Glycoside Supplementation on the Growth, Intestinal Health, and Immunity of Broilers from Breeders Supplemented or Not with the Same Additive

by
Thiago S. Andrade
1,*,
Nilton Rohloff Junior
1,
Paulo L. O. Carvalho
1,
Bruno S. Vieira
2,
José G. Vargas Junior
3,
Arele A. Calderano
4,
Paulo C. Pozza
5,
Leandro D. Castilha
5,
Elcio S. Klosowski
1,
Cinthia Eyng
1 and
Ricardo V. Nunes
1
1
Department of Animal Science, Western Parana State University (Unioeste), Marechal Candido Rondon 85960-000, PR, Brazil
2
Department of Animal Science, Federal University of Uberlandia, Uberlandia 38408-100, MG, Brazil
3
Department of Animal Science, Federal University of Espírito Santo, Alegre 29500-00, ES, Brazil
4
Department of Animal Science, Universidade Federal de Viçosa, Viçosa 36570-900, MG, Brazil
5
Department of Animal Science, State University of Maringá, Maringá 87020-900, PR, Brazil
*
Author to whom correspondence should be addressed.
Vet. Sci. 2025, 12(5), 434; https://doi.org/10.3390/vetsci12050434
Submission received: 7 March 2025 / Revised: 4 April 2025 / Accepted: 8 April 2025 / Published: 1 May 2025
Review Reports Versions Notes

Simple Summary

The objective of this study was to evaluate the effects of 1,25-Dihydroxycholecalciferol glycoside supplementation on the growth, intestinal health, and immunity of broilers. The results showed that supplementation of breeders led to heavier chicks at hatch, better feed conversion, and improved nutrient absorption in the intestines. There was also an improvement in immune indicators, suggesting that this supplementation may contribute to healthier and more efficient growth of broilers.

Abstract

This study aimed to investigate the effects of 1,25-Dihydroxycholecalciferol glycoside (1,25(OH)2D3-G) supplementation on the performance, biochemical blood, bone health, intestinal histomorphometry, and gene expressions in broilers from breeders supplemented or not with 1,25(OH)2D3-G. A total of 1152 one-day-old, male Ross 308 AP chicks were distributed in a completely randomized design with a 2 × 3 factorial arrangement. One factor was the inclusion or not of 1,25(OH)2D3-G in the breeders’ diets from 21 to 62 weeks of age. The other factor involved three levels (0, 50, and 100 mg/kg) of 1,25(OH)2D3-G inclusion in the broilers’ diets from 1 to 21 days of age. The study totaled six treatments, with eight replicates and 24 birds per experimental unit. Breeders supplemented with of 1,25(OH)2D3-G resulted in heavier broiler chicks at hatch, better feed conversion, and higher concentrations of calbindin D28K, interleukin 10, and interleukin 1β at 21 days of age. Villus height and absorption area in the jejunum showed interactions between breeder supplementation and broiler diets. The inclusion of this additive in both diets was not sufficient to increase villus height and absorption area in broilers at 21 days of age. It is concluded that supplementation in breeders improves growth and immunity in broilers.

1. Introduction

In modern broilers, rapid muscle growth combined with still-developing skeletal support can lead to a higher incidence of metabolic challenges, bone issues, and locomotor difficulties throughout their growth [1,2,3]. At the same time, the pursuit of significant weight gain in birds can result in biomechanical imbalances in skeletal development, leading to problems such as restricted mobility, lameness, and other bone deformities [4,5]. Notably, tibial dyschondroplasia is observed during the early growth phase, while structural issues and distortions in long bones may occur in the later stages [6,7,8]. These complexities in the development of modern broiler chickens require special attention to minimizing potential negative impacts on their health and well-being during the production cycle [9,10].
In this context, vitamin supplementation plays a crucial role in reducing mobility issues and bone deformities [11,12], particularly vitamin D3, which acts as an essential metabolic cofactor, significantly influencing bone metabolism and the regulation of calcium and phosphorus in birds [4,13,14]. Studies suggest that vitamin D3 supplementation in diets can reduce locomotion problems, minimize skeletal disorders, and contribute to improved growth and immunity in poultry [15,16,17].
Among vitamin D3 metabolites, 1,25-Dihydroxycholecalciferol, the active form of vitamin D3, plays a critical role in calcium and phosphorus absorption in the intestinal tract of birds [1,4,9,15,18,19,20], promoting efficient mineral uptake in the body [17,21,22]. This function is essential for proper skeletal development, ensuring bone formation and health in birds [23,24,25].
1,25-Dihydroxycholecalciferol can also be found in glycosylated form in certain plants, such as Solanum glaucophyllum [1,9,10,15,26]. In this glycosylated form (1,25(OH)2D3-G), the vitamin D3 compound is bound to glucose molecules [27], giving it a prolonged and targeted action in the birds’ intestines [7,10,27,28,29]. When consumed, birds can metabolize this glycosylated form of 1,25-Dihydroxycholecalciferol, allowing for the gradual release of the active substance, extending its activity time in the birds’ bodies and improving its efficacy in regulating calcium and phosphorus metabolism [15,30]. This herbal form offers a natural alternative for vitamin D3 supplementation, with specific properties that can benefit the digestive system and absorption of these essential minerals for growth [15,31,32].
Recent research highlights that 1,25(OH)2D3-G supplementation not only significantly improves bone mineralization in birds, promoting a stronger and more resilient skeletal structure [9,32,33,34,35], but also plays a key role in enhancing the efficient transport of essential minerals such as calcium and phosphorus. Additional studies emphasize the positive influence of 1,25(OH)2D3-G in facilitating the absorption of these minerals in the birds’ intestines, contributing to bone health and proper skeletal development [13,36,37,38]. These findings highlight the benefits of this form of supplementation, extending beyond bone mineralization to optimize mineral metabolism in birds. Moreover, 1,25(OH)2D3-G plays a vital role in strengthening the immune response, improving defense against pathogens [8,39,40].
This substance triggers a series of biochemical events that positively influence the body’s natural defenses [18,24]. Recent studies by researchers such as [10] highlight that adequate supplementation of 1,25(OH)2D3-G is associated with significant improvements in birds’ defense capabilities against pathogens. By enhancing the immune response, 1,25(OH)2D3-G can increase the effectiveness of natural barriers, such as mucosal integrity and the production of antimicrobial substances [5]. Furthermore, this active substance can modulate the gene expression of cytokines and other immune mediators, contributing to a more balanced and responsive immune environment [19,20,36].
In this context, the importance of 1,25(OH)2D3-G in the immune response of birds extends beyond its traditional role in calcium homeostasis and bone phosphorylation [9]. Its positive influence on pathogen defense stands out as a crucial factor in maintaining overall poultry health, providing significant benefits for poultry production [18,39,41,42,43]. However, determining the optimal dosage for incorporation into bird diets remains a point of contention [5,19,20,44]. The lack of precise definition in this area presents a substantial challenge, as inadequate doses may result in toxicity issues [4,6,39,45,46]. This uncertainty underscores the importance of conducting studies to mitigate any toxicity risks and optimize the potential benefits offered by this form of vitamin D3 [15,20,21,32,47,48,49,50,51].
Therefore, this study hypothesizes that breeder supplementation with 1,25(OH)2D3-G enhances bone mineralization in newly hatched broilers, promoting balanced growth and a strengthened immune system. To test this hypothesis, the study evaluated the effects of 1,25(OH)2D3-G supplementation on the performance, biochemical blood, bone health, intestinal histomorphometry, and gene expression in broilers from breeders supplemented or not with this additive.

2. Materials and Methods

2.1. Animal Ethics Statement

The procedures were approved by the Ethics Committee for the Use of Animals of the National Council for the Control of Animal Experimentation—UNIOESTE (Protocol No. 01/2021) and were previously approved by the National Council for the Control of Animal Experimentation in accordance with Normative No. 37 of 15 February 2018.

2.2. Animals and Experimental Design

Two broiler breeder houses (G1 and G2) were established in the municipality of Pato Branco, Paraná, Brazil, with the aim of housing 8000 (Ross 308 AP—AP95, Avícola Pato Branco, PR, Brazil) broiler breeders at 21 weeks of age. Each house measured 175 m × 13 m, was constructed with a metallic structure, was covered with Brasilit roofing, and had a ceiling height of 3 m without insulation. The houses were equipped with bird-proof mesh and white curtains, along with fans to maintain positive pressure ventilation. The nests were mechanical, while the feeding system consisted of automatic chain feeders specifically designed for breeders, and the drinkers were pendular models from the brand Plasson.
The diets provided to the birds in houses G1 and G2 were identical, formulated with corn and soybean meal to meet the nutritional requirements throughout the production period (21 to 62 weeks of age). However, the breeders in house G1 received a mash diet supplemented with 1,25(OH)2D3-G at a dosage of 100 mg/kg starting at 21 weeks of age, while the breeders in house G2 received a mash diet without 1,25(OH)2D3-G supplementation. This level was chosen based on its expected influence on calcium and phosphorus metabolism, aiming to enhance mineral transfer from breeders to embryos and improve skeletal health in the progeny (broilers).
At 62 weeks of age, the eggs from each barn were collected separately, identified, selected, and sanitized. The eggs were then transported to the hatchery and incubated in incubators (Jamesway Platinum Series, Jamesway Incubator Company Inc., Cambridge, ON, Canada), where they remained for a period of 18 days, maintained at a temperature of 37.5 °C and a relative humidity of 60%. After the 18-day incubation period, the eggs were transferred to the hatchers, where they remained at a temperature of 37.2 °C and a relative humidity of 65% until hatching occurred.
After hatching, the broiler chicks were sexed and vaccinated on their first day of life to prevent common poultry diseases, including Marek’s disease, Avian Pox, Gumboro disease, and Infectious Bronchitis. The vaccines administered included Vaxxitek HVT+IBD (Boehringer), which was applied subcutaneously for protection against Marek’s disease (HVT) and Gumboro. The Prevvaxion RN (Boehringer) vaccine, also administered subcutaneously, provided protection against Marek’s disease (Rispens). For fowl pox protection, the Bouba das Aves Suave (Biovet) vaccine was applied subcutaneously. Additionally, the Bronquite H120 (MSD Animal Health, Kenilworth, NJ, USA) vaccine, aimed at protecting against Infectious Bronchitis (Massachusetts strain), was administered via spray. All vaccines were applied according to the manufacturers’ recommended procedures, ensuring effective early immunization and protection of the broiler chicks against these diseases.
After vaccination, the broiler chicks were properly identified based on the breeder’s origin, considering whether or not they were supplemented with 1,25(OH)2D3-G. They were then sent to the Poultry Research Center at the State University of Western Paraná, in Marechal Cândido Rondon, Paraná, Brazil.
A total of 1152 one-day-old male, Ross 308 AP95 broiler chicks were distributed in a completely randomized design, arranged in a 2 × 3 factorial scheme. One of the factors was the origin of the broiler chicks from breeders fed with or without 1,25(OH)2D3-G (0 and 100 mg/kg), and the broiler chicks were fed with three inclusion levels (0, 50, and 100 mg/kg) of 1,25(OH)2D3-G) up to 21 days of age. This resulted in 6 treatments, with 8 replicates and 24 birds per experimental unit.

2.3. Diets and Feeding Management

The experimental diets (Table 1) were isonutritive and isocaloric, based on corn and soybean meal, following the nutritional recommendations of [52]. The vitamin used in this study (1,25-Dihydroxycholecalciferol glycoside) is from the product Panbonis® 10, which is produced from Solanum glaucophyllum in powder form and standardized with pre-gelatinized wheat starch and wheat middlings. Its analytical composition includes 1,25-Dihydroxycholecalciferol glycosides (minimum of 10 ppm), moisture (maximum of 14%), crude protein (14–18%), crude fiber (5.25–8.75%), crude fat (3–6%), crude ash (3–6%), sodium (0.0–0.7%), lysine (0.6–0.9%), and methionine (0.2–0.4%). The product is manufactured by Herbonis Animal Health GmbH, located in Switzerland, and is marketed in Brazil through local distributors.
The feed provided to the birds throughout the experimental period was in meal form. The micronutrients, along with 1,25(OH)2D3-G, were weighed and manually mixed in 5 kg bags. The mixture was then transferred to the Premiata PRM vertical mixer, with a capacity of 500 kg, where the blending process with the other feed ingredients was carried out for 10 min to ensure homogeneous distribution. After mixing, the feed was bagged in 30 kg bags. The use of 1,25(OH)2D3-G replaced the inert material in the feed (g g−1). The 1,25(OH)2D3-G was provided only up to 21 days of age (Table 2). After this period, the broilers received the same grower and finisher diets without 1,25(OH)2D3-G. During the experimental period (1 to 21 days), the birds had ad libitum access to water and feed.

2.4. Performance

The birds and feed were weighed at the beginning of the experimental period and at 21 days of age to determine average feed intake, weight gain, and feed conversion ratio. Mortality was recorded daily to adjust feed intake and feed conversion ratio [53].

2.5. Intestinal Histomorphometry

At 21 days of age, one bird per experimental unit was euthanized by cervical dislocation for the removal of the digestive tract and subsequent evaluation of intestinal histomorphometry (villus height, crypt depth, villus-height-to-crypt depth ratio, and absorption area). The small intestine was exposed, and the jejunum was isolated for sampling. The segment used was the distal portion from the duodenal loop to Meckel’s diverticulum. A 2 cm fragment of the jejunum was collected 5 cm before Meckel’s diverticulum. This fragment was fixed in 10% buffered formalin, dehydrated in a series of increasing ethanol concentrations, and then embedded in paraffin. Semi-serial sections of 5 µm from each segment were placed on glass slides and stained using the hematoxylin-eosin technique [54].
The measurements were performed using the PROPLUS IMAGE 4.1 imaging system. On each slide, the length and width of the villi, as well as the depth and width of the crypts, were recorded. These morphometric measurements were used to calculate the absorption surface area of the intestinal mucosa [55]. The villus-height-to-crypt depth ratio was calculated using the results of villus height and crypt depth measurements.

2.6. Biochemical Variables

At 21 days of age, 4 mL of blood were collected from two birds per experimental unit for the analysis of calcium, phosphorus, lactate dehydrogenase (LDH), creatine phosphokinase (CPK), and alkaline phosphatase. Blood collection was performed by puncture of the ulnar vein while the birds were positioned in lateral recumbency. Specific vacuum tubes with a clot activator and a 5 mL capacity (CRAL, Cotia, SP, Brazil) were used, along with adapters and 25 × 0.8 mm needles (Labor Import, Weihai, Shandong, China).
After collection, the samples were kept in a horizontal position for 15 min and then centrifuged (K14-4000, Kasvi, São José dos Pinhais, PR, Brazil) at 2500 rpm (1050 g) for 10 min at room temperature. After serum separation, the samples were properly identified and transferred to 2 mL microtubes (CRAL, Cotia, SP, Brazil) and stored in a freezer at −20 °C until the time of analysis [56].
For the readings, the samples were thawed under refrigeration at 4 °C and kept in the refrigerator for a maximum of 8 h. Prior to analysis, the samples were centrifuged in a microcentrifuge (Eppendorf®, Minispin® model, Hamburg, Germany) at 1050 g for 10 min at room temperature to remove any remaining fibrin traces. The biochemical variables were measured using an automatic biochemical analyzer with spectrophotometry, specifically the Flexor EL200 (Elitech® brand, Flexor EL200 model, Puteaux, France). The analysis was conducted using reagents, calibrators (Elical II), and control standards (Elitrol I) from the Elitech® brand.
The spectrophotometric methods demonstrated high sensitivity and precision for all analyzed analytes. The intra-assay coefficients of variation ranged from 1.1% to 3.6%, while the inter-assay values varied between 1.7% and 6.5%, ensuring reliability in the analyses. The correlation between methods was consistent, with r ≥ 0.998. Specifically, for calcium and phosphorus, intra-assay coefficients ranged from 1.1% to 2.8%, while inter-assay values were 1.7% to 3.7%. Lactate dehydrogenase (LDH) showed a sensitivity of 0.087 m∆A/min per U/L and high reproducibility, with intra-assay variations from 1.2% to 3.6% and inter-assay variations from 2.8% to 6.5%. Creatine phosphokinase (CK) and alkaline phosphatase (ALP) had intra-assay coefficients ranging from 1.1% to 3.5% and inter-assay values from 1.7% to 5.2%, reinforcing the accuracy of these methodologies.

2.7. Bone Quality and Tibia Proximal Composition

The tibias of euthanized birds (21 days old) were cleaned of flesh. The right tibia was weighed and measured with a digital caliper (Mitutoyo Absolute 0.01 mm–150 mm). Using the weight and length of the bone, the Seedor Index [57] was calculated. The tibias from the birds euthanized at 21 days of age were used to determine dry matter in an oven with air circulation (105 °C). After this process, they were calcined for 8 h in a muffle furnace at 600 °C to obtain mineral matter (ash). The calcium and phosphorus contents in the bone were determined using the methodology described by [58]. Calcium concentration was measured by flame atomic absorption spectroscopy (FAAS), and phosphorus (P) was measured using ultraviolet–visible (UV-VIS) spectroscopy.
The left tibia was used to determine bone strength using the Brookfield CT3 texture analyzer. This equipment features a base that supports the epiphyseal areas of the bone, applying a force of 5 mm/s with a load of 200 kgf to the central region of the bone (diaphysis). During the strength determination, the tibia was placed on support in the same position each time. The results were expressed in kilogram-force (kgf) [59].

2.8. Gene Expression

At 21 days of age, one bird per experimental unit received stimulation through intraperitoneal administration of 1 mg of LPS (lipopolysaccharides from E. coli, Sigma-Aldrich, St. Louis, MO, USA) per live weight. After a 4 h period, the birds were sacrificed by cervical dislocation, and a fragment of the jejunum was immediately collected and immersed in a RNAlater™ stabilization solution (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) and then stored in a freezer at −20 °C until RNA extraction. Total RNA was extracted using the QIAzol Lysis Reagent (Qiagen GmbH, Hilden, Germany). Approximately 70 mg of chicken intestine was weighed, crushed, and added to a microtube, free of DNase and RNase, containing 500 µL of Trizol. The samples were homogenized (vortex) and incubated at room temperature for 5 min. Next, 100 µL of chloroform was added, followed by manual homogenization for 15 s and incubation at room temperature for 3 min, followed by centrifugation for 15 min (12,000× g at 4 °C).
The aqueous phase was collected into a tube, and 250 µL of isopropanol was added, followed by a 10 min incubation (room temperature), manual homogenization, and centrifugation for 15 min at 12,000× g at 4 °C. The supernatant was discarded, and the precipitate was washed with 1 mL of 75% ethanol. The samples were centrifuged once again at 7500× g for 5 min, and the supernatant was discarded to dry the pellet for 15 min and then resuspended in DNase- and RNase-free ultrapure water and incubated at 60 °C for 15 min.
The RNA concentrations for the cytokines (IL-1β and IL-10), calbindin-D28K (CALB-D28K), and β-actin (endogenous control gene) were measured using a NanoDrop™ Lite spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) at a wavelength of 260/280 nm. The integrity of the RNA was evaluated on 1% agarose gel stained with SYBR Safe™ DNA Gel Stain (Invitrogen, Thermo Fisher Scientific, Carlsbad, CA, USA) and visualized under ultraviolet transilluminator.
For cDNA synthesis, the QuantiTect Reverse Transcription Kit (Qiagen GmbH, Hilden, Germany) was used according to the manufacturer’s instructions, with 1 µg of RNA and a final volume of 20 µL. To remove potential genomic DNA residues, each sample was treated with 2 µL of gDNA Wipeout Buffer (Qiagen GmbH, Hilden, Germany) and incubated at 45 °C for 2 min. After removing genomic DNA, 4 µL of Quantiscript RT Buffer, 1 µL of RT Primer Mix, and 1 µL of Quantiscript Reverse Transcriptase were added. The reverse transcription reaction was incubated for 15 min at 42 °C, followed by 95 °C for 3 min, and immediately placed on ice. The samples were measured using the NanoDrop™ Lite spectrophotometer (Thermo Fisher Scientific, Carlsbad, CA, USA) and stored at −20 °C until use.
The primers/oligonucleotides used in the reactions were obtained from published studies on Gallus gallus (Table 3). The primer sequences were aligned using the BLAST (Basic Local Alignment Search Tool) algorithm in the NCBI database (http://www.ncbi.nlm.nih.gov/BLAST, accessed on 17 April 2024). The β-actin gene was considered a reference/housekeeping gene, and its stability across treatments was evaluated using the Statistica® 7.0 program.
To evaluate the amplification efficiency of each primer, serial dilutions of the cDNA sample pool containing all treatments were performed using different concentrations of primers. For β-actin, CALB-D28K, and IL-10, 200 ng of cDNA and 400 nM of primer were used, and for IL-1β, 200 ng of cDNA and 600 nM of primer were used.
qRT-PCR analyses were conducted on a Rotor-Gene Q (Qiagen GmbH, Hilden, Germany) using the QuantiNova SYBR Green PCR Kit (Qiagen GmbH, Hilden, Germany) in duplicates. The total reaction volume was 20 µL. The amplification conditions were as follows: 95 °C for 2 min, followed by 40 cycles at 95 °C for 5 s, and 60 °C for 10 s. The melt curve of the reaction products was obtained to determine the specificity of the reactions.
Relative gene expression data were recorded as Ct (cycle threshold) values and normalized using the average Ct values obtained for the reference gene in each sample, for each treatment, and for each target gene, as recommended by [61]. The 2−ΔCt method [60] was used for the relative quantification of gene expression (expressed as arbitrary units, AU).

2.9. Statistical Analyses

The data were evaluated for residual normality using the Shapiro–Wilk test and variance homogeneity using Levene’s test, both conducted through the Univariate procedure. For data with a normal distribution, a two-way analysis of variance (ANOVA) was performed to assess the effects of 1,25(OH)2D3-G supplementation in breeders and broilers, as well as the potential interactions between these factors. When significant effects were detected, treatment means for breeders were compared using the F-test, while treatment means for broilers were compared using the Student–Newman–Keuls test. All analyses were conducted using SAS for academics software (version 9.4 OnDemand), with a significance level of 5% [62].

3. Results

3.1. Performance

The performance variables of broilers at 21 days of age showed no significant interaction (p > 0.05) between the effects of 1,25(OH)2D3-G in breeders and the supplementation of 1,25(OH)2D3-G in broiler diets. However, breeders supplemented with 1,25(OH)2D3-G produced heavier broiler chicks (p = 0.001) at housing (Table 4). A significant effect of 1,25(OH)2D3-G inclusion in broiler diets was observed, resulting in a significant reduction in the feed conversion ratio (p = 0.001) at 21 days of age compared to broilers not receiving the supplementation.

3.2. Intestinal Histomorphometry

Villus height (p < 0.004) and absorption area (p = 0.001) in the jejunum of 21-day-old broilers showed a significant interaction between the effects of 1,25(OH)2D3-G supplementation in breeders and broiler diets (Table 5). When analyzing the interaction between 1,25(OH)2D3-G supplementation in breeder and broiler diets (Table 6), the inclusion of this additive in both diets was not sufficient to increase villus height and absorption area in broilers at 21 days of age. Broilers from breeders not supplemented with 1,25(OH)2D3-G had a greater villus height and absorption area when also not supplemented with the same additive.

3.3. Biochemical Variables

Calcium and phosphorus concentrations, as well as enzymatic variables, in 21-day-old broilers showed no significant interaction (p > 0.05) between the effects of 1,25(OH)2D3-G in breeders and the supplementation of 1,25(OH)2D3-G in broiler diets. However, 1,25(OH)2D3-G supplementation in the breeder diet resulted in higher alkaline phosphatase activity (p = 0.004) in broilers at 21 days of age (Table 7).

3.4. Bone Quality and Tibia Proximal Composition

No significant differences (p > 0.05) were identified for the Seedor index and tibia breaking strength in broilers at 21 days of age (Table 8). Calcium concentrations in broilers at 21 days showed a significant interaction (p = 0.006) between the effects of 1,25(OH)2D3-G in breeders and the supplementation of 1,25(OH)2D3-G in broiler diets. The inclusion of 100 mg/kg of 1,25(OH)2D3-G in broiler diets at 21 days resulted in lower calcium (p < 0.005) and phosphorus (p = 0.044) concentrations in the tibia (Table 9). Analyzing the interaction of 1,25(OH)2D3-G supplementation between breeders and broilers, it was observed that the inclusion of 100 mg/kg of 1,25(OH)2D3-G in both breeder and broiler diets resulted in lower calcium concentrations (p = 0.003) in the tibias of broilers at 21 days of age (Table 10).

3.5. Gene Expression

Gene expression of calbindin D28K and interleukins-10 and -1β in the jejunum of broilers at 21 days showed no significant interaction (p > 0.05) between the effects of 1,25(OH)2D3-G in breeders and 1,25(OH)2D3-G supplementation in broiler diets. However, higher expressions of calbindin D28K (p < 0.001), interleukin-10 (p = 0.001), and interleukin-1β (p = 0.001) were observed in the jejunum of broilers from breeders supplemented with 1,25(OH)2D3-G. Additionally, the inclusion of 1,25(OH)2D3-G in broiler diets (p = 0.047) indicated increased expression of calbindin D28K in the jejunum of birds receiving 50 and 100 mg/kg of 1,25(OH)2D3-G in their diets (Table 11).

4. Discussion

The results of this study indicate that the supplementation of breeders with 1,25(OH)2D3-G contributed to bone development and increased chick weight at hatch, highlighting the crucial role of this metabolite in nutrient transfer to the embryo [63]. By consuming a diet enriched with 1,25(OH)2D3-G, the breeder more efficiently absorbed calcium and phosphorus in the intestine, increasing their concentration in the bloodstream [64,65]. Since breeders primarily rely on dietary calcium for eggshell formation, without intense mobilization of medullary bone, 1,25(OH)2D3-G supplementation was essential to ensuring an adequate supply of minerals for both the eggshell and the embryo [66,67].
With a greater supply of calcium and phosphorus in the egg, the shell maintained its strength, protecting the embryo, while the yolk, enriched with these nutrients and 1,25(OH)2D3-G, provided support for chick bone development [64,65,68]. During incubation, the embryo first absorbed minerals from the yolk and later mobilized calcium from the eggshell for bone mineralization [68,69]. The 1,25(OH)2D3-G present in the egg stimulated the expression of calcium transporters in the intestinal epithelium of the embryo, enhancing calcium absorption [64,65,69]. Additionally, it promoted osteoblast activation, facilitating bone matrix deposition and resulting in stronger bones at hatch [70,71].
Although there are no studies directly exploring the use of 1,25-Dihydroxycholecalciferol (1,25(OH)2D3 in the diet of broiler breeders, related research suggests that the supplementation of vitamin D3 metabolites can improve egg quality and chick development [63,64,65]. The inclusion of 25-hydroxycholecalciferol (25(OH)D3), a direct precursor of 1,25(OH)2D3, in breeder diets enhances calcium and phosphorus absorption, resulting in eggs with stronger shells and higher mineral content [68,69]. Consequently, embryos benefit from an improved supply of these nutrients, which may lead to chicks with better bone health [70,71]. Additionally, supplementation with 25(OH)D3 has been shown to reduce the incidence of skeletal abnormalities in chicks, indicating a positive impact on early bone development [63,64]. These findings suggest that adding active vitamin D3 metabolites to breeder diets is an effective strategy to enhance egg quality and support the healthy growth of chicks [63,71].
The improved feed conversion in broiler chickens at 21 days of age with supplementation of 50 and 100 mg/kg of 1,25(OH)2D3-G suggests that feed conversion may be related to mechanisms distinct from intestinal morphology, such as the regulation of calcium and phosphorus metabolism, greater enzymatic efficiency, or other physiological processes [32]. This contradiction reinforces the complexity of the interaction between nutritional supplementation and physiological parameters, highlighting the need for further investigation into the underlying mechanisms [1,27]. Similarly, [3] observed improved feed conversion when broilers were supplemented with 1 and 2 µg of 1,25(OH)2D3-G from 1 to 21 days of age. These findings suggest that the addition of 1,25(OH)2D3-G can lead to significant improvements in performance during the growth phase, aligning with the results of the present study.
Although the supplementation of 1,25(OH)2D3-G did not increase intestinal villus height or absorption area, the observed improvements in feed conversion suggest that the additive may have enhanced the efficiency of metabolic processes involved in nutrient absorption and utilization [4,5,9,15]. Thus, despite the absence of structural changes in the intestine, supplementation appears to have optimized nutrient utilization, which is reflected in the improved feed conversion of broilers [5,20]
Moreover, supplementation may have influenced other physiological aspects, such as immunomodulation and maintenance of intestinal mucosal integrity, indirectly contributing to the efficiency of digestion and nutrient absorption [10]. These factors, combined, might have allowed the broilers to better utilize the nutrients available in the diet, resulting in improved feed conversion, even without a direct increase in villus height or absorption area [32]. Therefore, the improvement in feed conversion may be more closely associated with overall metabolic efficiency and optimization of the absorption of essential nutrients like calcium and phosphorus, rather than visible structural changes in the intestine [4,15,19,20]
The reduction in alkaline phosphatase activity in 21-day-old broiler chickens from breeders supplemented with 1,25(OH)2D3-G remained within the range considered normal for this age, suggesting a physiological adjustment associated with this supplementation protocol. Alkaline phosphatase is an essential enzyme for bone metabolism, and its activity generally reflects the rate of bone remodeling and mineralization [30,72]. Lower activity of this enzyme may indicate a reduced demand for phosphate mobilization to the bone, which could be related to a dynamic balance between mineral absorption and utilization [73]. Additionally, the regulation of alkaline phosphatase may be influenced by hormonal mechanisms mediated by 1,25(OH)2D3, which modulates the expression of genes involved in bone homeostasis [27]. These findings suggest that supplementation may have adjusted enzymatic activity according to the metabolic needs of the birds during this early growth phase [1,30].
The absence of changes in tibia bone strength in broilers at 21 days of age suggests that, despite the observed changes in alkaline phosphatase activity and calcium and phosphorus deposition in response to 1,25(OH)2D3-G supplementation, these changes were not reflected in detectable differences in bone strength [15,26,74]. The lack of distinction in bone strength between the groups may be attributed to various factors, including the complexity of bone and mineral metabolism, the influence of other dietary components, and genetic factors [30,72,75]. Moreover, it is important to consider that bone strength is influenced by various factors, such as bone quality and density, trabecular and cortical structure, as well as mineral composition [15,32,76]. Subtle changes in some of these aspects may not be detected through direct measurements of mineral deposition or enzymatic activity [75].
The reduction in calcium and phosphorus retention in the tibia with the higher dose of 1,25(OH)2D3-G suggests a possible activation of regulatory mechanisms that favored bone resorption over deposition [27]. At higher concentrations, 1,25(OH)2D3 may have stimulated RANKL expression, increasing osteoclastic activity and promoting the mobilization of these minerals to maintain systemic balance [21,30]. This process may have reduced mineral retention in the tibia without improving bone strength, indicating that supplementation influences bone metabolism dynamics in a complex manner, depending on the dose used [27,30,34].
Supplementation of 1,25(OH)2D3-G in the breeder diet had significant impacts on gene expression in broilers, suggesting a direct influence on physiological processes related to immune response and mineral metabolism [5,10,17,46]. The increase in calbindin D28K expression in broilers at 21 days of age, especially when supplemented with 50 mg/kg of 1,25(OH)2D3-G, suggested modulation of calcium transport in the intestine in response to the supplementation [77,78]. This means that there was increased production of this protein in intestinal cells and possibly a greater contribution to the bone development of growing broiler chickens [21,34,79].
Additionally, it is interesting to highlight that the calbindin D28K gene is associated with neuronal function, playing an essential role in the development and maintenance of brain health in birds [80]. When 1,25(OH)2D3-G binds to the VDR receptor, there is an increase in the expression of the calbindin D28K gene [79,81,82,83]. This results in increased production of the calbindin-D28K protein, which plays multiple roles in the nervous system, including regulating intracellular calcium and modulating neurotransmission [5,19,20]. This increase in the production of the calbindin-D28K protein can, therefore, significantly improve brain function in birds, contributing to better cognitive performance and healthier neurological development over time [77].
In this context, healthier neurological development is associated with more efficient and rapid growth in birds [32]. Optimized brain function can enhance nutrient absorption capacity, driving more vigorous growth and more efficient feed conversion [17,46]. Additionally, birds with improved brain function tend to exhibit a lower incidence of abnormal or stressful behaviors, which contributes to the overall well-being of the birds [39]. Additionally, a robust nervous system can strengthen the immune system of birds, making them more resistant to diseases and infections [82]. This, in turn, can reduce the need for antibiotics and medications, promoting a more sustainable and healthier production [10].

5. Conclusions

Supplementation with 100 mg/kg of 1,25(OH)2D3-G in breeder diets resulted in heavier broiler chicks at hatch, indicating improved nutrient transfer from the breeders to the eggs. Additionally, these chicks showed higher levels of interleukin 1β, interleukin 10, and calbindin D28K at 21 days of age, suggesting enhanced immune response and intestinal health. These health benefits extend into the growth phase, as broilers supplemented with 50 and 100 mg/kg of 1,25(OH)2D3-G exhibited better feed conversion ratios, reflecting more efficient nutrient utilization. This indicates that the supplementation not only improves the initial health of the chicks but also supports more efficient and healthy growth during the later stages.

Author Contributions

Conceptualization, T.S.A. and R.V.N.; methodology, R.V.N.; validation, R.V.N.; formal analysis, N.R.J.; investigation, T.S.A.; writing—original draft preparation, T.S.A.; writing—review and editing, T.S.A.; visualization, P.L.O.C., B.S.V., J.G.V.J., A.A.C., P.C.P., L.D.C. and E.S.K., supervision, C.E. and R.V.N. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The animal study protocol was approved by the Ethics Committee for the Use of Animals of the National Council for the Control of Animal Experimentation—Western Parana State University (Protocol No. 001/2021, 4 March 2021) and was previously approved by the National Council for the Control of Animal Experimentation in accordance with Normative No. 37 of 15 February 2018.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data will be made available on reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
CALB-D28K:Calbindin D28K
IL-1βInterleukin-1 beta
IL-10Interleukin 10
SEMStandard error of the mean
FIFeed intake
BWBody weight
BWGBody weight gain
FCRFeed conversion ratio
VHVillus height
CDCrypt depth
AAAbsorption area
VH/CDVillus-height-to-crypt-depth ratio
LDHLactate dehydrogenase
CPKCreatine phosphokinase
ALPAlkaline phosphatase

References

  1. Vieites, F.M.; Drosghic, L.C.A.B.; Souza, C.S.; Júnior, J.G.V.; Nunes, R.V.; de Moraes, G.H.K.; Corrêa, G.S.S.; Júnior, J.G.C. Características Ósseas de Frangos de Corte Alimentados Com Rações Suplementadas Com Solanum Glaucophyllum. Semin. Agrar. 2016, 37, 381. [Google Scholar] [CrossRef]
  2. Świątkiewicz, S.; Arczewska-Włosek, A.; Bederska-Lojewska, D.; Józefiak, D. Efficacy of Dietary Vitamin D and Its Metabolites in Poultry—Review and Implications of the Recent Studies. World’s Poult. Sci. J. 2017, 73, 57–68. [Google Scholar] [CrossRef]
  3. de Souza Castro, F.L.; Baião, N.C.; Ecco, R.; Louzada, M.J.Q.; de Faria Melo, É.; Saldanha, M.M.; Triginelli, M.V.; Lara, L.J.C. Effects of 1,25-Dihydroxycholecalciferol and Reduced Vitamin D3 Level on Broiler Performance and Bone Quality. Rev. Bras. Zootec. 2018, 47, e20170186. [Google Scholar] [CrossRef]
  4. Souza, C.S.; Vieites, F.M. Vitamina D3 e Seus Metabólitos Para Frangos de Corte. Arch. Zootecnia 2014, 63, 11–24. [Google Scholar] [CrossRef]
  5. Hsiao, F.S.-H.; Cheng, Y.-H.; Han, J.-C.; Chang, M.-H.; Yu, Y.-H. Effect of Different Vitamin D3 Metabolites on Intestinal Calcium Homeostasis-Related Gene Expression in Broiler Chickens. Rev. Bras. Zootecnia 2018, 47, e20170015. [Google Scholar] [CrossRef]
  6. Aye Cho, T.-Z.; Sadiq, M.B.; Srichana, P.; Anal, A.K. Vitamin D3 Enhanced Intestinal Phosphate Cotransporter Genes in Young and Growing Broilers. Poult. Sci. 2020, 99, 2041–2047. [Google Scholar] [CrossRef]
  7. Trautenmüller, H.; Genova, J.L.; de Azevedo dos Santos, L.B.; Leal, I.F.; de Brito Santos, G.; Rupolo, P.E.; Nunes, R.V.; de Oliveira, E.R.; de Oliveira Carvalho, P.L. Partial Cholecalciferol Replacement with 1,25-Dihydroxycholecalciferol Glycoside in Diets for Piglets. Anim. Prod. Sci. 2022, 62, 1590–1599. [Google Scholar] [CrossRef]
  8. Khan, R.U.; Naz, S.; Ullah, H.; Khan, N.A.; Laudadio, V.; Ragni, M.; Piemontese, L.; Tufarelli, V. Dietary Vitamin D: Growth, Physiological and Health Consequences in Broiler Production. Anim. Biotechnol. 2023, 34, 1635–1641. [Google Scholar] [CrossRef]
  9. Vieites, F.M.; Drosghic, L.C.A.B.; Souza, C.S.; Lima, C.A.R.; Moraes, G.H.K.; Nunes, R.V.; Vasconcellos, C.H.F.; Vargas Júnior, J.G. 1,25-Dihidroxivitamina-D 3 Sobre as Características Ósseas de Frangos de Corte Fêmeas. Arq. Bras. Med. Vet. Zootec. 2017, 69, 1285–1293. [Google Scholar] [CrossRef]
  10. Nunes, R.A.; de Souza Duarte, M.; Campos, P.H.R.F.; de Oliveira, L.L.; e Silva, F.F.; Kreuz, B.S.; Mirabile, C.G.; Borges, S.O.; Calderano, A.A. Active Vitamin D3-Glycoside Preserves Weight Gain and Modulates the Inflammatory Response in Broiler Chickens Challenged with Lipopolysaccharide. Anim. Feed. Sci. Technol. 2020, 270, 114704. [Google Scholar] [CrossRef]
  11. Bassi, L.S.; Moreno, F.A.; Martins, C.C.S.; Sens, R.F.; Lozano-Poveda, C.A.; Maiorka, A. Effect of 25-Hydroxycholecalciferol Supplementation with Different Dietary Available Phosphorus Levels for Broilers. Br. Poult. Sci. 2023, 65, 71–78. [Google Scholar] [CrossRef]
  12. Poorhemati, H.; Ghaly, M.; Sadvakassova, G.; Komarova, S.V. FGF23 Level in Poultry Chicken, a Systematic Review and Meta-Analysis. Front. Physiol. 2023, 14, 1279204. [Google Scholar] [CrossRef] [PubMed]
  13. Souza, C.S.; Vieites, F.M.; Nunes, R.V.; Brusamarelo, E.; Reis, T.L.; de Lima, C.A.R.; de Vargas Junior, J.G. Suplemento de 1,25-Dihidroxicolecalciferol e Redução de Cálcio e Fósforo Disponível Para Frangos de Corte Fêmeas. Res. Soc. Dev. 2020, 9, e119973975. [Google Scholar] [CrossRef]
  14. Hu, Y.; van Baal, J.; Hendriks, W.H.; Resink, J.-W.; Liesegang, A.; van Krimpen, M.M.; Bikker, P. High Dietary Ca and Microbial Phytase Reduce the Expression of Ca Transporters While Enhancing Claudins Involved in Paracellular Ca Absorption in the Porcine Jejunum and Colon. Br. J. Nutr. 2023, 129, 1127–1135. [Google Scholar] [CrossRef]
  15. Vieites, F.; Brusamarelo, E.; Corrêa, G.d.S.; Souza, C.; De Oliveira, C.; De Moraes, G.; Júnior, J.C. 1,25-Dihidroxicolecalciferol de Origem Herbal (Solanum glaucophyllum) Mantém o Desempenho e a Qualidade Óssea de Frangos de Corte Fêmeas Durante Restrição de Cálcio e Fósforo. Arch. Zootecnia 2018, 67, 414–419. [Google Scholar] [CrossRef]
  16. Warren, M.F.; Vu, T.C.; Toomer, O.T.; Fernandez, J.D.; Livingston, K.A. Efficacy of 1-α-Hydroxycholecalciferol Supplementation in Young Broiler Feed Suggests Reducing Calcium Levels at Grower Phase. Front. Vet. Sci. 2020, 7, 245. [Google Scholar] [CrossRef]
  17. Han, J.; Wu, L.; Lv, X.; Liu, M.; Zhang, Y.; He, L.; Hao, J.; Xi, L.; Qu, H.; Shi, C.; et al. Intestinal Segment and Vitamin D3 Concentration Affect Gene Expression Levels of Calcium and Phosphorus Transporters in Broiler Chickens. J. Anim. Sci. Technol. 2022, 65, 336–350. [Google Scholar] [CrossRef] [PubMed]
  18. Ismailova, A.; White, J.H. Vitamin D, Infections and Immunity. Rev. Endocr. Metab. Disord. 2022, 23, 265–277. [Google Scholar] [CrossRef]
  19. Shojadoost, B.; Behboudi, S.; Villanueva, A.I.; Brisbin, J.T.; Ashkar, A.A.; Sharif, S. Vitamin D3 Modulates the Function of Chicken Macrophages. Res. Vet. Sci. 2015, 100, 45–51. [Google Scholar] [CrossRef]
  20. Shojadoost, B.; Yitbarek, A.; Alizadeh, M.; Kulkarni, R.R.; Astill, J.; Boodhoo, N.; Sharif, S. Centennial Review: Effects of Vitamins A, D, E, and C on the Chicken Immune System. Poult. Sci. 2021, 100, 100930. [Google Scholar] [CrossRef]
  21. Cao, S.; Li, T.; Shao, Y.; Zhang, L.; Lu, L.; Zhang, R.; Hou, S.; Luo, X.; Liao, X. Regulation of Bone Phosphorus Retention and Bone Development Possibly by Related Hormones and Local Bone-Derived Regulators in Broiler Chicks. J. Anim. Sci. Biotechnol. 2021, 12, 88. [Google Scholar] [CrossRef] [PubMed]
  22. Saddoris, K.L.; Fleet, J.C.; Radcliffe, J.S. The Effect of Dietary Vitamin D Supplementation on Sodium-Dependent Phosphate Uptake and Expression of NaPi-IIb in the Small Intestine of Weanling Pigs. J. Anim. Sci. 2021, 99, skz106. [Google Scholar] [CrossRef] [PubMed]
  23. Gloux, A.; Le Roy, N.; Ezagal, J.; Même, N.; Hennequet-Antier, C.; Piketty, M.L.; Prié, D.; Benzoni, G.; Gautron, J.; Nys, Y.; et al. Possible Roles of Parathyroid Hormone, 1.25(OH)2D3, and Fibroblast Growth Factor 23 on Genes Controlling Calcium Metabolism across Different Tissues of the Laying Hen. Domest. Anim. Endocrinol. 2020, 72, 106407. [Google Scholar] [CrossRef]
  24. Dimitrov, V.; Barbier, C.; Ismailova, A.; Wang, Y.; Dmowski, K.; Salehi-Tabar, R.; Memari, B.; Groulx-Boivin, E.; White, J.H. Vitamin D-Regulated Gene Expression Profiles: Species-Specificity and Cell-Specific Effects on Metabolism and Immunity. Endocrinology 2021, 162, bqaa218. [Google Scholar] [CrossRef] [PubMed]
  25. Haussler, M.R.; Livingston, S.; Sabir, Z.L.; Haussler, C.A.; Jurutka, P.W. Vitamin D Receptor Mediates a Myriad of Biological Actions Dependent on Its 1,25-Dihydroxyvitamin D Ligand: Distinct Regulatory Themes Revealed by Induction of Klotho and Fibroblast Growth Factor-23. JBMR Plus 2021, 5, e10432. [Google Scholar] [CrossRef]
  26. Souza, C.S.; Vieites, F.M.; Vasconcellos, C.H.F.; Calderano, A.A.; Nunes, R.V.; Ferreira, C.M.; Pereira, T.V.S.; Moraes, G.H.K. Suplemento de 1,25 Dihidroxicolecalciferol e Redução de Cálcio e Fósforo Disponível Para Frangos de Corte. Arq. Bras. Med. Vet. E Zootec. 2013, 65, 519–525. [Google Scholar] [CrossRef]
  27. Alves, O.D.S.; Calixto, L.F.L.; Araujo, A.H.B.; Torres-Cordido, K.A.A.; Reis, T.L.; Calderano, A.A. Decreased Levels of Vitamin D3 and Supplementation with 1,25-Dihydroxyvitamin D3-Glycoside on Performance, Carcass Yield and Bone Quality in Broilers. Cienc. Rural. 2018, 48, e20170705. [Google Scholar] [CrossRef]
  28. Gili, V.; Pardo, V.G.; Ronda, A.C.; De Genaro, P.; Bachmann, H.; Boland, R.; de Boland, A.R. In Vitro Effects of 1α,25(OH)2D3-Glycosides from Solbone A (Solanum Glaucophyllum Leaves Extract; Herbonis AG) Compared to Synthetic 1α,25(OH)2D3 on Myogenesis. Steroids 2016, 109, 7–15. [Google Scholar] [CrossRef]
  29. Trautenmüller, H.; Genova, J.L.; de Faria, A.B.B.; Martins, J.S.; Viana, S.C.M.; Castilha, L.D.; Gonçalves, A.C.; Baraldi-Artoni, S.M.; de Oliveira Carvalho, P.L. Bone Traits and Gastrointestinal Tract Parameters of Piglets Fed Cholecalciferol and 1,25-Dihydroxycholecalciferol Glycoside. Rev. Bras. Zootecnia 2021, 50, e20210098. [Google Scholar] [CrossRef]
  30. Yavaş, İ.; Çenesiz, A.A.; Ceylan, N. Effects of Herbal Vitamin D3 and Phytase Supplementation to Broiler Feed on Performance, Bone Development and Serum Parameters of Broilers. J. Agric. Sci. Bilim. Derg. 2020, 26, 212–219. [Google Scholar] [CrossRef]
  31. Jacquillet, G.; Unwin, R.J. Physiological Regulation of Phosphate by Vitamin D, Parathyroid Hormone (PTH) and Phosphate (Pi). Pflügers Archiv 2019, 471, 83–98. [Google Scholar] [CrossRef] [PubMed]
  32. Wu, L.; Wang, X.; Lv, X.; He, L.; Qu, H.; Shi, C.; Zhang, L.; Zhang, J.; Wang, Z.; Han, J. 1,25-Dihydroxycholecalciferol Improved the Growth Performance and Upregulated the Calcium Transporter Gene Expression Levels in the Small Intestine of Broiler Chickens. J. Poult. Sci. 2022, 59, 0210019. [Google Scholar] [CrossRef] [PubMed]
  33. Khan, S.H.; Shahid, R.; Mian, A.A.; Sardar, R.; Anjum, M.A. ORIGINAL ARTICLE: Effect of the Level of Cholecalciferol Supplementation of Broiler Diets on the Performance and Tibial Dyschondroplasia. J. Anim. Physiol. Anim. Nutr. 2010, 94, 584–593. [Google Scholar] [CrossRef] [PubMed]
  34. Colet, S.; Garcia, R.; Almeida Paz, I.; Caldara, F.; Borille, R.; Royer, A.; Nääs, I.; Sgavioli, S. Bone Characteristics of Broilers Supplemented with Vitamin D. Rev. Bras. Cienc. Avicola 2015, 17, 325–332. [Google Scholar] [CrossRef]
  35. Nääs, I.D.A.; Baracho, M.D.S.; Bueno, L.G.F.; de Moura, D.J.; Vercelino, R.D.A.; Salgado, D.D. Use of Vitamin D to Reduce Lameness in Broilers Reared in Harsh Environments. Rev. Bras. Cienc. Avicola 2012, 14, 165–172. [Google Scholar] [CrossRef]
  36. Gil, Á.; Plaza-Diaz, J.; Mesa, M.D. Vitamin D: Classic and Novel Actions. Ann. Nutr. Metab. 2018, 72, 87–95. [Google Scholar] [CrossRef]
  37. Hodnik, J.J.; Ježek, J.; Starič, J. A Review of Vitamin D and Its Importance to the Health of Dairy Cattle. J. Dairy Res. 2020, 87, 84–87. [Google Scholar] [CrossRef]
  38. Marques, M.; Oliveira, R.; Donzele, J.; Albino, L.; Tizziani, T.; Faria, L.; Muniz, J.; Dalólio, F.; Lozano, C.; Silva, C. 25-Hydroxycholecalciferol As an Alternative to Vitamin D3 in Diets with Different Levels of Calcium for Broilers Reared Under Heat Stress. Braz. J. Poult. Sci. 2022, 24, eRBCA-2021. [Google Scholar] [CrossRef]
  39. Kumar, R.; Brar, R.S.; Banga, H.S. Hypervitaminosis D3 in Broiler Chicks: Histopathological, Immunomodulatory and Immunohistochemical Approach. Iran. J. Vet. Res. 2017, 18, 170–176. [Google Scholar]
  40. Koivisto, O.; Hanel, A.; Carlberg, C. Key Vitamin D Target Genes with Functions in the Immune System. Nutrients 2020, 12, 1140. [Google Scholar] [CrossRef]
  41. Jaime, J.; Vargas-Bermúdez, D.S.; Yitbarek, A.; Reyes, J.; Rodríguez-Lecompte, J.C. Differential Immunomodulatory Effect of Vitamin D (1,25(OH)2D3) on the Innate Immune Response in Different Types of Cells Infected in Vitro with Infectious Bursal Disease Virus. Poult. Sci. 2020, 99, 4265–4277. [Google Scholar] [CrossRef] [PubMed]
  42. Rodriguez-Lecompte, J.C.; Yitbarek, A.; Cuperus, T.; Echeverry, H.; van Dijk, A. The Immunomodulatory Effect of Vitamin D in Chickens Is Dose-Dependent and Influenced by Calcium and Phosphorus Levels. Poult. Sci. 2016, 95, 2547–2556. [Google Scholar] [CrossRef] [PubMed]
  43. Prietl, B.; Treiber, G.; Pieber, T.; Amrein, K. Vitamin D and Immune Function. Nutrients 2013, 5, 2502–2521. [Google Scholar] [CrossRef] [PubMed]
  44. Bachmann, H.; Autzen, S.; Frey, U.; Wehr, U.; Rambeck, W.; McCormack, H.; Whitehead, C.C. The Efficacy of a Standardised Product from Dried Leaves of Solanum glaucophyllum as Source of 1,25-Dihydroxycholecalciferol for Poultry. Br. Poult. Sci. 2013, 54, 642–652. [Google Scholar] [CrossRef]
  45. Vieites, F.M.; Nalon, R.P.; Santos, A.L.; Castelo Branco, P.A.; Souza, C.S.; Nunes, R.V.; Calderano, A.A.; de Arruda, N.V.M. Desempenho, Rendimento de Carcaça e Cortes Nobres de Frangos de Corte Alimentados Com Rações Suplementadas Com Solanum Glaucophyllum. Semin. Cienc. Agrar. 2014, 35, 1617. [Google Scholar] [CrossRef]
  46. Kumar, R.; Singh Banga, H.; Singh Brar, R. Effects of Dietary Vitamin D3 Over-Supplementation on Broiler Chickens’ Health; Clinicopathological and Immunohistochemical Characteristics. J. Vet. Physiol. Pathol. 2023, 2, 20–31. [Google Scholar] [CrossRef]
  47. Pande, V.V.; Chousalkar, K.C.; Bhanugopan, M.S.; Quinn, J.C. Super Pharmacological Levels of Calcitriol (1,25-(OH)2 D3) Inhibits Mineral Deposition and Decreases Cell Proliferation in a Strain Dependent Manner in Chicken Mesenchymal Stem Cells Undergoing Osteogenic Differentiation in Vitro. Poult. Sci. 2015, 94, 2784–2796. [Google Scholar] [CrossRef] [PubMed]
  48. Nong, K.; Liu, Y.; Fang, X.; Qin, X.; Liu, Z.; Zhang, H. Effects of the Vitamin D3 on Alleviating the Oxidative Stress Induced by Diquat in Wenchang Chickens. Animals 2023, 13, 711. [Google Scholar] [CrossRef]
  49. Liao, X.D.; Suo, H.Q.; Lu, L.; Hu, Y.X.; Zhang, L.Y.; Luo, X.G. Effects of Sodium, 1,25-Dihydroxyvitamin D3 and Parathyroid Hormone Fragment on Inorganic P Absorption and Type IIb Sodium-Phosphate Cotransporter Expression in Ligated Duodenal Loops of Broilers. Poult. Sci. 2017, 96, 2344–2350. [Google Scholar] [CrossRef]
  50. Lu, L.; Li, S.M.; Zhang, L.; Liu, X.Q.; Li, D.Y.; Zhao, X.L.; Liu, Y.P. Expression of β-Defensins in Intestines of Chickens Injected with Vitamin D3 and Lipopolysaccharide. Genet. Mol. Res. 2015, 14, 3330–3337. [Google Scholar] [CrossRef]
  51. Zhang, Y.; Leung, D.Y.M.; Richers, B.N.; Liu, Y.; Remigio, L.K.; Riches, D.W.; Goleva, E. Vitamin D Inhibits Monocyte/Macrophage Proinflammatory Cytokine Production by Targeting MAPK Phosphatase-1. J. Immunol. 2012, 188, 2127–2135. [Google Scholar] [CrossRef] [PubMed]
  52. Rostagno, H.S.; Albino, L.F.T.; Calderano, A.A.; Hanas, M.I.; Sakomura, N.K.; Perazzo, F.; Rocha, G.C.; Saraiva, A.; Abreu, M.L.T.; Genova, J.L.; et al. Tabelas Brasileiras Para Aves e Suínos: Composição de Alimentos e Exigências Nutricionais; Suprema: Visconde do Rio Branco, Brazil, 2024; Volume 5. [Google Scholar]
  53. Sakomura, N.K.; Rostagno, S.H. Métodos de Pesquisa Em Nutrição de Monogástricos; FUNEP, Ed.; Funep: Jaboticabal, Brazil, 2016; Volume 2. [Google Scholar]
  54. Luna, L.G. Manual of Histologic Staining Methods of the Armed Forces Institute of Pathology. In Pathology; McGraw-Hill: New York, NY, USA, 1968; Volume 3. [Google Scholar]
  55. Kisielinski, K.; Willis, S.; Prescher, A.; Klosterhalfen, B.; Schumpelick, V. A Simple New Method to Calculate Small Intestine Absorptive Surface in the Rat. Clin. Exp. Med. 2002, 2, 131–135. [Google Scholar] [CrossRef]
  56. Nunes, R.V.; Broch, J.; Wachholz, L.; de Souza, C.; Damasceno, J.L.; Oxford, J.H.; Bloxham, D.J.; Billard, L.; Pesti, G.M. Choosing Sample Sizes for Various Blood Parameters of Broiler Chickens with Normal and Non-Normal Observations. Poult. Sci. 2018, 97, 3746–3754. [Google Scholar] [CrossRef] [PubMed]
  57. Seedor, J.G. The Biophosphanate Alendronate (MK-217) Inhibit Bone Loss Due to Ovariectomy in Rats. J. Bone Miner. Res. 1993, 6, 265–275. [Google Scholar]
  58. Silva, D.J.; Queiroz, A.C. Análise de Alimentos: Métodos Químicos e Biológicos; UFV: Viçosa, Brazil, 2006; Volume 3. [Google Scholar]
  59. Crenshaw, T.D.; Peo, E.R.; Lewis, A.J.; Moser, B.D. Bone Strength as a Trait for Assessing Mineralization in Swine: A Critical Review of Techniques Involved. J. Anim. Sci. 1981, 53, 827–835. [Google Scholar] [CrossRef]
  60. Proszkowiec-Weglarz, M.; Angel, R. Calcium and Phosphorus Metabolism in Broilers: Effect of Homeostatic Mechanism on Calcium and Phosphorus Digestibility. J. Appl. Poult. Res. 2013, 22, 609–627. [Google Scholar] [CrossRef]
  61. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  62. SAS Institute. SAS University Edition: Installation Guide for Windows; SAS Institute Inc.: Cary, NC, USA, 2020; Available online: https://www.sas.com/pt_br/software/on-demand-for-academics.html (accessed on 12 March 2023).
  63. Fatemi, S.A.; Elliott, K.E.C.; Bello, A.; Peebles, E.D. Effects of the in Ovo Injection of Vitamin D3 and 25-Hydroxyvitamin D3 in Ross 708 Broilers Subsequently Challenged with Coccidiosis. I. Performance, Meat Yield and Intestinal Lesion Incidence1,2,3. Poult. Sci. 2021, 100, 101382. [Google Scholar] [CrossRef]
  64. Fatemi, S.A.; Elliott, K.E.C.; Macklin, K.S.; Bello, A.; Peebles, E.D. Effects of the In Ovo Injection of Vitamin D3 and 25-Hydroxyvitamin D3 in Ross 708 Broilers Subsequently Challenged with Coccidiosis: II Immunological and Inflammatory Responses and Small Intestine Histomorphology. Animals 2022, 12, 1027. [Google Scholar] [CrossRef]
  65. Fatemi, S.A.; Elliott, K.E.C.; Bello, A.; Durojaye, O.A.; Zhang, H.-J.; Peebles, E.D. The Effects of in Ovo Injected Vitamin D3 Sources on the Eggshell Temperature and Early Posthatch Performance of Ross 708 Broilers. Poult. Sci. 2020, 99, 1357–1362. [Google Scholar] [CrossRef]
  66. Kanani, R.; Kianfar, R.; Janmohammadi, H.; Kyun Kim, W.; Olyaee, M. Influence of Vitamin D3 and Lactic Acid on Performance, Egg Quality, and Hatchability in Broiler Breeder Hens. Anim. Prod. Res. 2022, 11, 67–81. [Google Scholar] [CrossRef]
  67. Setiyaningsih, N.; Jayanegara, A.; Wardani, W.W. Effects of a Vitamins D and C Supplement on Performance, Hatchability and Blood Profiles of Broiler Breeders. J. World’s Poult. Res. 2023, 13, 71–80. [Google Scholar] [CrossRef]
  68. Li, H.-M.; Liu, Y.; Zhang, R.-J.; Ding, J.-Y.; Shen, C.-L. Vitamin D Receptor Gene Polymorphisms and Osteoarthritis: A Meta-Analysis. Rheumatology 2021, 60, 538–548. [Google Scholar] [CrossRef]
  69. San, J.; Zhang, Z.; Bu, S.; Zhang, M.; Hu, J.; Yang, J.; Wu, G. Changes in Duodenal and Nephritic Ca and P Absorption in Hens during Different Egg-Laying Periods. Heliyon 2021, 7, e06081. [Google Scholar] [CrossRef]
  70. Barnkob, L.L.; Argyraki, A.; Jakobsen, J. Naturally Enhanced Eggs as a Source of Vitamin D: A Review. Trends Food Sci. Technol. 2020, 102, 62–70. [Google Scholar] [CrossRef]
  71. Yusuf, G.M.; Sumiati, S.; Mutia, R.; Wardani, W.W.; Akbar, I.; Putri, N.D.S. Performance, Egg Quality, Bone Health, and Immunity Assessments of Lohmann Laying Hens Supplemented with Vitamin D3 in the Diet. J. Trop Anim. Sci. 2023, 46, 461–470. [Google Scholar] [CrossRef]
  72. Li, J.; Yuan, J.; Miao, Z.; Guo, Y. Effects of Age on Intestinal Phosphate Transport and Biochemical Values of Broiler Chickens. Asian-Australas. J. Anim. Sci. 2016, 30, 221–228. [Google Scholar] [CrossRef]
  73. Kermani, Z.A.; Taheri, H.R.; Faridi, A.; Shahir, M.H.; Baradaran, N. Interactive Effects of Calcium, Vitamin D3, and Exogenous Phytase on Phosphorus Utilization in Male Broiler Chickens from 1 to 21 Days Post-Hatch: A Meta-Analysis Approach. Anim. Feed. Sci. Technol. 2023, 295, 115525. [Google Scholar] [CrossRef]
  74. Costa, C.H.R.; de Toledo Barreto, S.L.; Umigi, R.T.; Lima, H.J.D.; de Araujo, M.S.; Medina, P. Balanço de Cálcio e Fósforo e Estudo Dos Níveis Desses Minerais Em Dietas Para Codornas Japonesas (45 a 57 Semanas de Idade). Rev. Bras. Zootecnia 2010, 39, 1748–1755. [Google Scholar] [CrossRef]
  75. Sakkas, P.; Smith, S.; Hill, T.R.; Kyriazakis, I. A Reassessment of the Vitamin D Requirements of Modern Broiler Genotypes. Poult. Sci. 2019, 98, 330–340. [Google Scholar] [CrossRef]
  76. Lopes, T.S.B.; Shi, H.; White, D.; Araújo, I.C.S.; Kim, W.K. Effects of 25-Hydroxycholecalciferol on Performance, Gut Health, and Bone Quality of Broilers Fed with Reduced Calcium and Phosphorus Diet during Eimeria Challenge. Poult Sci. 2024, 103, 103267. [Google Scholar] [CrossRef] [PubMed]
  77. Düngelhoef, K.; Wilkens, M.R.; Mrochen, N.; Schröder, B.; Sander, S.; Kamphues, J. Effects of an Extra Supply of Vitamin D, Calcium and Phosphorus via Drinking Water on the Calcium and Phosphorus Metabolism in Growing Chickens Fed a Conventional Complete Diet. Eur. Poult. Sci. (EPS) 2014, 78, 1–15. [Google Scholar] [CrossRef]
  78. Lv, X.; Hao, J.; Wu, L.; Liu, M.; He, L.; Qiao, Y.; Cui, Y.; Wang, G.; Zhang, C.; Qu, H.; et al. Age Quadratically Affects Intestinal Calcium and Phosphorus Transporter Gene Expression in Broiler Chickens. Anim. Biosci. 2022, 35, 1921–1928. [Google Scholar] [CrossRef]
  79. Yang, L.-P.; Dong, Y.-P.; Luo, W.-T.; Zhu, T.; Li, Q.-W.; Zhang, L.-J.; Kong, J.; Yuan, Z.-W.; Zhao, Q. Tissue-Specific Regulatory Effects of Vitamin D and Its Receptor on Calbindin- D28K and Calbindin-D9K. Biochem. Mol. Biol. J. 2018, 4, 23. [Google Scholar] [CrossRef]
  80. Christakos, S.; Liu, Y.; Dhawan, P.; Peng, X. The Calbindins: Calbindin-D9K and Calbindin-D28K. In Vitamin D; Elsevier: Amsterdam, The Netherlands, 2005; pp. 721–735. [Google Scholar]
  81. David, L.S.; Anwar, M.N.; Abdollahi, M.R.; Bedford, M.R.; Ravindran, V. Calcium Nutrition of Broilers: Current Perspectives and Challenges. Animals 2023, 13, 1590. [Google Scholar] [CrossRef] [PubMed]
  82. Silva, J.C.S.; Fernandes, A.W.D.N.; Nunes, M.J.M.; Morais, P.L.A.d.G.; Fonseca, I.A.T.; Engelberth, R.C.G.J.; Cavalcanti, J.R.L.d.P.; de Araújo, D.P. Regulação Negativa de Calbindina-D28k Durante o Envelhecimento Neural Animal. Revista Neurociências 2022, 30, 1–36. [Google Scholar] [CrossRef]
  83. Bolt, M.J.; Cao, L.-P.; Kong, J.; Sitrin, M.D.; Li, Y.C. Vitamin D Receptor Is Required for Dietary Calcium-Induced Repression of Calbindin-D9k Expression in Mice. J. Nutr. Biochem. 2005, 16, 286–290. [Google Scholar] [CrossRef]
Table 1. Ingredient composition and calculated nutrient content of experimental diets.
Table 1. Ingredient composition and calculated nutrient content of experimental diets.
Ingredients, g/kg1 to 7 Day8 to 21 Day
Corn (7.88%)504.76525.03
Soybean Meal (46%)423.88402.13
Degummed Soybean oil29.7033.66
Dicalcium Phosphate17.8616.37
Limestone9.398.64
Salt4.023.68
Sodium Bicarbonate 1.001.50
Lysine Sulphate (60%)1.701.75
DL-Methionine (99%)3.273.09
L-Threonine (99%)0.470.42
Choline Chloride (60%)0.500.50
Adsorbent 11.001.00
Vitamin Premix 21.301.00
Mineral Premix 30.500.50
Anticoccidial 40.550.55
Enramycin 5 0.08
Inert (kaolin) 60.100.10
Calculated Nutrient Composition, g/kg
Metabolisable Energy, MJ/kg12.55212.761
Crude Protein 240.471231.848
Digestible Lysine 13.00012.50
dMet+Cys 79.6209.250
Digestible Threonine8.5808.250
Digestible Valine 10.0009.630
Digestible Tryptophan 2.8042.688
Digestible Arginine 15.19614.573
Calcium9.5008.780
Available Phosphorus 4.5004.190
Sodium 2.0002.000
Potassium 9.3729.039
1 Adsorbent: bentonite. 2 Vitamin supplement: composition per kg of product: vitamin A (min)—4.29 mg; vitamin D3 (min)—0.13 mg; vitamin E (min)—47.91 mg; vitamin K3 (min)—3.90 mg; vitamin B1 (min)—2.99 mg; vitamin B2 (min)—9.10 mg; pantothenic acid (min)—15.60 mg; vitamin B6 (min)—5.20 mg; vitamin B12 (min)—32.50 mg; niacin (min)—78.00 mg; folic acid (min)—2.60 mg; biotin (min)—0.33 mg; selenium (min)—0.39 mg. Vitamin supplement: composition per kg of diet initially: growth and finishing feeds: vitamin A—3.3 mg; vitamin D3—40.1 mg, 36.85 mg, 36.85 mg, and 36.85 mg; vitamin E—36.85 mg; vitamin K3—3.00 mg; thiamine (B1)—2.30 mg; riboflavin (B2)—7.00 mg; pyridoxine (B6)—4.00 mg; cyanocobalamin (B12)—25.00 mg; pantothenic acid (B5)—12.00 mg; niacin (B3)—60.00 mg; folic acid (B9)—2.00 mg; biotin (B7)—0.25 mg; selenium—0.30 g. 3 Mineral supplement: composition per kg of product: iron (min)—50 g; copper (min)—10 g; manganese (min)—65 g; zinc (min)—65 g; iodine (min)—1.000 mg. 4 Anticoccidial was as follows: From 1 to 21 days of age, Salinomycin 12% (Coxistac 12%) was used. From 22 to 35 days of age, Salinomycin 24% (Salinocox 24%) was used. 5 Enramycin 8% (Enradin 8%). 6 Inert based on kaolin, with the inclusion of 1,25(OH)2D3-G as a weight-for-weight substitution by the inert. 7 dMet+Cys: digestible methionine + cysteine.
Table 2. Supplementation of vitamin D3 (1,25(OH)2D3-G) in broilers diets from breeders supplemented with the same additive.
Table 2. Supplementation of vitamin D3 (1,25(OH)2D3-G) in broilers diets from breeders supplemented with the same additive.
Vitamin D3 Breeders, mg/kgVitamin D3 Broilers, mg/kg
0.00.0
0.050
0.0100
1000.0
10050
100100
Table 3. Genes and primer sequences for gene expression analysis using qPCR.
Table 3. Genes and primer sequences for gene expression analysis using qPCR.
GenePrimer Sequence (5′→3′)Amplicon Size (bp)Reference
β-actinaF: TTCTTTTGGCGCTTGACTCA
R: GCGTTCGCTCCAACATGTT		88[60]
CALB-D28KF: TTGGCACTGAAATCCCACTGAA
R: CATGCCAAGACCAAGGCTGA		116NM_205513.2
IL-1βF: GCTCTACATGTCGTGTGTGATGAG
R: TGTCGATGTCCCGCATGA		80NM_204524.2
IL-10F: CATGCTGCTGGGCCTGAA
R: CGTCTCCTTGATCTGCTTGATG		94NM_001004414.4
CALB-D28K: calbindin D28K; IL-1β: interleukin-1 beta; IL-10: interleukin 10.
Table 4. Performance of broilers at 21 days of age fed diets supplemented or not with vitamin D3 (1,25(OH)2D3-G) from breeders supplemented or not with the same additive.
Table 4. Performance of broilers at 21 days of age fed diets supplemented or not with vitamin D3 (1,25(OH)2D3-G) from breeders supplemented or not with the same additive.
Vitamin D3 Levels, mg/kgHatching BW, g/BirdFI, g/BirdBWG, g/BirdFCR, g FI/g BWG
Vitamin D3 Breeders
0.047.73 b11549171.261
10048.48 a11579231.254
SEM 10.035.934.310.01
Vitamin D3 Broilers
0.048.1211679141.279 B
5048.1411529201.252 A
10048.0611499251.242 A
SEM0.095.894.330.01
p-Value
Vitamin D3 Breeders0.0010.8120.4800.351
Vitamin D3 Broilers0.8930.4430.6030.001
Vitamin D3 Breeders × Vitamin D3 Broilers Interaction0.7370.6720.8450.245
ab: means followed by different lowercase letters in the column differ by F test at 5% significance. AB: means followed by different uppercase letters in the column differ by Student–Newman–Keuls test at 5% significance. 1 SEM: standard error of the mean. FI: feed intake; BW: body weight; BWG: body weight gain; FCR: feed.
Table 5. Histomorphometry of the jejunum of broilers at 21 days of age fed diets supplemented or not with vitamin D3 (1,25(OH)2D3-G) from breeders supplemented or not with the same additive.
Table 5. Histomorphometry of the jejunum of broilers at 21 days of age fed diets supplemented or not with vitamin D3 (1,25(OH)2D3-G) from breeders supplemented or not with the same additive.
Vitamin D3 Levels, mg/kgVH, µmCD, µmAA, µm2VH/CD, µm
Vitamin D3 Breeders
0.0780.5049.1716.4315.89
100745.5144.5116.1717.52
SEM 117.781.530.530.60
Vitamin D3 Broilers
0.0804.8246.4217.4417.14
50 761.3749.5815.5515.90
100724.3644.1715.9217.09
SEM17.481.540.520.61
p-Value
Vitamin D3 Breeders0.2050.0950.7660.181
Vitamin D3 Broilers0.0890.3150.3290.304
Vitamin D3 Breeders × Vitamin D3 Broilers Interaction0.0040.1050.0010.810
1 SEM: standard error of the mean. Vit: vitamin. VH: villus height; CD: crypt depth, AA: absorption area; VH/CD: villus-height-to-crypt-depth ratio.
Table 6. Breakdown of the interaction between vitamin D3 (1,25(OH)2D3-G) supplementation in the diets of breeders and broilers and its impact on villus height and absorption area in the jejunum of 21-day-old broilers.
Table 6. Breakdown of the interaction between vitamin D3 (1,25(OH)2D3-G) supplementation in the diets of breeders and broilers and its impact on villus height and absorption area in the jejunum of 21-day-old broilers.
Villus Height, µm Absorption Area, µm2
Vitamin D3 Broilers, mg/kg Vitamin D3 Breeders, mg/kg
0.0100SEMp-Value0.0100 SEMp-Value
0.0898.52 aA722.84 B18.310.00419.74 aA15.13 B0.720.004
50 780.15 ab742.6036.140.59915.76 b15.340.940.823
100677.65 b771.0824.210.06613.80 bB18.03 A0.710.008
SEM 120.1020.03 0.480.58
p-Value0.0020.660 0.0010.180
ab: means followed by different lowercase letters in the columns differ by the Student–Newman–Keuls test at 5%. AB: means followed by uppercase letters in the row differ by the F-test at 5%. 1 SEM: standard error of the mean.
Table 7. Calcium, phosphorus concentrations, and serum enzyme activity of broilers at 21 days of age fed diets supplemented or not with vitamin D3 (1,25(OH)2D3-G) from breeders supplemented or not with the same additive.
Table 7. Calcium, phosphorus concentrations, and serum enzyme activity of broilers at 21 days of age fed diets supplemented or not with vitamin D3 (1,25(OH)2D3-G) from breeders supplemented or not with the same additive.
Vitamin D3 Levels, mg/kgCa
mg/dL		P
mg/dL		LDH
U/L		CPK
U/L		ALP
U/L
Vitamin D3 Breeders
0.09.487.50683216226,500 a
1009.097.16642287220,920 b
SEM 10.110.1330.56123.54412.70
Vitamin D3 Broilers
0.09.167.24662234923,561
509.707.48671323324,057
1009.017.27654190423,684
SEM0.120.1331.05151.28316.01
p-Value
Vitamin D3 Breeders0.4110.1840.5050.3200.004
Vitamin D3 Broilers0.4920.6910.9650.2740.962
Vitamin D3 Breeders × Vitamin D3 Broilers Interaction0.7580.5450.3670.6110.529
ab: means followed by lowercase letters in the column differ according to the F-test at 5% significance. 1 SEM: standard error of the mean. Ca: calcium; P: phosphorus. LDH: lactate dehydrogenase; CPK: creatine phosphokinase; ALP: alkaline phosphatase.
Table 8. Seedor index and tibia breaking strength of broilers at 21 days of age fed diets supplemented or not with vitamin D3 (1,25(OH)2D3-G) from breeders supplemented or not with the same additive.
Table 8. Seedor index and tibia breaking strength of broilers at 21 days of age fed diets supplemented or not with vitamin D3 (1,25(OH)2D3-G) from breeders supplemented or not with the same additive.
Vitamin D3 Levels, mg/kgSeedor IndexBreaking Strength, kg
Vitamin D3 Breeders
0.068.8222.45
10070.1822.28
SEM 11.020.53
Vitamin D3 Broilers
0.068.4321.89
5067.2621.41
10072.7823.77
SEM0.970.52
p-Value
Vitamin D3 Breeders0.4530.879
Vitamin D3 Broilers0.0570.142
Vitamin D3 Breeders × Vitamin D3 Broilers Interaction0.5050.726
1 SEM: standard error of the mean.
Table 9. Bromatological composition of the tibia expressed in dry matter of broilers at 21 days of age fed diets supplemented or not with vitamin D3 (1,25(OH)2D3-G) from breeders supplemented or not with the same additive.
Table 9. Bromatological composition of the tibia expressed in dry matter of broilers at 21 days of age fed diets supplemented or not with vitamin D3 (1,25(OH)2D3-G) from breeders supplemented or not with the same additive.
Vitamin D3 Levels, mg/kgDry Matter, %Phosphorus, %Calcium, %
Vitamin D3 Breeders
0.040.1211.3416.23
10040.7011.3116.27
SEM 10.330.290.36
Vitamin D3 Broilers
0.039.7211.68 A17.51 A
5040.7111.96 A16.64 A
10040.8310.33 B14.59 B
SEM0.330.270.31
p-Value
Vitamin D3 Breeders0.3440.9660.951
Vitamin D3 Broilers0.3060.0440.005
Vitamin D3 Breeders × Vitamin D3 Broilers Interaction0.4870.9000.006
AB: means followed by different uppercase letters in the column differ by Student–Newman–Keuls test at 5% significance. 1 SEM: standard error of the mean.
Table 10. Breakdown of the interaction between vitamin D3 (1,25(OH)2D3-G) supplementation in the diets of breeders and broilers and its impact on calcium concentrations in 21-day-old broilers.
Table 10. Breakdown of the interaction between vitamin D3 (1,25(OH)2D3-G) supplementation in the diets of breeders and broilers and its impact on calcium concentrations in 21-day-old broilers.
Vitamin D3 Broilers, mg/kgVitamin D3 Breeders, mg/kg
0.0100SEMp-Value
0.016.7818.25 a0.450.118
5015.9817.31 a0.630.292
10015.94 A13.25 bB0.420.005
SEM 10.370.45
p-Value0.5670.003
ab: means followed by different lowercase letters in the column differ from each other according to the F-test at 5% significance. AB: means followed by uppercase letters in the column differ from each other according to the Student–Newman–Keuls test at 5% significance. 1 SEM: standard error of the mean.
Table 11. Jejunum gene expression in broilers at 21 days of age fed diets supplemented or not with vitamin D3 (1,25(OH)2D3-G) from breeders supplemented or not with the same additive.
Table 11. Jejunum gene expression in broilers at 21 days of age fed diets supplemented or not with vitamin D3 (1,25(OH)2D3-G) from breeders supplemented or not with the same additive.
Vitamin D3 Levels, mg/kgCalbindin D28KInterleukin 10Interleukin 1β
Vitamin D3 Breeders
0.00.239 b1.557 b1.030 b
1000.358 a1.820 a1.366 a
SEM 10.020.120.07
Vitamin D3 Broilers
0.00.273 B1.7811.255
500.318 A1.7071.108
1000.306 A1.5991.207
SEM0.020.130.07
p-Value
Vitamin D3 Breeders0.0010.0010.003
Vitamin D3 Broilers0.0470.1760.461
Vitamin D3 Breeders × Vitamin D3 Broilers Interaction0.1220.2270.897
ab: means followed by different lowercase letters in the column differ from each other according to the F-test at 5% significance. AB: means followed by uppercase letters in the column differ from each other according to the Student–Newman–Keuls test at 5% significance. 1 SEM: standard error of the mean.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Andrade, T.S.; Rohloff Junior, N.; Carvalho, P.L.O.; Vieira, B.S.; Vargas Junior, J.G.; Calderano, A.A.; Pozza, P.C.; Castilha, L.D.; Klosowski, E.S.; Eyng, C.; et al. Effects of 1,25-Dihydroxycholecalciferol Glycoside Supplementation on the Growth, Intestinal Health, and Immunity of Broilers from Breeders Supplemented or Not with the Same Additive. Vet. Sci. 2025, 12, 434. https://doi.org/10.3390/vetsci12050434

AMA Style

Andrade TS, Rohloff Junior N, Carvalho PLO, Vieira BS, Vargas Junior JG, Calderano AA, Pozza PC, Castilha LD, Klosowski ES, Eyng C, et al. Effects of 1,25-Dihydroxycholecalciferol Glycoside Supplementation on the Growth, Intestinal Health, and Immunity of Broilers from Breeders Supplemented or Not with the Same Additive. Veterinary Sciences. 2025; 12(5):434. https://doi.org/10.3390/vetsci12050434

Chicago/Turabian Style

Andrade, Thiago S., Nilton Rohloff Junior, Paulo L. O. Carvalho, Bruno S. Vieira, José G. Vargas Junior, Arele A. Calderano, Paulo C. Pozza, Leandro D. Castilha, Elcio S. Klosowski, Cinthia Eyng, and et al. 2025. "Effects of 1,25-Dihydroxycholecalciferol Glycoside Supplementation on the Growth, Intestinal Health, and Immunity of Broilers from Breeders Supplemented or Not with the Same Additive" Veterinary Sciences 12, no. 5: 434. https://doi.org/10.3390/vetsci12050434

APA Style

Andrade, T. S., Rohloff Junior, N., Carvalho, P. L. O., Vieira, B. S., Vargas Junior, J. G., Calderano, A. A., Pozza, P. C., Castilha, L. D., Klosowski, E. S., Eyng, C., & Nunes, R. V. (2025). Effects of 1,25-Dihydroxycholecalciferol Glycoside Supplementation on the Growth, Intestinal Health, and Immunity of Broilers from Breeders Supplemented or Not with the Same Additive. Veterinary Sciences, 12(5), 434. https://doi.org/10.3390/vetsci12050434

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop