Variants in BMP15 Gene Affect Promoter Activity and Litter Size in Gobi Short Tail and Ujimqin Sheep
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Selection
2.2. DNA Extraction and Sequencing
2.3. SNP Genotyping Using iPLEX MassARRAY
2.4. Paraffin Sections and Immunohistochemical Staining
2.5. Plasmid Construction
2.6. Cell Culture and Transfection
2.7. Dual Luciferase Activity Assay
2.8. Bioinformatics Analysis
2.9. Statistical Analyses
3. Results
3.1. Ovine BMP15 SNP Identification in GB Sheep
3.2. Genetic Diversity Analysis
3.3. Linkage Disequilibrium Analysis of Variants in BMP15
3.4. Associations Between Novel Variants and Litter Size
3.4.1. Associations Between Novel Variants and Litter Size in Gobi Short Tail Sheep
3.4.2. Associations Between Novel Variants and Litter Size in Ujimqin Sheep
3.5. Localization of BMP15 in the Ovary
3.6. The SNP g.54291460G>A in the Promoter of BMP15 Affects Promoter Activity
3.7. Bioinformatics Analysis of Ovine BMP15
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- China National Commission of Animal Genetic Resources (CNCAGR). Sheep and Goats, Animal Genetic Resources in China; China Agriculture Press: Beijing, China, 2011. [Google Scholar]
- Bai, Y.; Wang, S.; Wu, K.; Zhang, M.; Alatan, S.; Cang, M.; Cao, G.; Jin, H.; Li, C.; Tong, B. The Impact of Novel BMPR1B Mutations on Litter Size in Short-Tailed Gobi Sheep and Larger-Tailed Ujimqin Sheep. Vet. Sci. 2024, 11, 297. [Google Scholar] [CrossRef] [PubMed]
- Tong, B.; Wang, J.P.; Cheng, Z.X.; Liu, J.S.; Wu, Y.R.; Li, Y.H.; Bai, C.; Zhao, S.; Yu, H.; Li, G. Novel Variants in Gene Affect Promoter Activity and Litter Size in Mongolia Sheep. Genes 2020, 11, 375. [Google Scholar] [CrossRef] [PubMed]
- Juengel, J.L.; Hudson, N.L.; Heath, D.A.; Smith, P.; Reader, K.L.; Lawrence, S.B.; Juengel, J.L.; Jokiranta, T.S.; McLaren, R.J.; Luiro, K.; et al. Growth differentiation factor 9 and bone morphogenetic protein 15 are essential for ovarian follicular development in sheep. Biol. Reprod. 2002, 67, 1777–1789. [Google Scholar] [CrossRef]
- Otsuka, F.; Yao, Z.X.; Lee, T.H.; Yamamoto, S.; Erickson, G.F.; Shimasaki, S. Bone morphogenetic protein-15—Identification of target cells and biological functions. J. Biol. Chem. 2000, 275, 39523–39528. [Google Scholar] [CrossRef]
- Dube, J.L.; Wang, P.; Elvin, J.; Lyons, K.M.; Celeste, A.J.; Matzuk, M.M. The bone morphogenetic protein 15 gene is X-linked and expressed in oocytes. Mol. Endocrinol. 1998, 12, 1809–1817. [Google Scholar] [CrossRef]
- Galloway, S.M.; McNatty, K.P.; Cambridge, L.M.; Laitinen, M.P.; Juengel, J.L.; Jokiranta, T.S.; McLaren, R.J.; Luiro, K.; Dodds, K.G.; Montgomery, G.W.; et al. Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nat. Genet. 2000, 25, 279–283. [Google Scholar] [CrossRef]
- Hanrahan, J.P.; Gregan, S.M.; Mulsant, P.; Mullen, M.; Davis, G.H.; Powell, R.; Galloway, S.M. Mutations in the genes for oocyte-derived growth factors GDF9 and BMP15 are associated with both increased ovulation rate and sterility in Cambridge and Belclare sheep (Ovis aries). Biol. Reprod. 2004, 70, 900–909. [Google Scholar] [CrossRef]
- Bodin, L.; Di Pasquale, E.; Fabre, S.; Bontoux, M.; Monget, P.; Persani, L.; Mulsant, P. A novel mutation in the bone morphogenetic protein 15 gene causing defective protein secretion is associated with both increased ovulation rate and sterility in Lacaune sheep. Endocrinology 2007, 148, 393–400. [Google Scholar] [CrossRef]
- Demars, J.; Fabre, S.; Sarry, J.; Rossetti, R.; Gilbert, H.; Persani, L.; Tosser-Klopp, G.; Mulsant, P.; Nowak, Z.; Drobik, W.; et al. Genome-Wide Association Studies Identify Two Novel Mutations Responsible for an Atypical Hyperprolificacy Phenotype in Sheep. PLoS. Genet. 2013, 9, 1003482. [Google Scholar] [CrossRef]
- Lassoued, N.; Benkhlil, Z.; Woloszyn, F.; Rejeb, A.; Aouina, M.; Rekik, M.; Fabre, S.; Bedhiaf-Romdhani, S. FecX Bar a Novel BMP15 mutation responsible for prolificacy and female sterility in Tunisian Barbarine Sheep. BMC. Genet. 2017, 18, 43. [Google Scholar] [CrossRef]
- Guo, W.; Chu, M.X.; Deng, X.M.; Feng, J.D.; Li, N.; Wu, C.X. Association of a single codon deletion in bone morphogenetic protein 15 gene with prolificacy in small tail han sheep. Asian Austral. J. Anim. 2004, 17, 1491–1495. [Google Scholar] [CrossRef]
- Martinez-Royo, A.; Jurado, J.J.; Smulders, J.P.; Martí, J.I.; Alabart, J.L.; Roche, A.; Fantova, E.; Bodin, L.; Mulsant, P.; Serrano, M.; et al. A deletion in the gene causes sterility and increased prolificacy in Rasa Aragonesa sheep. Anim. Genet. 2008, 39, 294–297. [Google Scholar] [CrossRef]
- Silva, B.D.; Castro, E.A.; Souza, C.J.; Paiva, S.R.; Sartori, R.; Franco, M.M.; Azevedo, H.C.; Silva, T.A.; Vieira, A.M.; Neves, J.P.; et al. A new polymorphism in the Growth and Differentiation Factor 9 (GDF9) gene is associated with increased ovulation rate and prolificacy in homozygous sheep. Anim. Genet. 2011, 42, 89–92. [Google Scholar] [CrossRef] [PubMed]
- Abdoli, R.; Zamani, P.; Mirhoseini, S.Z.; Hossein-Zadeh, N.G.; Nadri, S. A review on prolificacy genes in sheep. Reprod. Domest. Anim. 2016, 51, 631–637. [Google Scholar] [CrossRef]
- Haresign, W. The physiological basis for variation in ovulation rate and litter size in sheep: A review. Livest. Prod. Sci. 1985, 13, 3–20. [Google Scholar] [CrossRef]
- Baena, V.; Terasaki, M. Three-dimensional organization of transzonal projections and other cytoplasmic extensions in the mouse ovarian follicle. Sci. Rep. 2019, 9, 1262. [Google Scholar] [CrossRef]
- Racowsky, C.; Needleman, D.J. Cumulus cell gene expression as a potential biomarker for oocyte quality. Fertil. Steril. 2018, 109, 438–439. [Google Scholar] [CrossRef]
- Zhu, G.; Fang, C.; Li, J.; Mo, C.; Wang, Y.; Li, J. Transcriptomic diversification of granulosa cells during follicular development in chicken. Sci. Rep. 2019, 9, 5462. [Google Scholar] [CrossRef]
- Uyar, A.; Torrealday, S.; Seli, E. Cumulus and granulosa cell markers of oocyte and embryo quality. Fertil. Steril. 2013, 99, 979–997. [Google Scholar] [CrossRef]
- Matsuda, F.; Inoue, N.; Manabe, N.; Ohkura, S. Follicular Growth and Atresia in Mammalian Ovaries: Regulation by Survival and Death of Granulosa Cells. J. Reprod. Develop. 2012, 58, 44–50. [Google Scholar] [CrossRef]
- Lu, C.L.; Yang, W.; Hu, Z.Y.; Liu, Y.X. Granulosa cell proliferation differentiation and its role in follicular development. Chin. Sci. Bull. 2005, 50, 2665–2671. [Google Scholar] [CrossRef]
- Ge, T.; Wen, Y.F.; Li, B.; Huang, X.Y.; Jiang, S.H.; Zhang, E.P. Single-cell sequencing reveals the reproductive variations between primiparous and multiparous Hu ewes. J. Anim. Sci. Biotechnol. 2023, 14, 144. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.L.; Chi, Z.J.; Jia, S.A.; Zhao, S.W.; Cao, G.F.; Purev, C.; Cang, M.; Yu, H.; Li, X.; Bao, S.; et al. Effects of novel variants in gene on litter size in Mongolia and Ujimqin sheep breeds. Theriogenology. 2023, 198, 1–11. [Google Scholar] [CrossRef]
- Gabriel, S.; Ziaugra, L.; Tabbaa, D. SNP genotyping using the Sequenom MassARRAY iPLEX platform. Curr. Protoc. Hum. Genet. 2009, 60, 2–12. [Google Scholar] [CrossRef]
- Barrett, J.C.; Fry, B.; Maller, J.; Daly, M.J. Haploview: Analysis and visualization of LD and haplotype maps. Bioinformatics 2005, 21, 263–265. [Google Scholar] [CrossRef]
- Moore, R.K.; Otsuka, F.; Shimasaki, S. Molecular basis of bone morphogenetic protein-15 signaling in granulosa cells. J. Biol. Chem. 2003, 278, 304–310. [Google Scholar] [CrossRef]
- Niu, Z.G.; Qin, J.; Jiang, Y.; Ding, X.D.; Ding, Y.G.; Tang, S.; Shi, H.C. The Identification of Mutation in BMP15 Gene Associated with Litter Size in Xinjiang Cele Black Sheep. Animals 2021, 11, 668. [Google Scholar] [CrossRef]
- Amini, H.R.; Ajaki, A.; Farahi, M.; Heidari, M.; Pirali, A.; Forouzanfar, M.; Eghbalsaied, S. The novel T755C mutation in BMP15 is associated with the litter size of Iranian Afshari, Ghezel, and Shal breeds. Arch. Anim. Breed. 2018, 61, 153–160. [Google Scholar] [CrossRef]
- Vaz-Drago, R.; Custódio, N.; Carmo-Fonseca, M. Deep intronic mutations and human disease. Hum. Gene 2017, 136, 1093–1111. [Google Scholar] [CrossRef]
- Anna, A.; Monika, G. Splicing mutations in human genetic disorders: Examples, detection, and confirmation. J. Appl. Genet. 2018, 59, 253–268. [Google Scholar] [CrossRef]
- Ambros, V. The functions of animal microRNAs. Nature 2004, 431, 350–355. [Google Scholar] [CrossRef] [PubMed]
- Ying, S.Y.; Lin, S.L. Intron-derived microRNAs--fine tuning of gene functions. Gene 2004, 342, 25–28. [Google Scholar] [CrossRef]
- Zhao, Z.Z.; Painter, J.N.; Palmer, J.S.; Webb, P.M.; Hayward, N.K.; Whiteman, D.C.; Boomsma, D.I.; Martin, N.G.; Duffy, D.L.; Montgomery, G.W. Variation in bone morphogenetic protein 15 is not associated with spontaneous human dizygotic twinning. Hum. Reprod. 2008, 23, 2372–2379. [Google Scholar] [CrossRef]
- Silva, J.R.; van den Hurk, R.; van Tol, H.T.; Roelen, B.A.; Figueiredo, J.R. Expression of growth differentiation factor 9 (GDF9), bone morphogenetic protein 15 (BMP15), and BMP receptors in the ovaries of goats. Mol. Reprod. Dev. 2005, 70, 11–19. [Google Scholar] [CrossRef]
- Hosoe, M.; Kaneyama, K.; Ushizawa, K.; Hayashi, K.G.; Takahashi, T. Quantitative analysis of bone morphogenetic protein 15 (BMP15) and growth differentiation factor 9 (GDF9) gene expression in calf and adult bovine ovaries. Reprod. Biol. Endocrin. 2011, 9, 33. [Google Scholar] [CrossRef]
- Pierre, A.; Estienne, A.; Racine, C.; Picard, J.Y.; Fanchin, R.; Lahoz, B.; Alabart, J.L.; Folch, J.; Jarrier, P.; Fabre, S.; et al. The Bone Morphogenetic Protein 15 Up-Regulates the Anti-Müllerian Hormone Receptor Expression in Granulosa Cells. J. Clin. Endocrinol. Metab. 2016, 101, 2602–2611. [Google Scholar] [CrossRef]
- Visser, J.A.; de Jong, F.H.; Laven, J.S.; Themmen, A.P. Anti-Müllerian hormone: A new marker for ovarian function. Reproduction 2006, 131, 1–9. [Google Scholar] [CrossRef]
- Turgut, A.O.; Koca, D. Anti-Müllerian hormone as a promising novel biomarker for litter size in Romanov sheep. Reprod. Domest. Anim. 2024, 59, e14692. [Google Scholar] [CrossRef]
- Otsuka, F.; Yamamoto, S.; Erickson, G.F.; Shimasaki, S. Bone morphogenetic protein-15 inhibits follicle-stimulating hormone (FSH) action by suppressing FSH receptor expression. J. Biol. Chem. 2001, 276, 11387–11392. [Google Scholar] [CrossRef]
- Hsueh, A.J.; Billig, H.; Tsafriri, A. Ovarian follicle atresia: A hormonally controlled apoptotic process. Endocr. Rev. 1994, 15, 707–724. [Google Scholar]
- Tilly, J.L. Apoptosis and ovarian function. Rev. Reprod. 1996, 1, 162–172. [Google Scholar] [CrossRef] [PubMed]
- Persani, L.; Rossetti, R.; Di Pasquale, E.; Cacciatore, C.; Fabre, S. The fundamental role of bone morphogenetic protein 15 in ovarian function and its involvement in female fertility disorders. Hum. Reprod. Update 2014, 20, 869–883. [Google Scholar] [CrossRef] [PubMed]
- Carlberg, C.; Polly, P. Gene regulation by vitamin D. Crit. Rev. Eukaryot. Gene Expr. 1998, 8, 19–42. [Google Scholar] [CrossRef] [PubMed]
- Thill, M.; Becker, S.; Fischer, D.; Cordes, T.; Hornemann, A.; Diedrich, K.; Salehin, D.; Friedrich, M. Expression of Prostaglandin Metabolising Enzymes COX-2 and 15-PGDH and VDR in Human Granulosa Cells. Anticancer Res. 2009, 29, 3611–3618. [Google Scholar]
- Glass, C.K. Differential recognition of target genes by nuclear receptor monomers, dimers, and heterodimers. Endocr. Rev. 1994, 15, 391–407. [Google Scholar]
- Carlberg, C. Molecular basis of the selective activity of vitamin D analogues. J. Cell. Biochem. 2003, 88, 274–281. [Google Scholar] [CrossRef]
Name | Primer Sequence | Annealing Temperature (°C) |
---|---|---|
Promoter-A | F: CCTGAGCTCGCTAGCCTCGAGGCCACCGCTTACAAAGTTCATACCTGTTCCACAG | 58 |
R: TTGGCCGCCGAGGCCAGATCTGTGTCCACTTGCGTCA | ||
Promoter-G | F: CCTGAGCTCGCTAGCCTCGAGGCCACCGCTTACAAAGTTCGTACCTGTTCCACAG | 58 |
R: TTGGCCGCCGAGGCCAGATCTGTGTCCACTTGCGTCA |
SNP | Genotype | Number | Litter Size |
---|---|---|---|
c.755T>C | TT | 179 | 1.26 ± 0.03 |
TC | 50 | 1.34 ± 0.07 | |
g.54291798C>T | CC | 211 | 1.28 ± 0.03 |
CT | 20 | 1.15 ± 0.08 | |
g.54292331G>A | GG | 201 | 1.28 ± 0.03 |
GA | 30 | 1.20 ± 0.07 | |
g.54292075C>A | CC | 204 | 1.26 ± 0.03 |
CA | 25 | 1.32 ± 0.10 | |
g.54288671C>T | CC | 27 | 1.37 ± 0.09 |
CT | 114 | 1.30 ± 0.04 | |
TT | 90 | 1.21 ± 0.04 | |
g.54287453C>T | CC | 203 | 1.27 ± 0.03 |
CT | 27 | 1.26 ± 0.09 | |
g.54285159_54285161TTAindel | TTA | 114 | 1.21 ± 0.04 a |
TTA.DEL | 102 | 1.34 ± 0.05 b | |
DEL.DEL | 15 | 1.27 ± 0.12 ab |
SNP | Genotype | Number | Litter Size |
---|---|---|---|
c.755T>C | TT | 125 | 1.19 ± 0.04 |
TC | 28 | 1.25 ± 0.08 | |
g.54291460G>A | GG | 132 | 1.18 ± 0.03 a |
GA | 21 | 1.38 ± 0.11 b | |
g.54292331G>A | GG | 133 | 1.20 ± 0.03 |
GA | 20 | 1.25 ± 0.10 | |
g.54292075C>A | CC | 114 | 1.18 ± 0.04 |
CA | 34 | 1.29 ± 0.08 | |
g.54288671C>T | CC | 31 | 1.16 ± 0.08 ab |
CT | 66 | 1.28 ± 0.05 a | |
TT | 56 | 1.10 ± 0.04 b | |
g.54285159_54285161TTAindel | TTA.TTA | 86 | 1.14 ± 0.04 a |
TTA.DEL | 61 | 1.31 ± 0.06 b |
SNP | Genotype | Number | Litter Size |
---|---|---|---|
c.755T>C | TT | 226 | 1.32 ± 0.03 |
TC | 43 | 1.39 ± 0.08 | |
c.1047G>A | GG | 254 | 1.33 ± 0.03 |
GA | 15 | 1.33 ± 0.12 | |
g.54291460G>A | GG | 238 | 1.31 ± 0.03 A |
GA | 31 | 1.55 ± 0.09 B | |
g.54292331G>A | GG | 242 | 1.34 ± 0.03 |
GA | 27 | 1.30 ± 0.09 | |
g.54292075C>A | CC | 212 | 1.31 ± 0.03 a |
CA | 51 | 1.47 ± 0.07 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, S.; Bai, Y.; Wang, D.; Zhang, M.; Alatan, S.; Cang, M.; Jin, H.; Li, C.; Du, G.; Cao, G.; et al. Variants in BMP15 Gene Affect Promoter Activity and Litter Size in Gobi Short Tail and Ujimqin Sheep. Vet. Sci. 2025, 12, 222. https://doi.org/10.3390/vetsci12030222
Wang S, Bai Y, Wang D, Zhang M, Alatan S, Cang M, Jin H, Li C, Du G, Cao G, et al. Variants in BMP15 Gene Affect Promoter Activity and Litter Size in Gobi Short Tail and Ujimqin Sheep. Veterinary Sciences. 2025; 12(3):222. https://doi.org/10.3390/vetsci12030222
Chicago/Turabian StyleWang, Shenyuan, Yanyu Bai, Daqing Wang, Ming Zhang, Suhe Alatan, Ming Cang, Hai Jin, Changqing Li, Guangchen Du, Guifang Cao, and et al. 2025. "Variants in BMP15 Gene Affect Promoter Activity and Litter Size in Gobi Short Tail and Ujimqin Sheep" Veterinary Sciences 12, no. 3: 222. https://doi.org/10.3390/vetsci12030222
APA StyleWang, S., Bai, Y., Wang, D., Zhang, M., Alatan, S., Cang, M., Jin, H., Li, C., Du, G., Cao, G., & Tong, B. (2025). Variants in BMP15 Gene Affect Promoter Activity and Litter Size in Gobi Short Tail and Ujimqin Sheep. Veterinary Sciences, 12(3), 222. https://doi.org/10.3390/vetsci12030222