Identification, Characterization, and Epidemiological Analysis of Lactococcus garvieae Fish Isolates Obtained in a Period of Eighteen Years
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. L. garvieae Bacterial Isolates
2.3. DNA Extraction
2.4. Antimicrobial Susceptibility Testing
2.5. Polymerase-Chain Reaction (PCR)
2.6. Sequencing of 16S rDNA Gene and Capsular Gene
2.7. Epidemiological Typing by Random Amplification of Polymorphic DNA (RAPD Analysis)
2.8. Data Analysis
3. Results
3.1. Cultivation and Identification
3.2. Antimicrobial Susceptibility
3.3. Molecular-Genetic Methods
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Vendrell, D.; Balcazar, J.L.; Ruiz-Zarzuela, I.; de Blas, I.; Girones, O.; Muzquiz, J.L. Lactococcus garvieae in fish: A review. Comp. Immunol. Microbiol. Infect. Dis. 2006, 29, 177–198. [Google Scholar] [CrossRef] [PubMed]
- Soltani, M.; Baldisserotto, B.; Hosseini, S.P.; Shafiei, S.; Bashiri, M. Lactococcosis a Re-Emerging Disease in Aquaculture: Disease Significant and Phytotherapy. Vet. Sci. 2021, 8, 181. [Google Scholar] [CrossRef] [PubMed]
- Chan, Y.X.; Cao, H.; Jiang, S.; Li, X.; Fung, K.K.; Lee, C.H.; Sridhar, S.; Chen, J.H.K.; Ho, P.L. Genomic investigation of Lactococcus formosensis, Lactococcus garvieae, and Lactococcus petauri reveals differences in species distribution by human and animal sources. Microbiol. Spectr. 2024, 12, e0054124. [Google Scholar] [CrossRef] [PubMed]
- Kusuda, R. A new pathogenic bacterium belonging to the genus Streptococcus isolated from an epizootic of cultured yellowtail. Nippon Suisan Gakkai Shi 1976, 42, 1345–1352. [Google Scholar] [CrossRef]
- Collins, M.D.; Farrow, J.A.; Phillips, B.A.; Kandler, O. Streptococcus garvieae sp. nov. and Streptococcus plantarum sp. nov. Microbiology 1983, 129, 3427–3431. [Google Scholar] [CrossRef]
- Gibello, A.; Galán-Sánchez, F.; Blanco, M.M.; Rodríguez-Iglesias, M.; Domínguez, L.; Fernández-Garayzábal, J.F. The zoonotic potential of Lactococcus garvieae: An overview on microbiology, epidemiology, virulence factors and relationship with its presence in foods. Res. J. Vet. Sci. 2016, 109, 59–70. [Google Scholar] [CrossRef]
- Heckman, T.I.; Yazdi, Z.; Older, C.E.; Griffin, M.J.; Waldbieser, G.C.; Chow, A.M.; Medina Silva, I.; Anenson, K.M.; García, J.C.; LaFrentz, B.R.; et al. Redefining piscine lactococcosis. Appl. Environ. Microbiol. 2024, 90, e0234923. [Google Scholar] [CrossRef]
- Mahmoud, M.M.; Abdelsalam, M.; Kawato, S.; Harakawa, S.; Kawakami, H.; Hirono, I.; Kondo, H. Comparative genome analyses of three serotypes of Lactococcus bacteria isolated from diseased cultured striped jack (Pseudocaranx dentex). J. Fish. Dis. 2023, 46, 829–839. [Google Scholar] [CrossRef]
- Saticioglu, I.B.; Onuk, E.E.; Ay, H.; Ajmi, N.; Demirbas, E.; Altun, S. Phenotypic and molecular differentiation of Lactococcus garvieae and Lactococcus petauri isolated from trout. Aquaculture 2023, 577, 739933. [Google Scholar] [CrossRef]
- Stoppani, N.; Colussi, S.; Pastorino, P.; Prearo, M.; Sciuto, S.; Altinok, I.; Öztürk, R.Ç.; Ture, M.; Vela, A.I.; Blanco, M.D.M.; et al. 16S-23S rRNA Internal Transcribed Spacer Region (ITS) Sequencing: A Potential Molecular Diagnostic Tool for Differentiating Lactococcus garvieae and Lactococcus petauri. Microorganisms 2023, 11, 1320. [Google Scholar] [CrossRef]
- Duman, M.; Buyukekiz, A.G.; Saticioglu, I.B.; Cengiz, M.; Sahinturk, P.I.; Altun, S.O. Epidemiology, genotypic diversity, and antimicrobial resistance of Lactococcus garvieae in farmed rainbow trout (Oncorhynchus mykiss). Iran. J. Fish. Sci. 2020, 19, 1–8. [Google Scholar] [CrossRef]
- Radosavljević, V.; Radanović, O.; Zdravković, N.; Savić, B.; Stanković, M.; Zorić, J.M.; Veljović, L.; Nešić, K. The first outbreak of lactococcosis caused by Lactococcus garvieae in Serbia. AVM 2020, 13, 53–68. [Google Scholar] [CrossRef]
- Rao, S.; Pham, T.H.; Poudyal, S.; Cheng, L.W.; Nazareth, S.C.; Wang, P.C.; Chen, S.C. First report on genetic characterization, cell-surface properties and pathogenicity of Lactococcus garvieae, emerging pathogen isolated from cage-cultured cobia (Rachycentron canadum). Transbound. Emerg. Dis. 2022, 69, 1197–1211. [Google Scholar] [CrossRef] [PubMed]
- Evans, J.J.; Klesius, P.H.; Shoemaker, C.A. First isolation and characterization of Lactococcus garvieae from Brazilian Nile tilapia, Oreochromis niloticus (L.), and pintado, Pseudoplathystoma corruscans (Spix & Agassiz). J. Fish. Dis. 2009, 32, 943–951. [Google Scholar] [CrossRef] [PubMed]
- Nishiki, I.; Furukawa, M.; Matui, S.; Itami, T.; Nakai, T.; Yoshida, T. Epidemiological study on Lactococcus garvieae isolates from fish in Japan. Fish. Sci. 2011, 77, 367–373. [Google Scholar] [CrossRef]
- Sebastião, F.; Furlan, L.; Hashimoto, D.; Pilarski, F. Identification of Bacterial Fish Pathogens in Brazil by Direct Colony PCR and 16S rRNA Gene Sequencing. Adv. Microbiol. 2015, 5, 409–424. [Google Scholar] [CrossRef]
- Fukushima, H.C.; Leal, C.A.; Cavalcante, R.B.; Figueiredo, H.C.; Arijo, S.; Moriñigo, M.A.; Ishikawa, M.; Borra, R.C.; Ranzani-Paiva, M.J. Lactococcus garvieae outbreaks in Brazilian farms Lactococcosis in Pseudoplatystoma sp.—development of an autogenous vaccine as a control strategy. J. Fish. Dis. 2017, 40, 263–272. [Google Scholar] [CrossRef]
- Tavares, L.M.; de Jesus, L.C.L.; da Silva, T.F.; Barroso, F.A.L.; Batista, V.L.; Coelho-Rocha, N.D.; Azevedo, V.; Drumond, M.M.; Mancha-Agresti, P. Novel Strategies for Efficient Production and Delivery of Live Biotherapeutics and Biotechnological Uses of Lactococcus lactis: The Lactic Acid Bacterium Model. Front. Bioeng. Biotechnol. 2020, 8, 517166. [Google Scholar] [CrossRef]
- Karami, E.; Alishahi, M.; Molayemraftar, T.; Ghorbanpour, M.; Tabandeh, M.R.; Mohammadian, T. Study of pathogenicity and severity of Lactococcus garvieae isolated from rainbow trout (Oncorhynchus mykiss) farms in Kohkilooieh and Boyerahmad province. Fish. Aquat. Sci. 2019, 22, 21. [Google Scholar] [CrossRef]
- Bwalya, P.; Hang’ombe, B.M.; Gamil, A.A.; Munang’andu, H.M.; Evensen, Ø.; Mutoloki, S. A whole-cell Lactococcus garvieae autovaccine protects Nile tilapia against infection. PLoS ONE 2020, 15, e0230739. [Google Scholar] [CrossRef]
- Kawanishi, M.; Yoshida, T.; Kijima, M.; Yagyu, K.; Nakai, T.; Okada, S.; Endo, A.; Murakami, M.; Suzuki, S.; Morita, H. Characterization of Lactococcus garvieae isolated from radish and broccoli sprouts that exhibited a KG+ phenotype, lack of virulence and absence of a capsule. Lett. Appl. Microbiol. 2007, 44, 481–487. [Google Scholar] [CrossRef] [PubMed]
- Tejedor, J.L.; Vela, A.I.; Gibello, A.; Casamayor, A.; Domínguez, L.; Fernández-Garayzábal, J.F. A genetic comparison of pig, cow and trout isolates of Lactococcus garvieae by PFGE analysis. Lett. Appl. Microbiol. 2011, 53, 614–619. [Google Scholar] [CrossRef] [PubMed]
- Zuily, S.; Mami, Z.; Meune, C. Lactococcus garvieae endocarditis. Arch. Cardiovasc. Dis. 2011, 104, 138–139. [Google Scholar] [CrossRef]
- Ferrario, C.; Ricci, G.; Borgo, F.; Rollando, A.; Fortina, M.G. Genetic investigation within Lactococcus garvieae revealed two genomic lineages. FEMS Microbiol. Lett. 2012, 332, 153–161. [Google Scholar] [CrossRef] [PubMed]
- Tsai, M.A.; Wang, P.C.; Liaw, L.L.; Yoshida, T.; Chen, S.C. Comparison of genetic characteristics and pathogenicity of Lactococcus garvieae isolated from aquatic animals in Taiwan. Dis. Aquat. Org. 2012, 102, 43–51. [Google Scholar] [CrossRef]
- Sirakov, I.; Orozova, P.; Strateva, T.; Mitov, I. Lactococcus garvieae—zoonotic pathogen with commercial importance. Vet. Pract. 2021, 6, 26–33. [Google Scholar]
- Dimov, S.G. The Controversial Nature of Some Non-Starter Lactic Acid Bacteria Actively Participating in Cheese Ripening. BioTech 2023, 12, 63. [Google Scholar] [CrossRef]
- Elliot, J.A.; Collins, M.D.; Pigott, N.E.; Facklam, R.R. Differentiation of Lactococcus lactis and Lactococcus garvieae from humans by comparison of whole-cell protein patterns. J. Clin. Microbiol. 1991, 29, 2731–2734. [Google Scholar] [CrossRef]
- Fefer, J.J.; Ratzan, K.R.; Sharp, S.E.; Saiz, E. Lactococcus garvieae endocarditis: Report of a case and review of the literature. Diagn. Microb. Infect. Dis. 1998, 32, 127–130. [Google Scholar] [CrossRef]
- Chan, J.F.; Woo, P.C.; Teng, J.L.; Lau, S.K.; Leung, S.S.; Tam, F.C.; Yuen, K.Y. Primary infective spondylodiscitis caused by Lactococcus garvieae and a review of human L. garvieae infections. Infection 2011, 39, 259–264. [Google Scholar] [CrossRef]
- Russo, G.; Iannetta, M.; D’Abramo, A.; Mascellino, M.T.; Pantosti, A.; Erario, L.; Tebano, G.; Oliva, A.; D’Agostino, C.; Trinchieri, V.; et al. Lactococcus garvieae endocarditis in a patient with colonic diverticulosis: First case report in Italy and review of the literature. New Microbiol. 2012, 35, 495. [Google Scholar]
- Lin, Y.S.; Kweh, K.H.; Koh, T.H.; Lau, Q.C.; Rahman, N.B. Genomic analysis of Lactococcus garvieae isolates. Pathology 2020, 52, 700–707. [Google Scholar] [CrossRef] [PubMed]
- Colagrossi, L.; Costabile, V.; Scutari, R.; Agosta, M.; Onori, M.; Mancinelli, L.; Lucignano, B.; Onetti Muda, A.; Del Baldo, G.; Mastronuzzi, A.; et al. Evidence of pediatric sepsis caused by a drug resistant Lactococcus garvieae contaminated platelet concentrate. Emerg. Microbes Infect. 2022, 11, 1325–1334. [Google Scholar] [CrossRef] [PubMed]
- Kitagawa, I.; Ishikawa, N.; Ono, R. Infective endocarditis caused by Lactococcus garvieae: A case report and review of the literature. IDCases 2024, 36, e01941. [Google Scholar] [CrossRef]
- Rösch, R.M.; Buschmann, K.; Brendel, L.; Schwanz, T.; Vahl, C.F. Lactococcus garvieae Endocarditis in a Prosthetic Aortic Valve: A Case Report and Literature Review. J. Investig. Med. High Impact Case Rep. 2019, 7, 2324709619832052. [Google Scholar] [CrossRef]
- Cañas, V.H.; Ramirez, M.P.; Jiménez, F.B.; Martin, M.R.; Casas, C.M.; Arriaza, M.M.; Marí, J.N. Lactococcus garvieae endocarditis in a native valve identified by MALDI-TOF MS and PCR-based 16s rRNA in Spain: A case report. New Microbes New Infect. 2015, 5, 13–15. [Google Scholar] [CrossRef]
- Backes, Y.; Gruteke, P.; Branger, J. Lactococcus garvieae endocarditis. Ned. Tijdschr. Voor Geneeskd. 2015, 159, 8738. [Google Scholar]
- Sunnerhagen, T.; Hammarlund, P.; Rasmussen, M. A case of suspected infective endocarditis with Lactococcus garvieae: Lack of in vitro synergy between ampicillin and gentamicin. JMM Case Rep. 2015, 2, e000018. [Google Scholar] [CrossRef]
- Rasmussen, M.; Björk, J.; Werner, J.; Dolk, M.; Christensson, B. Lactococcus garvieae endocarditis presenting with subdural haematoma. BMC Cardiovasc. Disord. 2014, 1, 13–14. [Google Scholar] [CrossRef]
- Ortiz, C.; López, J.; del Amo, E.; Sevilla, T.; García, P.E.; San Román, J.A. Lactococcus garvieae infective endocarditis: Report of 2 cases and review of the literature. Rev. Esp. Cardiol. 2014, 67, 776–778. [Google Scholar] [CrossRef]
- Gönüllü, N.; Yenıdünya, G.; Çelık, S.; Güney, N.; Midilli, K.; Bavunoğlu, I.; Öngen, Z. Lactococcus garvieae endokarditi turkiye klinikleri. J. Med. Sci. 2012, 32, 588. [Google Scholar]
- Tessier, S.; Emengo, I.; Yoder, N.; Longo, S.; Ido, F. Massive empyema due to Lactococcus garvieae. Germs 2022, 12, 414. [Google Scholar] [CrossRef] [PubMed]
- Rawling, R.A.; Granato, P.A. Lactococcus garvieae native valve endocarditis. Clin. Microbiol. Newsl. 2014, 36, 182–183. [Google Scholar] [CrossRef]
- Sharngoe, C.; Fazili, T.; Javaid, W.; Endy, T.; Polhemus, M. 923 Lactococcus garvieae infective endocarditis requiring valve replacement: First case in the United States. InOpen Forum Infect. Dis. 2014, 1, S267. [Google Scholar] [CrossRef]
- Navas, M.E.; Hall, G.; El Bejjani, D. A case of endocarditis caused by Lactococcus garvieae and suggested methods for identification. J. Clin. Microbiol. 2013, 51, 1990–1992. [Google Scholar] [CrossRef]
- Hirakawa, T.F.; Costa, F.A.; Vilela, M.C.; Rigon, M.; Abensur, H.; Araújo, M.R. Lactococcus garvieae endocarditis: First case report in Latin America. Arq. Bras. Cardiol. 2011, 97, 108–110. [Google Scholar] [CrossRef]
- Park, S.H.; Lee, Y.H.; Yeo, M.H.; Chang, K.S. First case of urinary tract infection by Lactococcus garvieae in Korea. Korean J. Clin. Lab. Sci. 2021, 53, 277–283. [Google Scholar] [CrossRef]
- Tariq, E.F.; Irshad, Y.; Khalil, H.B.; Khakwani, A.S.; Khan, U.A. Urinary tract infection caused by the novel pathogen, Lactococcus garvieae: A case report. Cureus 2020, 12, e9462. [Google Scholar] [CrossRef]
- Watanabe, Y.; Naito, T.; Kikuchi, K.; Amari, Y.; Uehara, Y.; Isonuma, H.; Hisaoka, T.; Yoshida, T.; Yaginuma, K.; Takaya, N.; et al. Infective endocarditis with Lactococcus garvieae in Japan: A case report. J. Med. Case Rep. 2011, 5, 356. [Google Scholar] [CrossRef]
- Wang, C.Y.; Shie, H.S.; Chen, S.C.; Huang, J.P.; Hsieh, I.C.; Wen, M.S.; Lin, F.C.; Wu, D. Lactococcus garvieae infections in humans: Possible association with aquaculture outbreaks. Int. J. Clin. Pract. 2007, 61, 68–73. [Google Scholar] [CrossRef]
- Mitra, N.; Kumar, P. Lactococcus garvieae: An emerging pathogen. Indian. Pediatr. 2015, 52, 814. [Google Scholar] [PubMed]
- Jo, W.; Bae, I.G.; Kim, B.R. A case of Lactococcus garviaea bacteremia in patient with infectious colitis after the ingestion of ascidians. Korean J. Intern. Med. 2014, 29, 376. [Google Scholar]
- Aguado-Urda, M.; López-Campos, G.H.; Blanco, M.M.; Fernández-Garayzábal, J.F.; Cutuli, M.T.; Aspiroz, C.; López-Alonso, V.; Gibello, A. Genome sequence of Lactococcus garvieae 21881, isolated in a case of human septicemia. J. Bacteriol. 2011, 193, 4033–4034. [Google Scholar] [CrossRef] [PubMed]
- Aspiroz, C.; Saez-Nieto, J.A.; Ruiz-Zarzuela, I.; Vela, A.I. Bacteriemia por Lactococcus garvieae y Citrobacter freundii. Casos De Microbiolgía Clínica Caso 2007, 387. Available online: http://www.f-soria.es/admfsoria/casos/img/387.pdf (accessed on 10 October 2019).
- Yiu, K.H.; Siu, C.W.; To, K.K.; Jim, M.H.; Lee, K.L.; Lau, C.P.; Tse, H.F. A rare cause of infective endocarditis; Lactococcus garvieae. Int. J. Cardiol. 2007, 114, 286–287. [Google Scholar] [CrossRef]
- Mofredj, A.; Baraka, D.; Cadranel, J.F.; LeMaitre, P.; Kloeti, G.; Dumont, J.L. Lactococcus garvieae septicemia with liver abscess in an immunosuppressed patient. Am. J. Med. 2000, 109, 513–514. [Google Scholar] [CrossRef]
- Nadrah, K. “Lactococcus garvieae septicaemia in a patient with artificial heart valves”. Wien. Klin. Wochenschr. 2011, 123, 677–679. [Google Scholar] [CrossRef]
- Chao, C.T.; Lai, C.F.; Huang, J.W. Lactococcus garvieae peritoneal dialysis peritonitis. Perit. Dial. Int. 2013, 33, 100–101. [Google Scholar] [CrossRef]
- Lahlou, W.; Bourial, A.; Maaouni, T.; Bensaad, A.; Bensahi, I.; Sabry, M.; Miguil, M. Lactococcus lactis endocarditis and liver abscess in an immunocompetent patient: A case report and review of the literature. J. Med. Case Rep. 2023, 17, 115. [Google Scholar] [CrossRef]
- Tandel, K.; Bhatt, P.; Ranjan, P.; Rathi, K.R. Meningitis caused by Lactococcus garvieae. Med. J. Armed Forces India 2017, 73, 94–96. [Google Scholar] [CrossRef]
- Mayo-Yáñez, M.; González-Torres, L. Recurrent Penicillin-Resistant Tonsillitis Due to Lactococcus garvieae, a New Zoonosis from Aquaculture. Zoonotic Dis. 2023, 3, 1–5. [Google Scholar] [CrossRef]
- James, P.R.; Hardman, S.M.; Patterson, D.L. Osteomyelitis and possible endocarditis secondary to Lactococcus garvieae: A first case report. Postgrad. Med. J. 2000, 76, 301–303. [Google Scholar] [CrossRef] [PubMed]
- Woolery, W. Acute lower urinary tract infection caused by Lactococcus garvieae. Now Seek. “Clin. Images” 2015, 33, 33. [Google Scholar]
- Dylewski, J. Urinary tract sepsis caused by Lactococcus garvieae. Clin. Microbiol. Newsl. 2014, 36, 30–31. [Google Scholar] [CrossRef]
- Reguera-Brito, M.; Galán-Sánchez, F.; Blanco, M.M.; Rodríguez-Iglesias, M.; Domínguez, L.; Fernández-Garayzábal, J.F.; Gibello, A. Genetic analysis of human clinical isolates of Lactococcus garvieae: Relatedness with isolates from foods. Infect. Genet. Evol. 2016, 37, 185–191. [Google Scholar] [CrossRef]
- European Committee on Antimicrobial Susceptibility Testing (EUCAST). Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 14.0. 2024. Available online: http://www.eucast.org (accessed on 10 October 2019).
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 30th ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020. [Google Scholar]
- Zlotkin, A.; Eldar, A.; Ghittino, C.; Bercovier, H. Identification of Lactococcus garvieae by PCR. J. Clin. Microbiol. 1998, 36, 983–985. [Google Scholar] [CrossRef]
- Dang, H.T.; Park, H.K.; Myung, S.C.; Kim, W. Development of a novel PCR assay based on the 16S-23S rRNA internal transcribed spacer region for the detection of Lactococcus garvieae. J. Fish. Dis. 2012, 35, 481–487. [Google Scholar] [CrossRef]
- Lane, D.J. 16S/23S rRNA sequencing. In Nucleic Acid Techniques in Bacterial Systematics; Stackebrandt, E., Goodfellow, M., Eds.; Wiley: New York, NY, USA, 1991; pp. 115–175. [Google Scholar]
- Miyauchi, E.; Toh, H.; Nakano, A.; Tanabe, S.; Morita, H. Comparative genomic analysis of Lactococcus garvieae strains isolated from different sources reveals candidate virulence genes. Int. J. Microbiol. 2012, 2012, 728276. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef]
- Jayamohan, N.S.; Manohar, S.H.; Kumudini, B.S. Genomic and outer membrane protein diversity fingerprints of siderophore producing fluorescent Pseudomonas spp. using RAPD, Rep-PCR and SDS-PAGE profiling. Biologia 2015, 70, 1150–1158. [Google Scholar] [CrossRef]
- Ravelo, C.; Magarinos, B.; López-Romalde, S.; Toranzo, A.E.; Romalde, J.L. Molecular fingerprinting of fish-pathogenic Lactococcus garvieae strains by random amplified polymorphic DNA analysis. J. Clin. Microbiol. 2003, 41, 751–756. [Google Scholar] [CrossRef] [PubMed]
- Hermans, K.; Haesebrouck, F.; Vaneechoutte, M.; Devriese, L.A.; Godard, C.; De Herdt, P. Differentiation between high and low virulence Staphylococcus aureus strains from rabbits by randomly amplified polymorphic DNA (RAPD) analysis. Vet. Microbiol. 2000, 72, 311–319. [Google Scholar] [CrossRef] [PubMed]
- Jaccard, P. Distribution de la flore alpine dans le Bassin des Drouces et dans quelques regions voisines. Bull. Soc. Vaudoise Sci. Nat. 1901, 37, 241–272. [Google Scholar]
- Kimura, M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef]
- Altan, E.; Korun, J. Lactococcus garvieae isolates from rainbow trout (Oncorhynchus mykiss, W.) compared by PLG and SA1B10 PCR primer pairs. J. Ilm. PLATAX 2021, 9, 18–28. [Google Scholar] [CrossRef]
- Akayli, T.; Çanak, Ö.; Yardimci, R.; Çiğdem, Ü.R.; Ökmen, D. A mixed Frigoribacterium faeni and Lactococcus garvieae Infection in cultured Rainbow Trout (O. mykiss). KSU J. Agric. Nat. 2020, 23, 1569–1577. [Google Scholar] [CrossRef]
- Teixeira, L.M.; Merquior, V.L.C.; Vianni, M.D.C.E.; Carvalho, M.D.G.S.; Fracalanzza, S.E.; Steigerwalt, A.G.; Brenner, D.J.; Facklam, R.R. Phenotypic and genotypic characterization of atypical Lactococcus garvieae strains isolated from water buffalos with subclinical mastitis and confirmation of L. garvieae as a senior subjective synonym of Enterococcus seriolicida. Int. J. Syst. Bacteriol. 1996, 46, 664–668. [Google Scholar] [CrossRef]
- Barnes, A.C.; Ellis, A.E. Role of capsule in serotypic differences and complement fixation by Lactococcus garvieae. Fish. Shell Immunol. 2004, 16, 207–214. [Google Scholar] [CrossRef]
- Kanai, K.; Honma, T.; Souda, A.; Shutou, K.; Sugihara, Y. Variation in the Integration Site for Capsule Gene Cluster in the Genome among Strains of Lactococcus garvieae. Fish Pathol. 2018, 53, 19–28. [Google Scholar] [CrossRef]
- Kitao, T. The methods for detection of Streptococcus sp., causative bacteria of streptococcal disease of cultured yellowtail (Seriola quinqueradiata) especially, their cultural, biochemical and serological properties. Fish Pathol. 1982, 17, 17–26. [Google Scholar] [CrossRef]
- Sirakov, I.N. Nucleic acid isolation and downstream applications. In Nucleic Acids—From Basic Aspects to Laboratory Tools, 1st ed.; Larramendy, M.L., Soloneski, S., Eds.; IntechOpen Limited: London, UK, 2016; Volume 10, pp. 1–26. [Google Scholar] [CrossRef]
- TanakaN, N.M.; Okada, S. 16S rRNA gene sequences of NRIC Lactic Acid Bacteria strains. Published Only in Database. 2007. Available online: https://www.ncbi.nlm.nih.gov/nuccore/AB362686 (accessed on 10 February 2020).
- Meyburgh, C.M.; Bragg, R.R.; Boucher, C.E. Detection of virulence factors of South African Lactococcus garvieae isolated from rainbow trout, Oncorhynchus mykiss (Walbaum). Onderstepoort J. Vet. Res. 2018, 85, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Francés-Cuesta, C.; Ansari, I.; Fernández-Garayzábal, J.F.; Gibello, A.; González-Candelas, F. Comparative genomics and evolutionary analysis of Lactococcus garvieae isolated from human endocarditis. Microb. Genom. 2022, 8, 000771. [Google Scholar] [CrossRef] [PubMed]
Laboratory No./NCBI Number 16S rDNA | Year of Collection | Origin | Species |
---|---|---|---|
331/8066/MT568646 | 2002 | Belgium/reference strain | L. garvieae |
322 | 2002 | Dospat town/RTF | L. garvieae |
329 | 2002 | Dospat town/RTF | L. garvieae |
379 | 2006 | Dospat town/RTF | L. garvieae |
a386 | 2006 | Dospat town/RTF | L. garvieae |
397 | 2008 | Dospat town/RTF | L. garvieae |
400 | 2008 | Dospat town/RTF | L. garvieae |
412/MT568658 | 2010 | Greece/RTF | L. garvieae |
415 | 2010 | Greece/RTF | L. garvieae |
417 | 2013 | Dospat town/RTF | L. garvieae |
418 | 2013 | Dospat town/RTF | L. garvieae |
443 MT568659 | 2016 | Bulgaria/AS | L. garvieae |
444 | 2016 | Bulgaria/AS | L. garvieae |
456 | 2017 | Dospat town/RTF | L. garvieae |
459 | 2017 | Dospat town/RTF | L. garvieae |
465 | 2017 | Sofia city/from store/RTF | L. garvieae |
466 | 2017 | Sofia city/from store/RTF | L. garvieae |
467/MT568660 | 2019 | Pirdop town/RTF | L. garvieae |
468 | 2019 | Pirdop town/RTF | L. garvieae |
469 | 2019 | Pirdop town/RTF | L. garvieae |
470 | 2019 | Pirdop town/RTF | L. garvieae |
471 | 2019 | Pirdop town/RTF | L. garvieae |
472/MT568662 | 2019 | Pirdop town | L. lactis |
473 | Serbia/control | L. garvieae | |
474 | Serbia/control | L. garvieae | |
330 | 2019 | Sofia city | Str. iniae |
332 | 2018 | Sofia city | Ent. faecalis |
Primer Sequence (5′→3′) | Product Size (bp) | Annealing Temperature (°C) | Reference | |
---|---|---|---|---|
pLG-1 pLG-2 | CATAACAATGAGAATCGC GCACCCTCGCGGGTTG | 60.8 * | [68] | |
LG_IBS_F(132) LG_IBS_R(132) | ACAGAGCATGGGACGACCTA CTGCTTCTTGAGAGACGCCA | 54 | [9] | |
LP_IBS_F(583) LG_IBS_R(583) | ATTGGCTTAGGGGTTTGGGG AGTCCGAAATACGTTCCCGG | 54 | [9] | |
ITS 30F(290) ITS 319R(290) | ACTTTATTCAGTTTTGAGGGGTCT TTTAAAAGAATTCGCAGCTTTACA | 54 | [69] | |
27F 1492R | AGAGTTTGATCCTGGCTCAG TACGGYTACCTTGTTACGACTT | 56 | [70] | |
Lg2F Lg2R | TGCTGTCATCATATTGTGTCCA GGCTATGGCATTAGTCAGGAAG | 55 | [71] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sirakov, I.; Strateva, T.V.; Boyanov, V.S.; Orozova, P.; Yordanov, D.; Rusenova, N.; Gergova, R.; Dimov, S.G.; Sirakova, B.; Radosavljević, V.; et al. Identification, Characterization, and Epidemiological Analysis of Lactococcus garvieae Fish Isolates Obtained in a Period of Eighteen Years. Microorganisms 2025, 13, 436. https://doi.org/10.3390/microorganisms13020436
Sirakov I, Strateva TV, Boyanov VS, Orozova P, Yordanov D, Rusenova N, Gergova R, Dimov SG, Sirakova B, Radosavljević V, et al. Identification, Characterization, and Epidemiological Analysis of Lactococcus garvieae Fish Isolates Obtained in a Period of Eighteen Years. Microorganisms. 2025; 13(2):436. https://doi.org/10.3390/microorganisms13020436
Chicago/Turabian StyleSirakov, Ivo, Tanya V. Strateva, Vasil Svetoslavov Boyanov, Petya Orozova, Daniel Yordanov, Nikolina Rusenova, Raina Gergova, Svetoslav G. Dimov, Bilyana Sirakova, Vladimir Radosavljević, and et al. 2025. "Identification, Characterization, and Epidemiological Analysis of Lactococcus garvieae Fish Isolates Obtained in a Period of Eighteen Years" Microorganisms 13, no. 2: 436. https://doi.org/10.3390/microorganisms13020436
APA StyleSirakov, I., Strateva, T. V., Boyanov, V. S., Orozova, P., Yordanov, D., Rusenova, N., Gergova, R., Dimov, S. G., Sirakova, B., Radosavljević, V., Boyanova, L., & Mitov, I. (2025). Identification, Characterization, and Epidemiological Analysis of Lactococcus garvieae Fish Isolates Obtained in a Period of Eighteen Years. Microorganisms, 13(2), 436. https://doi.org/10.3390/microorganisms13020436