The Impact of Olive Oil Compounds on the Metabolic Reprogramming of Cutaneous Melanoma Cell Models
Abstract
1. Introduction
2. Results
2.1. Impact of Oleic Acid, Homovanillyl Alcohol, and Hydroxytyrosol on A375 and MNT1 Melanoma Cell Viability
2.2. Metabolic Gene Expression in A375 and MNT1 Melanoma Cells
2.3. Effects of Oleic Acid, Homovanillyl Alcohol, and Hydroxytyrosol Induced Metabolic Gene Expression Changes on A375 and MNT1 Melanoma Cells
2.4. Effects of Oleic Acid, Homovanillyl Alcohol, and Hydroxytyrosol on the Activation of ERK and JNK Molecular Pathways in A375 and MNT1 Melanoma Cells
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Compounds
4.3. Viability Assays
4.4. Quantitative Real Time Polymerase Chain Reaction (qRT-PCR)
4.5. Western Blot
4.6. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Leonardi, G.C.; Falzone, L.; Salemi, R.; Zanghì, A.; Spandidos, D.A.; McCubrey, J.A.; Candido, S.; Libra, M. Cutaneous melanoma: From pathogenesis to therapy (Review). Int. J. Oncol. 2018, 52, 1071–1080. [Google Scholar] [CrossRef] [PubMed]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2019. CA Cancer J. Clin. 2019, 69, 7–34. [Google Scholar] [CrossRef] [PubMed]
- Bandarchi, B.; Ma, L.; Navab, R.; Seth, A.; Rasty, G. From Melanocyte to Metastatic Malignant Melanoma. Dermatol. Res. Pract. 2010, 2010, 583748. [Google Scholar] [CrossRef] [PubMed]
- Budczies, J.; von Winterfeld, M.; Klauschen, F.; Bockmayr, M.; Lennerz, J.K.; Denkert, C.; Wolf, T.; Warth, A.; Dietel, M.; Anagnostopoulos, I.; et al. The landscape of metastatic progression patterns across major human cancers. Oncotarget 2015, 6, 570–583. [Google Scholar] [CrossRef]
- Luís, R.; Brito, C.; Pojo, M. Melanoma Metabolism: Cell Survival and Resistance to Therapy. In Tumor Microenvironment: The Main Driver of Metabolic Adaptation; Serpa, J., Ed.; Springer: Cham, Switzerland, 2020; pp. 203–223. [Google Scholar]
- Avagliano, A.; Fiume, G.; Pelagalli, A.; Sanità, G.; Ruocco, M.R.; Montagnani, S.; Arcucci, A. Metabolic Plasticity of Melanoma Cells and Their Crosstalk with Tumor Microenvironment. Front. Oncol. 2020, 10, 722. [Google Scholar] [CrossRef]
- Grimaldi, A.M.; Simeone, E.; Festino, L.; Vanella, V.; Strudel, M.; Ascierto, P.A. MEK Inhibitors in the Treatment of Metastatic Melanoma and Solid Tumors. Am. J. Clin. Dermatol. 2017, 18, 745–754. [Google Scholar] [CrossRef]
- Sosman, J.A.; Kim, K.B.; Schuchter, L.; Gonzalez, R.; Pavlick, A.C.; Weber, J.S.; McArthur, G.A.; Hutson, T.E.; Moschos, S.J.; Flaherty, K.T.; et al. Survival in BRAF V600–Mutant Advanced Melanoma Treated with Vemurafenib. N. Engl. J. Med. 2012, 366, 707–714. [Google Scholar] [CrossRef]
- Luke, J.J.; Flaherty, K.T.; Ribas, A.; Long, G.V. Targeted agents and immunotherapies: Optimizing outcomes in melanoma. Nat. Rev. Clin. Oncol. 2017, 14, 463–482. [Google Scholar] [CrossRef]
- Eroglu, Z.; Ribas, A. Combination therapy with BRAF and MEK inhibitors for melanoma: Latest evidence and place in therapy. Ther. Adv. Med. Oncol. 2016, 8, 48–56. [Google Scholar] [CrossRef]
- Domingues, B.; Lopes, J.; Soares, P.; Populo, H. Melanoma treatment in review. ImmunoTargets Ther. 2018, 7, 35–49. [Google Scholar] [CrossRef]
- Yu, C.; Liu, X.; Yang, J.; Zhang, M.; Jin, H.; Ma, X.; Shi, H. Combination of Immunotherapy with Targeted Therapy: Theory and Practice in Metastatic Melanoma. Front. Immunol. 2019, 10, 990. [Google Scholar] [CrossRef] [PubMed]
- Wong, D.J.L.; Ribas, A. Targeted Therapy for Melanoma. Cancer Res. 2016, 79, 251–262. [Google Scholar]
- Gide, T.N.; Wilmott, J.S.; Scolyer, R.A.; Long, G.V. Primary and acquired resistance to immune checkpoint inhibitors in metastatic melanoma. Clin. Cancer Res. 2018, 24, 1260–1270. [Google Scholar] [CrossRef] [PubMed]
- Gouvinhas, I.; Carbas, B.; Sobreira, C.; Domínguez-Perles, R.; Gomes, S.; Rosa, E.A.S.; Barros, A.I.R.N.A. Critical Review on the Significance of Olive Phytochemicals in Plant Physiology and Human Health. Molecules 2017, 22, 1986. [Google Scholar] [CrossRef] [PubMed]
- Omar, S.H. Cardioprotective and neuroprotective roles of oleuropein in olive. Saudi Pharm. J. 2010, 18, 111–121. [Google Scholar] [CrossRef]
- Konstantinidou, V.; Covas, M.I.; Sola, R.; Fitó, M. Up-to date knowledge on the in vivo transcriptomic effect of the Mediterranean diet in humans. Mol. Nutr. Food Res. 2013, 57, 772–783. [Google Scholar] [CrossRef] [PubMed]
- Aung, T.N.; Qu, Z.; Kortschak, R.D.; Adelson, D.L. Understanding the effectiveness of natural compound mixtures in cancer through their molecular mode of action. Int. J. Mol. Sci. 2017, 18, 656. [Google Scholar] [CrossRef]
- D’Angelo, S.; Ingrosso, D.; Migliardi, V.; Sorrentino, A.; Donnarumma, G.; Baroni, A.; Masella, L.; Tufano, M.A.; Zappia, M.; Galletti, P. Hydroxytyrosol, a natural antioxidant from olive oil, prevents protein damage induced by long-wave ultraviolet radiation in melanoma cells. Free Radic. Biol. Med. 2005, 38, 908–919. [Google Scholar] [CrossRef]
- Bellenghi, M.; Puglisi, R.; Pedini, F.; De Feo, A.; Felicetti, F.; Bottero, L.; Sangaletti, S.; Errico, M.C.; Petrini, M.; Gesumundo, C.; et al. SCD5-induced oleic acid production reduces melanoma malignancy by intracellular retention of SPARC and cathepsin B. J. Pathol. 2015, 236, 315–325. [Google Scholar] [CrossRef]
- Yamada, H.; Hakozaki, M.; Uemura, A.; Yamashita, T. Effect of fatty acids on melanogenesis and tumor cell growth in melanoma cells. J. Lipid Res. 2019, 60, 1491–1502. [Google Scholar] [CrossRef]
- De La Torre, R.; Corella, D.; Castañer, O.; Martínez-González, M.A.; Pintó, X.; Vila, J.; Estruch, R.; Sorlí, J.V.; Arós, F.; Fiol, M.; et al. Protective effect of homovanillyl alcohol on cardiovascular disease and total mortality: Virgin olive oil, wine, and catechol-methylathion. Am. J. Clin. Nutr. 2017, 105, 1297–1304. [Google Scholar] [CrossRef] [PubMed]
- Rietjens, S.J.; Bast, A.; Haenen, G.R.M.M. New Insights into Controversies on the Antioxidant Potential of the Olive Oil Antioxidant Hydroxytyrosol. J. Agric. Food Chem. 2007, 55, 7609–7614. [Google Scholar] [CrossRef] [PubMed]
- Deiana, M.; Incani, A.; Rosa, A.; Corona, G.; Atzeri, A.; Loru, D.; Melis, M.P.; Dessì, M.A. Protective effect of hydroxytyrosol and its metabolite homovanillic alcohol on H2O2 induced lipid peroxidation in renal tubular epithelial cells. Food Chem. Toxicol. 2008, 46, 2984–2990. [Google Scholar] [CrossRef] [PubMed]
- Liotti, A.; Cosimato, V.; Mirra, P.; Calì, G.; Conza, D.; Secondo, A.; Luongo, G.; Terracciano, D.; Formisano, P.; Beguinot, F.; et al. Oleic acid promotes prostate cancer malignant phenotype via the G protein-coupled receptor FFA1/GPR40. J. Cell. Physiol. 2018, 233, 7367–7378. [Google Scholar] [CrossRef]
- Calahorra, J.; Martínez-Lara, E.; Granadino-Roldán, J.M.; Martí, J.M.; Cañuelo, A.; Blanco, S.; Oliver, F.J.; Siles, E. Crosstalk between hydroxytyrosol, a major olive oil phenol, and HIF-1 in MCF-7 breast cancer cells. Sci. Rep. 2020, 10, 6361. [Google Scholar] [CrossRef]
- Serreli, G.; Deiana, M. Biological relevance of extra virgin olive oil polyphenols metabolites. Antioxidants 2018, 7, 170. [Google Scholar] [CrossRef]
- Teubert, A.; Thome, J.; Büttner, A.; Richter, J.; Irmisch, G. Elevated oleic acid serum concentrations in patients suffering from alcohol dependence. J. Mol. Psychiatry 2013, 1, 13. [Google Scholar] [CrossRef]
- Nilsson, A.K.; Sjöbom, U.; Christenson, K.; Hellström, A. Lipid profiling of suction blister fluid: Comparison of lipids in interstitial fluid and plasma. Lipids Health Dis. 2019, 18, 164. [Google Scholar] [CrossRef]
- Abdelmagid, S.A.; Clarke, S.E.; Nielsen, D.E.; Badawi, A.; El-Sohemy, A.; Mutch, D.M.; Ma, D.W.L. Comprehensive Profiling of Plasma Fatty Acid Concentrations in Young Healthy Canadian Adults. PLoS ONE 2015, 10, e0116195. [Google Scholar] [CrossRef]
- Abildgaard, C.; Guldberg, P. Molecular drivers of cellular metabolic reprogramming in melanoma. Trends Mol. Med. 2015, 21, 164–171. [Google Scholar] [CrossRef]
- Meier, F.; Schittek, B.; Busch, S.; Garbe, C.; Smalley, K.; Satyamoorthy, K.; Li, G.; Herlyn, M. The RAS/RAF/MEK/ERK and PI3K/AKT signaling pathways present molecular targets for the effective treatment of advanced melanoma. Front. Biosci. 2005, 10, 2986–3001. [Google Scholar] [CrossRef] [PubMed]
- Papa, S.; Choy, P.M.; Bubici, C. The ERK and JNK pathways in the regulation of metabolic reprogramming. Oncogene 2019, 38, 2223–2240. [Google Scholar] [CrossRef] [PubMed]
- Imran, M.; Nadeem, M.; Gilani, S.A.; Khan, S.; Sajid, M.W.; Amir, R.M. Antitumor Perspectives of Oleuropein and Its Metabolite Hydroxytyrosol: Recent Updates. J. Food Sci. 2018, 83, 1781–1791. [Google Scholar] [CrossRef] [PubMed]
- Rigacci, S.; Stefani, M. Nutraceutical properties of olive oil polyphenols. An itinerary from cultured cells through animal models to humans. Int. J. Mol. Sci. 2016, 17, 843. [Google Scholar] [CrossRef]
- Han, J.; Talorete, T.P.N.; Yamada, P.; Isoda, H. Anti-proliferative and apoptotic effects of oleuropein and hydroxytyrosol on human breast cancer MCF-7 cells. Cytotechnology 2009, 59, 45–53. [Google Scholar] [CrossRef]
- Zubair, H.; Bhardwaj, A.; Ahmad, A.; Srivastava, S.K.; Khan, M.A.; Patel, G.K.; Singh, S.; Singh, A.P. Hydroxytyrosol Induces Apoptosis and Cell Cycle Arrest and Suppresses Multiple Oncogenic Signaling Pathways in Prostate Cancer Cells. Nutr. Cancer 2017, 69, 932–942. [Google Scholar] [CrossRef]
- Giard, D.J.; Aaronson, S.A.; Todaro, G.J.; Arnstein, P.; Kersey, J.H.; Parks, W.P. In vitro cultivation of human tumors: Establishment of cell lines derived from a series of solid tumors. J. Natl. Cancer Inst. 1973, 51, 1417–1423. [Google Scholar] [CrossRef] [PubMed]
- Cuomo, M.; Nicotra, M.R.; Apollonj, C.; Fraioli, R.; Giacomini, P.; Natali, P.G. Production and Characterization of the Murine Monoclonal Antibody 2G10 to a Human T4-Tyrosinase Epitope. J. Investig. Dermatol. 1991, 96, 446–451. [Google Scholar] [CrossRef]
- Fischer, G.M.; Gopal, Y.N.V.; Mcquade, J.L.; Peng, W.; Ralph, J.; Davies, M.A. Metabolic Strategies of Melanoma Cells: Mechanisms, Interactions with the Tumor Microenvironment, and Therapeutic Implications. Pigment Cell Melanoma Res. 2018, 31, 11–30. [Google Scholar] [CrossRef]
- Rodrigues, M.F.; Obre, E.; De Melo, F.H.; Santos, J.G.C.; Galina, A.; Jasiulionis, M.G.; Rossignol, R.; Rumjanek, F.D.; Amoedo, N.D. Enhanced OXPHOS, glutaminolysis and β-oxidation constitute the metastatic phenotype of melanoma cells. Biochem. J. 2016, 473, 703–715. [Google Scholar] [CrossRef]
- De Moura, M.B.; Vincent, G.; Fayewicz, S.L.; Bateman, N.W.; Hood, B.L.; Sun, M.; Suhan, J.; Duensing, S.; Yin, Y.; Sander, C.; et al. Mitochondrial Respiration—An Important Therapeutic Target in Melanoma. PLoS ONE 2012, 7, e40690. [Google Scholar]
- Brisson, L.; Bański, P.; Sboarina, M.; Dethier, C.; Danhier, P.; Fontenille, M.-J.; Van Hée, V.F.; Vazeille, T.; Tardy, M.; Falces, J.; et al. Lactate Dehydrogenase B Controls Lysosome Activity and Autophagy in Cancer. Cancer Cell 2016, 30, 418–431. [Google Scholar] [CrossRef] [PubMed]
- Draoui, N.; Feron, O. Lactate shuttles at a glance: From physiological paradigms to anti-cancer treatments. DMM Dis. Model. Mech. 2011, 4, 727–732. [Google Scholar] [CrossRef]
- Urbańska, K.; Orzechowski, A. Unappreciated role of LDHA and LDHB to control apoptosis and autophagy in tumor cells. Int. J. Mol. Sci. 2019, 20, 2085. [Google Scholar] [CrossRef]
- Doherty, J.R.; Cleveland, J.L.; Doherty, J.R.; Cleveland, J.L. Targeting lactate metabolism for cancer therapeutics. J. Clin. Investig. 2013, 123, 3685–3692. [Google Scholar] [CrossRef]
- Mishra, D.; Banerjee, D. Lactate Dehydrogenases as Metabolic Links between Tumor and Stroma in the Tumor Microenvironment. Cancers 2019, 11, 750. [Google Scholar] [CrossRef]
- Cluntun, A.A.; Lukey, M.J.; Cerione, R.A.; Locasale, J.W. Glutamine Metabolism in Cancer: Understanding the Heterogeneity. Trends Cancer 2017, 3, 169–180. [Google Scholar] [CrossRef]
- Yang, H.-C.; Wu, Y.-H.; Yen, W.-C.; Liu, H.-Y.; Hwang, T.-L.; Stern, A.; Chiu, D.T.-Y. The Redox Role of G6PD in Cell Growth, Cell Death, and Cancer. Cells 2019, 8, 1055. [Google Scholar] [CrossRef]
- Ratnikov, B.I.; Scott, D.A.; Osterman, A.L.; Smith, J.W.; Ronai, Z.A. Metabolic rewiring in melanoma. Oncogene 2017, 36, 147–157. [Google Scholar] [CrossRef]
- Marshall, A.D.; Van Geldermalsen, M.; Otte, N.J.; Lum, T.; Vellozzi, M.; Thoeng, A.; Pang, A.; Nagarajah, R.; Zhang, B.; Wang, Q.; et al. ASCT2 regulates glutamine uptake and cell growth in endometrial carcinoma. Oncogenesis 2017, 6, e367. [Google Scholar] [CrossRef]
- Koppula, P.; Zhang, Y.; Zhuang, L.; Gan, B. Amino acid transporter SLC7A11/xCT at the crossroads of regulating redox homeostasis and nutrient dependency of cancer. Cancer Commun. 2018, 38, 12. [Google Scholar] [CrossRef] [PubMed]
- Vinceti, M.; Malagoli, C.; Iacuzio, L.; Crespi, C.M.; Sieri, S.; Krogh, V.; Marmiroli, S.; Pellacani, G.; Venturelli, E. Serum Fatty Acids and Risk of Cutaneous Melanoma: A Population-Based Case-Control Study. Dermatol. Res. Pract. 2013, 2013, 659394. [Google Scholar] [CrossRef]
- Yang, P.; Su, C.; Luo, X.; Zeng, H.; Zhao, L.; Wei, L.; Zhang, X.; Varghese, Z.; Moorhead, J.F.; Chen, Y.; et al. Dietary oleic acid-induced CD36 promotes cervical cancer cell growth and metastasis via up-regulation Src/ERK pathway. Cancer Lett. 2018, 438, 76–85. [Google Scholar] [CrossRef] [PubMed]
- Haeiwa, H.; Fujita, T.; Saitoh, Y.; Miwa, N. Oleic acid promotes adaptability against oxidative stress in 3T3-L1 cells through lipohormesis. Mol. Cell Biochem. 2014, 386, 73–83. [Google Scholar] [CrossRef] [PubMed]
- Junttila, M.R.; Li, S.; Westermarck, J. Phosphatase-mediated crosstalk between MAPK signaling pathways in the regulation of cell survival. FASEB J. 2008, 22, 954–965. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]




| A375 Melanoma Cells | MNT1 Melanoma Cells | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Oleic Acid | Homovanillyl Alcohol | Hydroxytyrosol | Oleic Acid | Homovanillyl Alcohol | Hydroxytyrosol | |||||||
| Gene | 100 µM | 200 µM | 100 µM | 200 µM | 100 µM | 200 µM | 100 µM | 200 µM | 100 µM | 200 µM | 100 µM | 200 µM |
| SNAT1 | nss | nss | nss | nss | nss | p = 0.017 | Nss | nss | Nss | nss | nss | nss |
| SNAT2 | nss | nss | nss | nss | nss | nss | Nss | nss | Nss | nss | nss | nss |
| GLS1 | nss | nss | nss | nss | nss | nss | Nss | nss | Nss | nss | nss | nss |
| LDHA | nss | nss | nss | nss | nss | nss | p = 0.043 | nss | Nss | nss | p = 0.037 | p = 0.012 |
| LDHB | nss | nss | nss | nss | nss | nss | p = 0.039 | nss | nss | nss | nss | nss |
| LDHC | nss | nss | nss | nss | nss | nss | p = 0.042 | nss | nss | nss | nss | p = 0.042 |
| MCT1 | nss | nss | nss | nss | nss | nss | Nss | nss | nss | nss | nss | nss |
| MCT4 | nss | nss | nss | nss | nss | nss | Nss | nss | nss | nss | nss | nss |
| GLUL | nss | nss | nss | nss | nss | nss | Nss | nss | nss | nss | nss | nss |
| G6PD | nss | nss | nss | nss | nss | nss | Nss | nss | nss | nss | nss | nss |
| xCT | nss | nss | p = 0.047 | nss | nss | p = 0.009 | Nss | nss | nss | nss | nss | nss |
| EAAT3 | nss | nss | nss | nss | nss | p = 0.008 | Nss | nss | nss | nss | nss | nss |
| Gene | Primer Forward | Primer Reverse |
|---|---|---|
| SNAT1 | CATTCTATGACAACGTGCAGTCC | CAGCAACAATGACAGCCAGC |
| SNAT2 | CTGAGCAATGCGATTGTGGG | CTCCTTCATTGGCAGTCTTC |
| GLS1 | CTTCTACTTCCAGCTGTGCTC | CACCAGTAATTGGGCAGAAACC |
| GLUL | GAATGGTCTGAAGTACATCGAGG | GTTAGACGTCGGGCATTGTC |
| LDHA | CTTGCTCTTGTTGATGTCATC | CAGCCGTGATAATGACCAGC |
| LDHB | GAGCCTTCTCTCTCCTGTG | CTGATAGCACACGCCATACC |
| LDHC | GGATCTTCAGCATGGCAGTC | CTATTCTGGAGTTTGCAGATA |
| MCT1 | GCTGGGCAGTGGTAATTGGA | CAGTAATTGATTTGGGAAATGCAT |
| MCT4 | CACAAGTTCTCCAGTGC | CGCATCCAGGAGTTTGC |
| G6PD | GGCAACAGATACAAGAACGTGAAG | GCAGAAGACGTCCAGGATGAG |
| XCT | GGTCCTGTCACTATTTGGAGC | GAGGAGTTCCACCCAGACTC |
| EAAT3 | GTATCACGGCCACATCTGCC | GCAATGATCAGGGTGACATCC |
| TBP | GAGCTGTGATGTGAAGTTTCC | TCTGGGTTTGATCATTCTGTAG |
| HPRT1 | TGAGGATTTGGAAAGGGTGT | GAGCACACAGAGGGCTACAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Brito, C.; Tomás, A.; Silva, S.; Bronze, M.R.; Serra, A.T.; Pojo, M. The Impact of Olive Oil Compounds on the Metabolic Reprogramming of Cutaneous Melanoma Cell Models. Molecules 2021, 26, 289. https://doi.org/10.3390/molecules26020289
Brito C, Tomás A, Silva S, Bronze MR, Serra AT, Pojo M. The Impact of Olive Oil Compounds on the Metabolic Reprogramming of Cutaneous Melanoma Cell Models. Molecules. 2021; 26(2):289. https://doi.org/10.3390/molecules26020289
Chicago/Turabian StyleBrito, Cheila, Ana Tomás, Sandra Silva, Maria Rosário Bronze, Ana Teresa Serra, and Marta Pojo. 2021. "The Impact of Olive Oil Compounds on the Metabolic Reprogramming of Cutaneous Melanoma Cell Models" Molecules 26, no. 2: 289. https://doi.org/10.3390/molecules26020289
APA StyleBrito, C., Tomás, A., Silva, S., Bronze, M. R., Serra, A. T., & Pojo, M. (2021). The Impact of Olive Oil Compounds on the Metabolic Reprogramming of Cutaneous Melanoma Cell Models. Molecules, 26(2), 289. https://doi.org/10.3390/molecules26020289

