RETRACTED: Ceftriaxone and Melittin Synergistically Promote Wound Healing in Diabetic Rats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Preparation and Characterization of CTX–MEL Ion-Pairing Complexes
2.3. Formulation of CTX–MEL-Loaded Hydrogels
2.4. Animals
2.5. Excision Wounding and Animal Treatment
2.6. Wound Measurement
2.7. Preparation of Tissue Homogenates
2.8. Histological Examination
2.9. Biochemical Analyses
2.10. qRT-PCR in Excised (Healing/Healed) Tissue
2.11. Immunohistochemical Assessment of VEGF-A and TGF-β1 Expression
2.12. Statistical Analysis
3. Results
3.1. Preparation and Characterization of CTX–MEL Nanomplex
3.2. Assessment of Wound Healing
3.3. Histopathological Investigation
3.4. Effect of CTX–MEL on Oxidative Status
3.5. Effect of CTX–MEL on Inflammation Markers
3.6. Effect of CTX–MEL on Fibrosis Markers
3.7. Immunohistochemical Assessment of VEGF-A and TGF-β1 Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rosenberg, C.S. Wound healing in the patient with diabetes mellitus. Nurs. Clin. N. Am. 1990, 25, 247–261. [Google Scholar]
- Han, G.; Ceilley, R. Chronic wound healing: A review of current management and treatments. Adv. Ther. 2017, 34, 599–610. [Google Scholar] [CrossRef] [PubMed]
- Endara, M.; Masden, D.; Goldstein, J.; Gondek, S.; Steinberg, J.; Attinger, C. The role of chronic and perioperative glucose management in high-risk surgical closures: A case for tighter glycemic control. Plast Reconstr. Surg. 2013, 132, 996–1004. [Google Scholar] [CrossRef] [PubMed]
- Strbo, N.; Yin, N.; Stojadinovic, O. Innate and adaptive immune responses in wound epithelialization. Adv. Wound Care 2014, 3, 492–501. [Google Scholar] [CrossRef]
- Rosique, R.G.; Rosique, M.J.; Farina Junior, J.A. Curbing inflammation in skin wound healing: A review. Int. J. Inflam. 2015, 2015, 316235. [Google Scholar] [CrossRef] [PubMed]
- Guillamat-Prats, R. The Role of MSC in Wound Healing, Scarring and Regeneration. Cells 2021, 10, 1729. [Google Scholar] [CrossRef]
- Fratini, F.; Cilia, G.; Turchi, B.; Felicioli, A. Insects, arachnids and centipedes venom: A powerful weapon against bacteria. A literature review. Toxicon 2017, 130, 91–103. [Google Scholar] [CrossRef] [PubMed]
- Soman, N.R.; Baldwin, S.L.; Hu, G.; Marsh, J.N.; Lanza, G.M.; Heuser, J.E.; Arbeit, J.M.; Wickline, S.A.; Schlesinger, P.H. Molecularly targeted nanocarriers deliver the cytolytic peptide melittin specifically to tumor cells in mice, reducing tumor growth. J. Clin. Investig. 2009, 119, 2830–2842. [Google Scholar] [CrossRef] [PubMed]
- Lima, W.G.; de Brito, J.C.M.; Cardoso, V.N.; Fernandes, S.O.A. In-depth characterization of antibacterial activity of melittin against Staphylococcus aureus and use in a model of non-surgical MRSA-infected skin wounds. Eur. J. Pharm. Sci. 2020, 156, 105592. [Google Scholar] [CrossRef] [PubMed]
- Memariani, H.; Memariani, M.; Shahidi-Dadras, M.; Nasiri, S.; Akhavan, M.M.; Moravvej, H. Melittin: From honeybees to superbugs. Appl. Microbiol. Biotechnol. 2019, 103, 3265–3276. [Google Scholar] [CrossRef]
- El-Aarag, B.; Magdy, M.; Alajmi, M.F.; Khalifa, S.A.; El-Seedi, H.R. Melittin Exerts Beneficial Effects on Paraquat-Induced Lung Injuries In Mice by Modifying Oxidative Stress and Apoptosis. Molecules 2019, 24, 1498. [Google Scholar] [CrossRef]
- Kurek-Górecka, A.; Komosinska-Vassev, K.; Rzepecka-Stojko, A.; Olczyk, P. Bee Venom in Wound Healing. Molecules 2020, 26, 148. [Google Scholar] [CrossRef] [PubMed]
- Desgranges, S.; Ruddle, C.C.; Burke, L.; McFadden, T.M.; O’Brien, J.E.; Fitzgerald-Hughes, D.; Humphreys, H.; Smyth, T.P.; Devocelle, M. β-Lactam-host defence peptide conjugates as antibiotic prodrug candidates targeting resistant bacteria. RSC Adv. 2012, 2, 2480–2492. [Google Scholar] [CrossRef]
- Li, W.; O’Brien-Simpson, N.M.; Holden, J.A.; Otvos, L.; Reynolds, E.C.; Separovic, F.; Hossain, M.A.; Wade, J.D. Covalent conjugation of cationic antimicrobial peptides with a β-lactam antibiotic core. Pept. Sci. 2018, 110. [Google Scholar] [CrossRef]
- Perry, T.R.; Schentag, J.J. Clinical use of ceftriaxone: A pharmacokinetic-pharmacodynamic perspective on the impact of minimum inhibitory concentration and serum protein binding. Clin Pharm. 2001, 40, 685–694. [Google Scholar] [CrossRef] [PubMed]
- Sari, Y.; Sakai, M.; Weedman, J.M.; Rebec, G.V.; Bell, R.L. Ceftriaxone, a Beta-Lactam Antibiotic, Reduces Ethanol Consumption in Alcohol-Preferring Rats. Alcohol Alcohol. 2011, 46, 239–246. [Google Scholar] [CrossRef]
- Ochoa-Aguilar, A.; Ventura-Martínez, R.; Sotomayor-Sobrino, M.A.; Jaimez, R.; Coffeen, U.; Jiménez-González, A.; Balcazar-Ochoa, L.G.; Pérez-Medina-Carballo, R.; Rodriguez, R.; Plancarte-Sánchez, R. Ceftriaxone and clavulanic acid induce antiallodynia and anti-inflammatory effects in rats using the carrageenan model. J. Pain Res. 2018, 11, 977–985. [Google Scholar] [CrossRef] [PubMed]
- Ochoa-Aguilar, A.; Sotomayor-Sobrino, M.; Jaimez, R.; Rodríguez, R.; Plancarte-Sanchez, R.; Ventura-Martinez, R. Antiallodynic Activity of Ceftriaxone and Clavulanic Acid in Acute Administration is Associated with Serum TNF-α Modulation and Activation of Dopaminergic and Opioidergic Systems. Drug Dev. Res. 2017, 78, 105–115. [Google Scholar] [CrossRef] [PubMed]
- Jeckson, T.A.; Neo, Y.P.; Sisinthy, S.P.; Gorain, B. Delivery of Therapeutics from Layer-by-Layer Electrospun Nanofiber Matrix for Wound Healing: An Update. J. Pharm. Sci. 2020, 110, 635–653. [Google Scholar] [CrossRef] [PubMed]
- Choudhury, H.; Pandey, M.; Lim, Y.Q.; Low, C.Y.; Lee, C.T.; Marilyn, T.C.L.; Loh, H.S.; Lim, Y.P.; Bhattamishra, S.K.; Kesharwani, P.; et al. Silver nanoparticles: Advanced and promising technology in diabetic wound therapy. Mater. Sci. Eng. C 2020, 112, 110925. [Google Scholar] [CrossRef] [PubMed]
- Choudhury, H.; Gorain, B.; Pandey, M.; Chatterjee, L.A.; Sengupta, P.; Das, A.; Molugulu, N.; Kesharwani, P. Recent Update on Nanoemulgel as Topical Drug Delivery System. J. Pharm. Sci. 2017, 106, 1736–1751. [Google Scholar] [CrossRef]
- Badr-Eldin, S.M.; Alhakamy, N.A.; Fahmy, U.A.; Ahmed, O.A.A.; Asfour, H.Z.; Althagafi, A.A.; Aldawsari, H.M.; Rizg, W.Y.; Mahdi, W.A.; Alghaith, A.F.; et al. Cytotoxic and Pro-Apoptotic Effects of a Sub-Toxic Concentration of Fluvastatin on OVCAR3 Ovarian Cancer Cells After its Optimized Formulation to Melittin Nano-Conjugates. Front. Pharmacol. 2021, 11. [Google Scholar] [CrossRef] [PubMed]
- Labib, R.M.; Ayoub, I.M.; Michel, H.E.; Mehanny, M.; Kamil, V.; Hany, M.; Magdy, M.; Moataz, A.; Maged, B.; Mohamed, A. Appraisal on the wound healing potential of Melaleuca alternifolia and Rosmarinus officinalis L. essential oil-loaded chitosan topical preparations. PLoS ONE 2019, 14, e0219561. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, O.A.; Afouna, M.I.; El-Say, K.M.; Abdel-Naim, A.B.; Khedr, A.; Banjar, Z.M. Optimization of self-nanoemulsifying systems for the enhancement of in vivo hypoglycemic efficacy of glimepiride transdermal patches. Expert Opin Drug Deliv. 2014, 11, 1005–1013. [Google Scholar] [CrossRef] [PubMed]
- Bae, J.-S.; Jang, K.-H.; Park, S.-C.; Jin, H.K. Promotion of Dermal Wound Healing by Polysaccharides Isolated from Phellinus gilvus in rats. J. Veter. Med. Sci. 2005, 67, 111–114. [Google Scholar] [CrossRef] [PubMed]
- lturkistani, A.H.; Tashkandi, F.M.; Mohammedsaleh, Z.M. Histological Stains: A Literature Review and Case Study. Glob. J. Heal. Sci. 2015, 8, 72–79. [Google Scholar] [CrossRef] [PubMed]
- Fresta, C.G.; Fidilio, A.; Lazzarino, G.; Musso, N.; Grasso, M.; Merlo, S.; Amorini, A.M.; Bucolo, C.; Tavazzi, B.; Lazzarino, G.; et al. Modulation of Pro-Oxidant and Pro-Inflammatory Activities of M1 Macrophages by the Natural Dipeptide Carnosine. Int. J. Mol. Sci. 2020, 21, 776. [Google Scholar] [CrossRef]
- Caruso, G.; Fresta, C.G.; Fidilio, A.; O’Donnell, F.; Musso, N.; Lazzarino, G.; Grasso, M.; Amorini, A.M.; Tascedda, F.; Bucolo, C.; et al. Carnosine Decreases PMA-Induced Oxidative Stress and Inflammation in Murine Macrophages. Antioxidants 2019, 8, 281. [Google Scholar] [CrossRef] [PubMed]
- Caruso, G.; Distefano, D.A.; Parlascino, P.; Fresta, C.G.; Lazzarino, G.; Lunte, S.M.; Nicoletti, V.G. Receptor-mediated toxicity of human amylin fragment aggregated by short- and long-term incubations with copper ions. Mol. Cell. Biochem. 2016, 425, 85–93. [Google Scholar] [CrossRef] [PubMed]
- Bucolo, C.; Campana, G.; Di Toro, R.; Cacciaguerra, S.; Spampinato, S. Sigma1 recognition sites in rabbit iris-ciliary body: Topical sigma1-site agonists lower intraocular pressure. J. Pharmacol. Exp. Ther. 1999, 289, 1362–1369. [Google Scholar]
- Fahmy, U.; Aldawsari, H.; Badr-Eldin, S.; Ahmed, O.; Alhakamy, N.; Alsulimani, H.; Caraci, F.; Caruso, G. The Encapsulation of Febuxostat into Emulsomes Strongly Enhances the Cytotoxic Potential of the Drug on HCT 116 Colon Cancer Cells. Pharmaceutics 2020, 12, 956. [Google Scholar] [CrossRef]
- Wu, M.; Guo, H.; Liu, L.; Liu, Y.; Xie, L. Size-dependent cellular uptake and localization profiles of silver nanoparticles. Int. J. Nanomed. 2019, 14, 4247–4259. [Google Scholar] [CrossRef] [PubMed]
- Hoshyar, N.; Gray, S.; Han, H.; Bao, G. The effect of nanoparticle size on in vivo pharmacokinetics and cellular interaction. Nanomedicine 2016, 11, 673–692. [Google Scholar] [CrossRef] [PubMed]
- Akash, M.S.H.; Rehman, K.; Liaqat, A. Tumor Necrosis Factor-Alpha: Role in Development of Insulin Resistance and Pathogenesis of Type 2 Diabetes Mellitus. J. Cell. Biochem. 2017, 119, 105–110. [Google Scholar] [CrossRef]
- Sharp, A.; Clark, J. Diabetes and its effects on wound healing. Nurs Stand 2011, 25, 41–47. [Google Scholar] [CrossRef]
- Al-Wahaibi, L.H.; Al-Saleem, M.S.M.; Ahmed, O.A.A.; Fahmy, U.A.; Alhakamy, N.A.; Eid, B.G.; Abdel-Naim, A.B.; Abdel-Mageed, W.M.; Alrasheed, M.M.; Shazly, G.A. Optimized Conjugation of Fluvastatin to HIV-1 TAT Displays Enhanced Pro-Apoptotic Activity in HepG2 Cells. Int. J. Mol. Sci. 2020, 21, 4138. [Google Scholar] [CrossRef] [PubMed]
- Moura, J.; Rodrigues, J.; Alves, J.M.; Amaral, C.; Lima, M.; Carvalho, E. Impaired T-cell differentiation in diabetic foot ulceration. Cell. Mol. Immunol. 2016, 14, 758–769. [Google Scholar] [CrossRef] [PubMed]
- Lazzarino, G.; Listorti, I.; Muzii, L.; Amorini, A.M.; Longo, S.; Di Stasio, E.; Caruso, G.; D’Urso, S.; Puglia, I.; Pisani, G.; et al. Low-molecular weight compounds in human seminal plasma as potential biomarkers of male infertility. Hum. Reprod. 2018, 33, 1817–1828. [Google Scholar] [CrossRef]
- Lazzarino, G.; Listorti, I.; Bilotta, G.; Capozzolo, T.; Amorini, A.M.; Longo, S.; Caruso, G.; Lazzarino, G.; Tavazzi, B.; Bilotta, P. Water- and Fat-Soluble Antioxidants in Human Seminal Plasma and Serum of Fertile Males. Antioxidants 2019, 8, 96. [Google Scholar] [CrossRef]
- Sanchez, M.C.; Lancel, S.; Boulanger, E.; Neviere, R. Targeting Oxidative Stress and Mitochondrial Dysfunction in the Treatment of Impaired Wound Healing: A Systematic Review. Antioxidants 2018, 7, 98. [Google Scholar] [CrossRef] [PubMed]
- Dos Santos, J.M.; Tewari, S.; Mendes, R.H. The Role of Oxidative Stress in the Development of Diabetes Mellitus and Its Complications. J. Diabetes Res. 2019, 2019, 4189813. [Google Scholar] [CrossRef] [PubMed]
- Bilgen, F.; Ural, A.; Kurutas, E.B.; Bekerecioglu, M. The effect of oxidative stress and Raftlin levels on wound healing. Int. Wound J. 2019, 16, 1178–1184. [Google Scholar] [CrossRef]
- Abood, W.N.; Al-Henhena, N.A.; Abood, A.N.; Al-Obaidi, M.M.J.; Ismail, S.; Abdulla, M.A.; Al Batran, R. Wound-healing potential of the fruit extract of Phaleria macrocarpa. Bosn. J. Basic Med Sci. 2015, 15, 25–30. [Google Scholar] [CrossRef] [PubMed]
- Perihan, O.; Ergul, K.B.; Neslihan, D.; Filiz, A. The activity of adenosine deaminase and oxidative stress biomarkers in scraping samples of acne lesions. J. Cosmet. Dermatol. 2012, 11, 323–328. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Leem, J.; Hong, H.-L. Melittin Ameliorates Endotoxin-Induced Acute Kidney Injury by Inhibiting Inflammation, Oxidative Stress, and Cell Death in Mice. Oxidative Med. Cell. Longev. 2021, 2021, 8843051. [Google Scholar] [CrossRef]
- Amin, B.; Hajhashemi, V.; Abnous, K.; Hosseinzadeh, H. Ceftriaxone, a Beta-Lactam Antibiotic, Modulates Apoptosis Pathways and Oxidative Stress in a Rat Model of Neuropathic Pain. BioMed Res. Int. 2014, 2014, 937568. [Google Scholar] [CrossRef]
- Kany, S.; Vollrath, J.T.; Relja, B. Cytokines in Inflammatory Disease. Int. J. Mol. Sci. 2019, 20, 6008. [Google Scholar] [CrossRef]
- Mirza, S.; Hossain, M.; Mathews, C.; Martinez, P.; Pino, P.; Gay, J.L.; Rentfro, A.; McCormick, J.B.; Fisher-Hoch, S.P. Type 2-diabetes is associated with elevated levels of TNF-alpha, IL-6 and adiponectin and low levels of leptin in a population of Mexican Americans: A cross-sectional study. Cytokine 2012, 57, 136–142. [Google Scholar] [CrossRef] [PubMed]
- Yao, C.; Markowicz, M.; Pallua, N.; Noah, E.M.; Steffens, G. The effect of cross-linking of collagen matrices on their angiogenic capability. Biomaterials 2008, 29, 66–74. [Google Scholar] [CrossRef]
- Jansen, R.G.; van Kuppevelt, T.H.; Daamen, W.F.; Kuijpers-Jagtman, A.M.; Hoff, J.W.V.D. Tissue reactions to collagen scaffolds in the oral mucosa and skin of rats: Environmental and mechanical factors. Arch. Oral Biol. 2008, 53, 376–387. [Google Scholar] [CrossRef]
- Boakye, Y.D.; Agyare, C.; Ayande, G.P.; Titiloye, N.; Asiamah, E.A.; Danquah, K.O. Assessment of Wound-Healing Properties of Medicinal Plants: The Case of Phyllanthus muellerianus. Front. Pharmacol. 2018, 9, 945. [Google Scholar] [CrossRef]
- Caskey, R.C.; Zgheib, C.; Morris, M.; Allukian, M.; Dorsett-Martin, W.; Xu, J.; Wu, W.; Liechty, K.W. Dysregulation of collagen production in diabetes following recurrent skin injury: Contribution to the development of a chronic wound. Wound Repair Regen. 2014, 22, 515–520. [Google Scholar] [CrossRef]
- Eming, S.A.; Krieg, T. Molecular Mechanisms of VEGF-A Action during Tissue Repair. J. Investig. Dermatol. Symp. Proc. 2006, 11, 79–86. [Google Scholar] [CrossRef]
- El Gazaerly, H.; Elbardisey, D.M.; Eltokhy, H.M. Effect of Transforming Growth Factor Beta 1 on Wound Healing in Induced Diabetic Rats. Int. J. Health Sci. 2013, 7, 160–172. [Google Scholar] [CrossRef]
- Beck, L.S.; Deguzman, L.; Lee, W.P.; Xu, Y.; McFatridge, L.A.; Amento, E.P. Tgf-beta 1 accelerates wound healing: Reversal of steroid-impaired healing in rats and rabbits. Growth Factors 1991, 5, 295–304. [Google Scholar] [CrossRef]
- Bao, P.; Kodra, A.; Tomic-Canic, M.; Golinko, M.S.; Ehrlich, H.P.; Brem, H. The Role of Vascular Endothelial Growth Factor in Wound Healing. J. Surg. Res. 2009, 153, 347–358. [Google Scholar] [CrossRef]
- Torrisi, S.A.; Geraci, F.; Tropea, M.R.; Grasso, M.; Caruso, G.; Fidilio, A.; Musso, N.; Sanfilippo, G.; Tascedda, F.; Palmeri, A.; et al. Fluoxetine and Vortioxetine Reverse Depressive-Like Phenotype and Memory Deficits Induced by Aβ1-42 Oligomers in Mice: A Key Role of Transforming Growth Factor-β1. Front. Pharmacol. 2019, 10. [Google Scholar] [CrossRef]
- Caraci, F.; Spampinato, S.F.; Morgese, M.G.; Tascedda, F.; Salluzzo, M.G.; Giambirtone, M.C.; Caruso, G.; Munafò, A.; Torrisi, S.A.; Leggio, G.M.; et al. Neurobiological links between depression and AD: The role of TGF-β1 signaling as a new pharmacological target. Pharmacol. Res. 2018, 130, 374–384. [Google Scholar] [CrossRef]
- Grasso, M.; Caruso, G.; Godos, J.; Bonaccorso, A.; Carbone, C.; Castellano, S.; Currenti, W.; Grosso, G.; Musumeci, T.; Caraci, F. Improving Cognition with Nutraceuticals Targeting TGF-β1 Signaling. Antioxidants 2021, 10, 1075. [Google Scholar] [CrossRef]
- Pakyari, M.; Farrokhi, A.; Maharlooei, M.K.; Ghahary, A. Critical Role of Transforming Growth Factor Beta in Different Phases of Wound Healing. Adv. Wound Care 2013, 2, 215–224. [Google Scholar] [CrossRef]








| Gene | Forward | Reverse | Gene Bank |
|---|---|---|---|
| Col1A1 | ATCAGCCCAAACCCCAAGGAGA | CGCAGGAAGGTCAGCTGGATAG | NM_053304.1 |
| GAPDH | CCATTCTTCCACCTTTGATGCT | TGTTGCTGTAGCCATATTCATTGT | NM_017008.4 |
| IC | FP | CD | GT | Ang | RE | |
|---|---|---|---|---|---|---|
| Negative Control | ++ | +/− | + | + | +/− | − |
| Positive Control | + | ++ | ++ | + | ++ | ++ |
| CTX | + | + | + | − | + | ++ |
| MEL | +/− | ++ | ++ | ++ | ++ | ++ |
| CTX–MEL | + | ++ | +++ | ++ | +++ | +++ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alhakamy, N.A.; Caruso, G.; Eid, B.G.; Fahmy, U.A.; Ahmed, O.A.A.; Abdel-Naim, A.B.; Alamoudi, A.J.; Alghamdi, S.A.; Al Sadoun, H.; Eldakhakhny, B.M.; et al. RETRACTED: Ceftriaxone and Melittin Synergistically Promote Wound Healing in Diabetic Rats. Pharmaceutics 2021, 13, 1622. https://doi.org/10.3390/pharmaceutics13101622
Alhakamy NA, Caruso G, Eid BG, Fahmy UA, Ahmed OAA, Abdel-Naim AB, Alamoudi AJ, Alghamdi SA, Al Sadoun H, Eldakhakhny BM, et al. RETRACTED: Ceftriaxone and Melittin Synergistically Promote Wound Healing in Diabetic Rats. Pharmaceutics. 2021; 13(10):1622. https://doi.org/10.3390/pharmaceutics13101622
Chicago/Turabian StyleAlhakamy, Nabil A., Giuseppe Caruso, Basma G. Eid, Usama A. Fahmy, Osama A. A. Ahmed, Ashraf B. Abdel-Naim, Abdulmohsin J. Alamoudi, Shareefa A. Alghamdi, Hadeel Al Sadoun, Basmah M. Eldakhakhny, and et al. 2021. "RETRACTED: Ceftriaxone and Melittin Synergistically Promote Wound Healing in Diabetic Rats" Pharmaceutics 13, no. 10: 1622. https://doi.org/10.3390/pharmaceutics13101622
APA StyleAlhakamy, N. A., Caruso, G., Eid, B. G., Fahmy, U. A., Ahmed, O. A. A., Abdel-Naim, A. B., Alamoudi, A. J., Alghamdi, S. A., Al Sadoun, H., Eldakhakhny, B. M., Caraci, F., & Abdulaal, W. H. (2021). RETRACTED: Ceftriaxone and Melittin Synergistically Promote Wound Healing in Diabetic Rats. Pharmaceutics, 13(10), 1622. https://doi.org/10.3390/pharmaceutics13101622

