Next Article in Journal
Microbial Diversity and Community Structure of Wastewater-Driven Microalgal Biofilms
Previous Article in Journal
Antimicrobial Resistance Profiles of Enterococcus faecium and Enterococcus faecalis Isolated from Healthy Dogs and Cats in South Korea
Previous Article in Special Issue
Probiotic Properties and Safety Evaluation of Lactobacillus plantarum HY7718 with Superior Storage Stability Isolated from Fermented Squid
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Enterotoxigenic and Antimicrobic Susceptibility Profile of Staphylococcus aureus Isolates from Fresh Cheese in Croatia

by
Ivana Ljevaković-Musladin
1,*,
Lidija Kozačinski
2,
Marija Krilanović
3,
Marina Vodnica Martucci
3,
Mato Lakić
1,
Luca Grispoldi
4 and
Beniamino T. Cenci-Goga
4
1
Environmental Health Department, Public Health Institute of Dubrovnik-Neretva County, Dr. A. Šercera 4A, HR-20000 Dubrovnik, Croatia
2
Department of Hygiene, Technology and Food Safety, Faculty of Veterinary Medicine University of Zagreb, Heinzelova 55, HR-10000 Zagreb, Croatia
3
Microbiology Department, Public Health Institute of Dubrovnik-Neretva County, Dr. A. Šercera 2C, HR-20000 Dubrovnik, Croatia
4
Laboratorio di Ispezione Degli Alimenti di Origine Animale, Department of Veterinary Medicine, University of Perugia, 06126 Perugia, Italy
*
Author to whom correspondence should be addressed.
Microorganisms 2023, 11(12), 2993; https://doi.org/10.3390/microorganisms11122993
Submission received: 6 November 2023 / Revised: 9 December 2023 / Accepted: 12 December 2023 / Published: 15 December 2023
(This article belongs to the Special Issue Microorganisms and Fermented Foods 2.0)

Abstract

Certain Staphylococcus aureus strains harbour staphylococcal enterotoxin genes and hence can produce enterotoxin during their growth in food. Therefore, food can be a source of staphylococcal food poisoning, one of the most common food-borne diseases worldwide. Epidemiological data show that S. aureus is often present in raw milk cheeses, and consequently, cheeses are often the source of staphylococcal food poisoning outbreaks. The aim of this study was to determine the phenotypic characteristics of S. aureus isolates from fresh cheese, including antibiotic susceptibility; the presence of classical sea-see enterotoxin genes through molecular methods; and the isolate’s ability to produce SEA-SEE enterotoxins in vitro through reversed passive latex agglutination. A total of 180 coagulase-positive staphylococci were isolated from 18 out of 30 cheese samples, and 175 were confirmed as S. aureus through latex agglutination and API STAPH tests. All isolates possessed phenotypic characteristics typical for S. aureus, with certain variations in the egg yolk reaction (18.3% of the isolates showed a weak reaction and 28% no reaction at all) and haemolysis pattern (36.6% of the isolates produced double-haemolysis and 4.6% were non-haemolytic). Antibiotic resistance was observed in 1.1% of the isolates and to mupirocin only. Real-time PCR detected the sec gene in 34 (19.4%) isolates, but most isolates (80.6%) were not enterotoxigenic. For all 34 (19.4%) strains that carried the sec gene, the RPLA method detected the production of the SEC enterotoxin in vitro. For those enterotoxigenic strains, the possibility of enterotoxin production in fresh cheese could not be ruled out.

1. Introduction

Staphylococcal food poisoning (SFP) is one of the most common food-borne diseases worldwide. The causative agents are enterotoxins produced by enterotoxigenic strains of S. aureus during its growth in favourable conditions in food. The most commonly reported foods involved in SFP outbreaks in the EU are mixed foods (29.7%), meat and meat products (20.8%), cheese and dairy products (14.4%), bakery products (8.4%), and fish and fish products (6.5%) [1,2]. According to De Buyser et al. [3], S. aureus is the main pathogen associated with raw milk cheeses. Delmas et al. [4] claim that S. aureus is the foremost causative agent of food poisoning from milk and dairy products. A meta-analysis conducted by Gajewska et al. [5] on studies during the years 2011–2021 reported that S. aureus was isolated from 29.07% of the milk samples and 42.81% of the cheese samples. The authors concluded that, despite food safety criteria for S. aureus that exist worldwide, the prevalence of this pathogen in raw milk and raw milk cheeses is very high. Mastitic cows are considered the most important source of milk contamination by enterotoxin-producing S. aureus strains [6,7,8]. Staphylococcal enterotoxins (SEs) are a superfamily of 29 exotoxins and are one of the major S. aureus virulence factors. The SE family is divided into two groups: classical and newer enterotoxins. At present, 29 kinds of enterotoxins have been found, which can be divided into classic enterotoxins (including SEA-SEE), non-classical enterotoxins (such as SEG, SEH, etc.), and enterotoxin-like (such as SElW, SElX, etc.) [9].
These multifunctional proteins share the same structural and functional properties, as well as the same superantigen activity [10]. Classical SEs were first described back in 1960 due to their emetic activity and implications in food poisoning outbreaks [11]. The role of newer SEs in staphylococcal food poisoning has yet to be proven. Epidemiological data show that SEA is the most frequently found SE in SFP outbreaks, followed by SED, SEB, and SEC, while SEE is the rarest [11,12,13]. Genotyping studies of S. aureus isolates from food implicated in staphylococcal food poisoning also confirm the prevalence of sea, sed, and seb genes [14,15,16,17,18,19].
Many studies have shown that S. aureus isolates from cheese carry one or more SE genes [20,21,22,23,24]. Published data show remarkable variability in the frequency and diversity of the prevalence of enterotoxin genes worldwide. Earlier studies showed the prevalence of sec, sea, and sed genes in S. aureus isolates [14,15,16,17,18,20,21,22,23,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41]. Recent studies showed a high frequency of newer enterotoxins [15,20,21,22,23,42,43,44,45]. The most recent systematic review and meta-analysis on the prevalence, antibiotic resistance, and enterotoxin genes of S. aureus isolated from milk and dairy products worldwide, conducted by Zhang et al. [46], reported that the pooled rate of classical staphylococcal enterotoxins was 39.31% (95% CI: 25.99–53.44%), and the highest rates were found for sec (16.27%; 95% CI: 10.32%–23.15%) and sea (9.11%; 95% CI: 3.81%–16.39%) genes.
S. aureus represents a serious hazard for the end consumer, as it is able to produce enterotoxins, which are stable at high temperatures (e.g., crude enterotoxin A remains active at 100 °C for 2 h in broth and at 121 °C for 28 min in mushrooms) and are also resistant to many environmental conditions (low pH, freezing, drying), which S. aureus strains do not survive. They are also resistant to human proteolytic enzymes and retain their activity in the digestive tract after ingestion [47]. The amount of enterotoxin required to cause illness in susceptible subjects can be as little as 20–100 ng [48]. A fraction of the strains of S. aureus are also able to persist in factory environments by forming biofilm [49].
A previous study conducted by Ljevaković-Musladin et al. [50] showed that home-made cheeses from the markets of the city of Dubrovnik had a high frequency and high level of contamination with S. aureus, indicating the need for further investigation of the enterotoxigenicity of isolates and assessment of the real risk of staphylococcal poisoning.
Since there are no data on the nature of S. aureus isolated from cheese produced in Croatia, the aim of this study is to determine (i) the phenotypic characteristics of isolates, including their antibiotic susceptibility; (ii) the presence of classical sea-see enterotoxin genes through molecular methods; and (iii) the ability of isolates to produce SEA-SEE enterotoxins in vitro, as detected through reversed passive latex agglutination (RPLA).

2. Materials and Methods

Cheese samples. A total of 30 fresh cheese samples produced by small-scale plants (26 bovine, 2 caprine, and 2 bovine/caprine) were collected from the Dubrovnik city markets during 2018 and 2019. For each sampling day, cheeses were randomly chosen from the plant database: all cheese numbers were printed, cut out, and then randomly drawn from a hat.
Microbiological analyses of cheeses. All cheese samples were analysed according to HRN EN ISO 6888-1:2004 [51] using Baird-Parker agar for the enumeration of coagulase-positive staphylococci. Ten grams of cheese was homogenised with 90 mL of Buffered Peptone Water (Oxoid, Basingstoke, UK) in a Smasher® blender (bioMerieux, Marcy-l’Etoile, France). Then, 0.1 mL of ten-fold dilutions was inoculated in duplicate on Baird-Parker agar (Oxoid, Basingstoke, UK) and incubated at 37 ± 1 °C for 24–48 h. After incubation, all typical and atypical colonies were counted and tested, using a coagulase test for the confirmation of coagulase-positive staphylococci. Ten colonies of coagulase-positive staphylococci per cheese sample were used in further examinations.
Bacterial strains. A total of 180 coagulase-positive staphylococci were collected from 18 fresh cheese samples; 175 isolates were confirmed as S. aureus. Colonies were identified as S. aureus based on the coagulase test (Bactident® Coagulase plasma EDTA, Merck, Darmstadt, Germany) and a latex agglutination test for the detection of fibrinogen affinity antigens, protein A, and capsular polysaccharides (PastorexTM Staph Plus test, Bio-Rad, Marnes-la-Coquette, France). All S. aureus isolates were tested for enterotoxin production and antibiotic susceptibility and their phenotypic characteristics were determined.
Determination of phenotypic characteristics. Methods used included Dnase (Dnase agar, Oxoid, Basingstoke, UK) and catalase tests, Gram staining, a haemolysis test (blood agar base No. 2 with defibrinated sheep blood, Oxoid, Basingstoke, UK), an “egg yolk” reaction on Baird-Parker agar (Oxoid, with Egg Yolk Tellurite Emulsion supplement, Oxoid, Basingstoke, UK), and biochemical identification using API STAPH (bioMerieux, Marcy-l’Etoile, France) according to manufacturer’s instructions.
Antimicrobic susceptibility testing. Antibiotic sensitivity was determined according to the EUCAST disk diffusion method [52] on Mueller–Hinton agar (Oxoid, Basingstoke, UK). The following antibiotic-impregnated disks were tested: azithromycin (15 µg), cefoxitin (30 µg), clindamycin (2 µg), erythromycin (15 µg), gentamicin (10 µg), moxifloxacin (5 µg), mupirocin (5 µg), oxacillin (5 µg), and trimethoprim-sulphamethoxazole (1.25/23.75 µg) (all Biorad, Marnes-la-Coquette, France). The interpretation of the results was conducted according to the European Committee on Antimicrobial Susceptibility Testing manual [52] and breakpoint tables for the interpretation of MICs and zone diameters, Version 13.1. [53].
Hierarchical cluster analysis. A hierarchical cluster analysis (HCA), a method of clustering to create a hierarchical tree or dendrogram, of the isolates was performed. This tree is a representation of the relationships between the objects, and it shows how the objects are grouped together into clusters at different levels of granularity. A Euclidean complete linkage hierarchical cluster analysis was conducted with the DataTab statistics calculator (DATAtab: DATAtab Team (2023). DATAtab: Online Statistics Calculator. DATAtab e.U. Graz, Austria. URL https://datatab.net accessed on 18 October 2023) which included, as metric variables, all data from the antimicrobic susceptibility testing and from the phenotypic identification. A dendrogram of all isolates was split into clusters.
Detection of enterotoxin production in vitro. All S. aureus isolates were examined for the production of SEA-SED enterotoxins. The overnight (37 °C/18–24 h) brain–heart infusion broth (Oxoid, Basingstoke, UK) cultures of well-isolated colonies from the Baird-Parker agar were examined using reversed passive latex agglutination RPLA (SET-RPLA, Thermo ScientificTM OxoidTM, Basingstoke, UK) methods, according to manufacturers’ instructions.
DNA isolation. Genomic DNA of each S. aureus isolate was extracted from one well-isolated colony on Baird-Parker agar in 100 µL of InstaGeneTM Matrix reagent (Bio-Rad, Marnes-la-Coquette, France) (1 colony in 100 µL of reagent). The suspension was vortexed for 15–20 sec and incubated in a dry incubator at 56 °C/60 min. After incubation, it was vortexed again for 15–20 sec and incubated for a second time at 95 °C/45 min. The final suspension was then vortexed for 15–20 min followed by centrifugation for 5 min at 13,200 rpm.
Detection of SEA-SEE genes. Since gene detection was performed using a modified real-time PCR method, classical PCR was used as a confirmatory method.
Real-time PCR. The real-time PCR method was a modified method described by Nakayama et al. [54] for the detection of sea-see genes. Primers (Invitrogen by Thermo Fisher Scientific, SAD) and probes (Applied Biosystems, Leicestershire, UK) are listed in Table 1. DNA amplification was conducted in a 20 μL reaction volume containing 2 μL DNA template and 18 μL reagent mix (10 μL of Luminaris Probe qPCR Master Mix (Thermo Scientific Baltics, Vilnius, Lithuania), 0.6 μL of each primer, 0.4 μL of MGB probe, and 6.4 μL of nuclease-free water). The real-time PCR reactions were carried out separately for each gene in a PikoReal 24 thermocycler (Thermo Fisher Scientific, Vantaa, Finland) under the following conditions: UDG pre-treatment at 50 °C/2 min and initial denaturation at 95 °C/10 min, followed by PCR amplification for 40 cycles at 95 °C/15 sec and 60 °C/60 sec.
Classical PCR. DNA amplification was conducted on a volume of 25 μL comprising 12.5 μL of RED Taq (10 mM of Tris HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.001% of gelatine, and 0.2 mM of each deoxyribonucleoside triphosphate), 0.5 µL (1 µM) of each primer, 5 μL of extracted DNA, and 6.5 μL of H2O. The presence of the sea, seb, sec, sed, and see genes was investigated. The primers and the amplification conditions used are given in Table 1. The PCR reaction was carried out in a Thermocycler Gene Amp, PCR System, 9700 Gold (Applied Biosystem, Foster City, CA, USA). The amplifications were analysed using an electrophoretic run on 1.5% agarose gel containing ethidium bromide (0.5 μg/mL); 10 μL of each PCR sample was loaded with 2 μL of 6× loading buffer (Fermentas, VWR Italy, Milan, Italy) and 5 μL of marker-PCR as reference DNA (Fermentas, VWR Italy, Milan, Italy). The run was carried out at a voltage of 100 V for about 1 h in TBE 10× (Trizma base, boric acid, and EDTA 0.5M pH 8). At the end of the run, the bands were viewed with a UV transilluminator (Fotodine 3-3102 Celbio, Milan, Italy). The primers and amplification conditions are listed in Table 2.

3. Results

A total of 180 coagulase-positive isolates were isolated from 18 cheese samples, and 175 were confirmed as S. aureus through latex agglutination and API STAPH tests. All isolates possessed phenotypic characteristics typical for S. aureus (protein A, bound and free coagulase, catalase, Dnase, and morphology). Variations were observed in certain biochemical reactions, including the “egg-yolk” reaction and haemolysis pattern (Table 3). The “Egg yolk” reaction was characteristic of 94 (53.7%) out of 175 isolates; 32 (18.3%) isolates showed a weak reaction, while in 49 (28%) isolates, the reaction was completely absent. Beta-haemolysis was observed in 103 (58.8%) isolates, while 64 (36.6%) isolates produced a double-haemolysis zone. On the other hand, 8 (4.6%) isolates were non-haemolytic. All isolates were split into 11 clusters for the hierarchical cluster analysis (Figure 1).
Antibiotic resistance was detected in 2 (1.1%) out of 175 S. aureus isolates, to mupirocin only.
Real-time PCR detected that 34 (19.4%) isolates were positive for the enterotoxin gene sec and 80.6% were not enterotoxigenic. Other classical genes were not detected. The presence of the sec gene was confirmed using the classical PCR method as well.
The production of the enterotoxin SEC was detected in all 34 (19.4%) isolates that carried the sec gene. Other classical enterotoxins were not detected (Table 4).
The hierarchical cluster analysis of the 34 SEC-positive isolates is shown in Figure 2.

4. Discussion

According to De Buyser et al. [3] and Delmas et al. [4], raw milk cheeses are often contaminated with enterotoxigenic S. aureus strains. A previous study on the microbiological quality of fresh cheese produced in the Dubrovnik area, conducted by Ljevaković-Musladin et al. [50], is in agreement with those findings. That study showed that 80% (24/30 samples) of the examined fresh cheese samples were (highly) contaminated with S. aureus strains. At that time, studies on the enterotoxigenic potential of S. aureus isolates had not been conducted, and their enterotoxin production capability and associated risk remained unknown. Besides a study on virulence factors of S. aureus strains isolated from mastitic cow milk [56], there are no data on S. aureus strains isolated from food. In light of that, this study aimed at the phenotype and genotype profiling of S. aureus strains isolated from fresh cheese.
Our S. aureus isolates from fresh cheese possessed typical phenotypic characteristics of S. aureus. However, variability was observed in the “egg-yolk” reactions and haemolysis patterns. Most of the isolates showed either characteristic or weak “egg-yolk” reactions, while in 28% of the isolates this reaction was absent. Unlike our results, other studies [25,40,57] have reported that the majority (more than 50%) of S. aureus isolates from mastitic cow milk and goat and sheep cheese were “egg-yolk”-negative.
Most of our isolates were β-haemolytic or produced a double zone of α+β-haemolysis. These results are in agreement with other findings [22,24,33]. Jørgensen et al. [58] even reported that all S. aureus from cheese production in Norway was β-haemolytic. Akineden et al. [25] and Stephan et al. [57] reported double-haemolysis in the majority of S. aureus isolates from goat’s milk cheese in Germany and bovine mastitis in Switzerland. According to Hájek and Marsálek [59], β-haemolysis is a characteristic of S. aureus isolates of animal origin.
The extremely low antimicrobic resistance of the S. aureus isolates in our study is in disagreement with other published data. Studies from Normanno et al. [23], Rola et al. [24], André et al. [60], Grispoldi et al. [61], and Papadopoulos et al. [62] reported the very high antimicrobic resistance of S. aureus isolates from milk and cheese to the antibiotics used in human and veterinary medicine. In our study, a small number of isolates were resistant to mupirocin, an antibiotic used in human medicine. According to Zhang et al. [46], among the 12 antibiotics, the resistance rates of penicillin and ampicillin were the highest worldwide, and the antibiotic resistance of ampicillin, gentamicin and chloramphenicol has increased over time. The results of a meta-analysis by Gajewska et al. [5] suggest that there is a low prevalence of MRSA in raw milk recovered from healthy animals, but it has increased in the past ten years.
Our study showed that S. aureus isolates from fresh cheese belonged to two genotypes/phenotypes: non-enterotoxigenic and sec genotype/SEC phenotype. The majority (80.6%) of S. aureus isolates from fresh cheese carried no SE genes. Similar results were reported by Hunt et al. [63]. The authors reported that 83.2% of S. aureus isolates from raw milk and raw milk cheeses in Ireland were not enterotoxigenic. However, we detected the sec gene in 34 (19.4%) isolates. All sec-gene-positive isolates produced SEC in vitro. Other studies have also shown that the sec gene is the most frequently found in S. aureus isolates from milk and raw milk cheese [20,25,27,28,29,30,31,32,33,35,40,41,46,64].
On the other hand, many authors reported, with high frequency, sed gene presence (alone or in combination with other genes) in S. aureus isolates from raw milk and raw milk cheeses [20,21,22,23,24,37,38,43,44,65].
Although sea, seb, and sed genes were not detected in our study, according to various studies, those genes are mostly found in S. aureus isolates from food implicated in staphylococcal food poisoning [14,15,16,17,18]. Rall et al. [39] reported the dominant presence of the sea gene in S. aureus isolates from raw milk in Brazil, while the presence of sea and seb genes were found in raw milk cheese in Turkey [66]. Several authors reported on the prevalence of the sea gene together with the sed gene in S. aureus isolates from raw milk and dairy products in Italy [21,22,23,36]. Unlike other classical enterotoxin genes, the see gene was rarely found in S. aureus isolates [12,16]. Only a few studies reported the presence of the see gene in S. aureus strains isolated from goat and sheep cheese [26] and in S. aureus isolates from mastitic cow milk in Italy [61].
Data on the enterotoxigenic potential of S. aureus isolates from fresh cheese in Croatia are scarce. The only study that determined the presence of SE genes in S. aureus isolates was conducted by Jaki Taklec [56]. The author reported the prevalence of seg and sei genes in 89.4% and 91.5%, respectively, and the presence of the sec gene in 44.7% of isolates. Other genes were not detected. These findings on the sec gene agree with our results. A meta-analysis conducted by Zhang et al. [46] reported that the highest detection rates for classical enterotoxins in S. aureus isolates from milk and dairy products between 1992 and 2021 worldwide were found for sec and sea genes.
However, in recent years, many studies on the enterotoxigenic properties of S. aureus isolates have found a high prevalence of newer enterotoxins [15,20,42,43,44,45,67].
The results from our study also showed that fresh cheeses were frequently contaminated with a heterogenous population of S. aureus strains, which were both enterotoxigenic and non-enterotoxigenic. The hierarchical cluster analysis (Figure 1 and Figure 2) confirmed the heterogenicity of the studied population. These observations agree with the findings of Loncarevic et al. [35], who found significant diversity in S. aureus isolates within single samples of raw milk and raw milk products. The authors also recommended testing up to ten isolates per sample to increase the chance of identifying a potential source of staphylococcal intoxication. The same principle was applied in our study.
The dominant production of SEC enterotoxin in S. aureus isolates from milk, dairy products (fresh cheese especially), and other food has also been reported in many studies worldwide. Similar results were found in Norway [31], Japan [32], Germany [25], Austria [29], Turkey [33], Italy [36], Switzerland [57], Ireland [63], France [68], the USA [69], and Spain [70]. According to these authors, the SEC enterotoxin is the most common enterotoxin produced by S. aureus strains isolated from animal samples and the most frequently found in cow and caprine milk as well as raw cow and caprine milk cheeses. It has also been recognised as an important cause of SFP associated with the consumption of dairy products [69]. According to the phenotypic characteristics of S. aureus isolates from our study, we assume that the isolates were of animal origin.
In comparison with our results, other studies reported the prevalence of other enterotoxins in milk, cheese, and dairy products. Borelli et al. [71] reported SEA, SEB, and SEC as the most common enterotoxin types in Canastra cheese in Brazil. Gonano et al. [29] and Normanno et al. [23] found that some S. aureus isolates from dairy products were able to produce more than one enterotoxin type, mostly SEA/SED and SEA/SEB/SEC combinations. SEB is the most frequent enterotoxin type from S. aureus isolates from sheep cheese in Slovakia [72]. Although the first studies on the enterotoxigenicity of S. aureus isolates from cheese in France showed that SEC is the most frequent enterotoxin type [68], later studies discovered a higher prevalence of enterotoxin SED-producing strains [34,37]. Morandi et al. [65] reported a high frequency of enterotoxins SEA and SED in raw milk and dairy products in Italy. Poli et al. [45] reported enterotoxin SED as the most frequent classical enterotoxin in Monte Veronese cheese in Italy. According to Grispoldi et al. [61], S. aureus isolates from mastitic cow milk are mostly SEA, SEE, and SED producers. SEA and SED are the most common causative agents of staphylococcal food poisoning associated with dairy products [65].
The prevalence of enterotoxigenic strains in fresh cheese from our study was found to be 19.4%. A similar frequency was found in Austria [29], Ireland [63], and France [68]. However, many studies on raw milk and raw milk cheeses have reported a higher prevalence of enterotoxigenic strains [31,35,36]. On the other hand, two extremes were reported by Borelli et al. [71] and Ertas et al. [66], as 93.3% and 2.3% of SE-producing strains of S. aureus were found in Brazilian Canastra cheese and sheep cheese in Turkey, respectively.
The diversity of results between studies is due to the differences between S. aureus reservoirs in different countries, S. aureus ecovars, analytical methods with different sensitivity, and differences in number and type of analysed samples.

5. Conclusions

Most S. aureus isolates from our study were not enterotoxigenic. All isolates possessed the typical phenotypic characteristics of S. aureus. Antibiotic resistance was surprisingly low, and to mupirocin only. Enterotoxigenic potential was observed in 19.4% of isolates. Based on their enterotoxigenic profile, all isolates could be divided into two phenotypes/genotypes, non-enterotoxigenic and toxigenic SEC phenotype (sec genotype), since only SEC production and the sec gene were detected. Cheese samples were contaminated with a mixture of non-enterotoxigenic and SEC-producing strains.
Although the enterotoxigenic potential of S. aureus isolates from fresh cheese was lower than expected, it can significantly increase if there is horizontal gene transfer between enterotoxigenic and non-enterotoxigenic strains in the cheese population. Since certain strains possessed the sec gene and were also able to produce SEC in vitro, enterotoxin production in fresh cheese could not be ruled out.

Author Contributions

Conceptualisation, I.L.-M. and L.K.; methodology, I.L.-M. and L.K.; validation, I.L.-M.; formal analysis, I.L.-M., M.K., M.V.M. and L.G.; investigation, I.L.-M., M.K., M.V.M., L.G. and B.T.C.-G.; data curation, I.L.-M., L.G. and B.T.C.-G.; writing—original draft preparation, I.L.-M.; writing—review and editing, L.K., L.G. and B.T.C.-G.; supervision, L.K.; funding acquisition, M.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Data Availability Statement

Data from this study are available from the corresponding author upon request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Nia, Y.; Mutel, I.; Assere, A.; Lombard, B.; Auvray, F.; Hennekinne, J.-A. Review Over a 3-Year Period of European Union Proficiency Tests for Detection of Staphylococcal Enterotoxins in Food Matrices. Toxins 2016, 8, 107. [Google Scholar] [CrossRef] [PubMed]
  2. Rajkovic, A.; Jovanovic, J.; Monteiro, S.; Decleer, M.; Andjelkovic, M.; Foubert, A.; Beloglazova, N.; Tsilla, V.; Sas, B.; Madder, A.; et al. Detection of toxins involved in foodborne diseases caused by Gram-positive bacteria. Compr. Rev. Food Sci. Food Saf. 2020, 19, 1605–1657. [Google Scholar] [CrossRef] [PubMed]
  3. De Buyser, M.-L.; Dufour, B.; Maire, M.; Lafarge, V. Implication of milk and milk products in food-borne diseases in France and in different industrialised countries. Int. J. Food Microbiol. 2001, 67, 1–17. [Google Scholar] [CrossRef] [PubMed]
  4. Delmas, G.; Gallay, A.; Espié, E.; Haeghebaert, S.; Pihier, N.; Weill, F.X.; De Valk, H.; Vaillant, V.; Desenclos, J.C. Les toxi-infections alimentaires collectives en France entre 1996 et 2005. Bull. Epidemiol. Hebd. 2006, 51–52, 418–422. [Google Scholar]
  5. Gajewska, J.; Zakrzewski, A.; Chajęcka-Wierzchowska, W.; Zadernowska, A. Meta-analysis of the global occurrence of S. aureus in raw cattle milk and artisanal cheeses. Food Control 2023, 147, 109603. [Google Scholar] [CrossRef]
  6. Cenci-Goga, B.T.; Karama, M.; Rossitto, P.V.; Morgante, R.A.; Cullor, J.S. Enterotoxin Production by Staphylococcus aureus Isolated from Mastitic Cows. J. Food Prot. 2003, 66, 1693–1696. [Google Scholar] [CrossRef] [PubMed]
  7. Grispoldi, L.; Karama, M.; Armani, A.; Hadjicharalambous, C.; Cenci-Goga, B.T. Staphylococcus aureus enterotoxin in food of animal origin and staphylococcal food poisoning risk assessment from farm to table. Ital. J. Anim. Sci. 2021, 20, 677–690. [Google Scholar] [CrossRef]
  8. Grispoldi, L.; Karama, M.; Ianni, F.; La Mantia, A.; Pucciarini, L.; Camaioni, E.; Sardella, R.; Sechi, P.; Natalini, B.; Cenci-Goga, B.T. The Relationship between S. aureus and Branched-Chain Amino Acids Content in Composite Cow Milk. Animals 2019, 9, 981. [Google Scholar] [CrossRef]
  9. Wan, Y.; Yang, L.; Li, Q.; Wang, X.; Zhou, T.; Chen, D.; Li, L.; Wang, Y.; Wang, X. Stability and emetic activity of enterotoxin like X (SElX) with high carrier rate of food poisoning Staphylococcus aureus. Int. J. Food Microbiol. 2023, 404, 110352. [Google Scholar] [CrossRef]
  10. Hu, D.-L.; Wang, L.; Fang, R.; Okamura, M.; Ono, H.K. Chapter 3—Staphylococcus aureus Enterotoxins. In Staphylococcus aureus; Fetsch, A., Ed.; Academic Press: New York, NY, USA, 2018; pp. 39–55. [Google Scholar]
  11. Balaban, N.; Rasooly, A. Staphylococcal enterotoxins. Int. J. Food Microbiol. 2000, 61, 1–10. [Google Scholar] [CrossRef]
  12. Ostyn, A.; De Buyser, M.L.; Guillier, F.; Groult, J.; Félix, B.; Salah, S.; Delmas, G.; Hennekinne, J.A. First evidence of a food poisoning outbreak due to staphylococcal enterotoxin type E, France, 2009. Eurosurveillance 2010, 15, 19528. [Google Scholar] [CrossRef] [PubMed]
  13. Zhang, P.; Zhang, Y.; Ruan, F.; Chang, G.; Lü, Z.; Tian, L.; Ji, H.; Zhou, T.; Wang, X. Genotypic diversity of staphylococcal enterotoxin B gene (seb) and its association with molecular characterization and antimicrobial resistance of Staphylococcus aureus from retail food. Int. J. Food Microbiol. 2024, 408, 110444. [Google Scholar] [CrossRef] [PubMed]
  14. Argudín, M.Á.; Mendoza, M.C.; Rodicio, M.R. Food Poisoning and Staphylococcus aureus Enterotoxins. Toxins 2010, 2, 1751–1773. [Google Scholar] [CrossRef] [PubMed]
  15. Chao, G.; Bao, G.; Cao, Y.; Yan, W.; Wang, Y.; Zhang, X.; Zhou, L.; Wu, Y. Prevalence and diversity of enterotoxin genes with genetic background of Staphylococcus aureus isolates from different origins in China. Int. J. Food Microbiol. 2015, 211, 142–147. [Google Scholar] [CrossRef] [PubMed]
  16. Kérouanton, A.; Hennekinne, J.A.; Letertre, C.; Petit, L.; Chesneau, O.; Brisabois, A.; De Buyser, M.L. Characterization of Staphylococcus aureus strains associated with food poisoning outbreaks in France. Int. J. Food Microbiol. 2007, 115, 369–375. [Google Scholar] [CrossRef] [PubMed]
  17. Omoe, K.; Hu, D.-L.; Takahashi-Omoe, H.; Nakane, A.; Shinagawa, K. Comprehensive analysis of classical and newly described staphylococcal superantigenic toxin genes in Staphylococcus aureus isolates. FEMS Microbiol. Lett. 2005, 246, 191–198. [Google Scholar] [CrossRef] [PubMed]
  18. Sato’o, Y.; Omoe, K.; Naito, I.; Ono, H.K.; Nakane, A.; Sugai, M.; Yamagishi, N.; Hu, D.-L. Molecular Epidemiology and Identification of a Staphylococcus aureus Clone Causing Food Poisoning Outbreaks in Japan. J. Clin. Microbiol. 2014, 52, 2637–2640. [Google Scholar] [CrossRef] [PubMed]
  19. Pineda, A.P.A.; Cueva, C.L.R.; Chacón, R.D.; Ramírez, M.; de Almeida, O.G.G.; de Oliveira, D.P.; Franco, B.D.G.M.; Lacorte, G.; Landgraf, M.; Silva, N.C.C.; et al. Genomic characterization of Staphylococcus aureus from Canastra Minas Artisanal Cheeses. Braz. J. Microbiol. 2023, 54, 2103–2116. [Google Scholar] [CrossRef]
  20. Carfora, V.; Caprioli, A.; Marri, N.; Sagrafoli, D.; Boselli, C.; Giacinti, G.; Giangolini, G.; Sorbara, L.; Dottarelli, S.; Battisti, A.; et al. Enterotoxin genes, enterotoxin production, and methicillin resistance in Staphylococcus aureus isolated from milk and dairy products in Central Italy. Int. Dairy J. 2015, 42, 12–15. [Google Scholar] [CrossRef]
  21. Cremonesi, P.; Perez, G.; Pisoni, G.; Moroni, P.; Morandi, S.; Luzzana, M.; Brasca, M.; Castiglioni, B. Detection of enterotoxigenic Staphylococcus aureus isolates in raw milk cheese. Lett. Appl. Microbiol. 2007, 45, 586–591. [Google Scholar] [CrossRef]
  22. Morandi, S.; Brasca, M.; Lodi, R.; Cremonesi, P.; Castiglioni, B. Detection of classical enterotoxins and identification of enterotoxin genes in Staphylococcus aureus from milk and dairy products. Vet. Microbiol. 2007, 124, 66–72. [Google Scholar] [CrossRef] [PubMed]
  23. Normanno, G.; La Salandra, G.; Dambrosio, A.; Quaglia, N.C.; Corrente, M.; Parisi, A.; Santagada, G.; Firinu, A.; Crisetti, E.; Celano, G.V. Occurrence, characterization and antimicrobial resistance of enterotoxigenic Staphylococcus aureus isolated from meat and dairy products. Int. J. Food Microbiol. 2007, 115, 290–296. [Google Scholar] [CrossRef] [PubMed]
  24. Rola, J.G.; Czubkowska, A.; Korpysa-Dzirba, W.; Osek, J. Occurrence of Staphylococcus aureus on Farms with Small Scale Production of Raw Milk Cheeses in Poland. Toxins 2016, 8, 62. [Google Scholar] [CrossRef] [PubMed]
  25. Akineden, Ö.; Hassan, A.A.; Schneider, E.; Usleber, E. Enterotoxigenic properties of Staphylococcus aureus isolated from goats’ milk cheese. Int. J. Food Microbiol. 2008, 124, 211–216. [Google Scholar] [CrossRef] [PubMed]
  26. Basanisi, M.G.; Nobili, G.; La Bella, G.; Russo, R.; Spano, G.; Normanno, G.; La Salandra, G. Molecular characterization of Staphylococcus aureus isolated from sheep and goat cheeses in southern Italy. Small Rumin. Res. 2016, 135, 17–19. [Google Scholar] [CrossRef]
  27. Cavicchioli, V.Q.; Scatamburlo, T.M.; Yamazi, A.K.; Pieri, F.A.; Nero, L.A. Occurrence of Salmonella, Listeria monocytogenes, and enterotoxigenic Staphylococcus in goat milk from small and medium-sized farms located in Minas Gerais State, Brazil. J. Dairy Sci. 2015, 98, 8386–8390. [Google Scholar] [CrossRef] [PubMed]
  28. De Buyser, M.L.; Dilasser, F.; Hummel, R.; Bergdoll, M.S. Enterotoxin and toxic shock syndrome toxin-1 production by staphylococci isolated from goat’s milk. Int. J. Food Microbiol. 1987, 5, 301–309. [Google Scholar] [CrossRef]
  29. Gonano, M.; Hein, I.; Zangerl, P.; Rammelmayr, A.; Wagner, M. Phenotypic and molecular characterization of Staphylococcus aureus strains of veterinary, dairy and human origin. Epidemiol. Infect. 2009, 137, 688–699. [Google Scholar] [CrossRef]
  30. Hàjek, V. Identification of enterotoxigenic staphylococci from sheep and sheep cheese. Appl. Environ. Microbiol. 1978, 35, 264–268. [Google Scholar] [CrossRef]
  31. Jørgensen, H.J.; Mørk, T.; Høgåsen, H.R.; Rørvik, L.M. Enterotoxigenic Staphylococcus aureus in bulk milk in Norway. J. Appl. Microbiol. 2005, 99, 158–166. [Google Scholar] [CrossRef]
  32. Katsuda, K.; Hata, E.; Kobayashi, H.; Kohmoto, M.; Kawashima, K.; Tsunemitsu, H.; Eguchi, M. Molecular typing of Staphylococcus aureus isolated from bovine mastitic milk on the basis of toxin genes and coagulase gene polymorphisms. Vet. Microbiol. 2005, 105, 301–305. [Google Scholar] [CrossRef] [PubMed]
  33. Kav, K.; Col, R.; Ardic, M. Characterization of Staphylococcus aureus isolates from white-brined Urfa cheese. J. Food Prot. 2011, 74, 1788–1796. [Google Scholar] [CrossRef] [PubMed]
  34. Lamprell, H.; Villard, L.; Chamba, J.F.; Beuvier, E.; Borges, E.; Maurin, F.; Mazerolles, G.; Noel, Y.; Kodjo, A. Identification and biotyping of coagulase positive staphylococci (CPS) in ripened French raw milk cheeses and their in vitro ability to produce enterotoxins. Rev. Med. Vet. 2004, 155, 92–96. [Google Scholar]
  35. Loncarevic, S.; Jørgensen, H.J.; Løvseth, A.; Mathisen, T.; Rørvik, L.M. Diversity of Staphylococcus aureus enterotoxin types within single samples of raw milk and raw milk products. J. Appl. Microbiol. 2005, 98, 344–350. [Google Scholar] [CrossRef] [PubMed]
  36. Normanno, G.; Firinu, A.; Virgilio, S.; Mula, G.; Dambrosio, A.; Poggiu, A.; Decastelli, L.; Mioni, R.; Scuota, S.; Bolzoni, G.; et al. Coagulase-positive Staphylococci and Staphylococcus aureus in food products marketed in Italy. Int. J. Food Microbiol. 2005, 98, 73–79. [Google Scholar] [CrossRef] [PubMed]
  37. Ostyn, A.; De Buyser, M.L.; Guillier, F.; Krys, S.; Hennekinne, J.A. Benefits of the Combined Use of Immunological- and PCR-Based Methods for Determination of Staphylococcal Enterotoxin Food Safety Criteria in Cheeses. Food Anal. Methods 2012, 5, 173–178. [Google Scholar] [CrossRef]
  38. Pelisser, M.R.; Klein, C.S.; Ascoli, K.R.; Zotti, T.R.; Arisi, A.C. Ocurrence of Staphylococcus aureus and multiplex pcr detection of classic enterotoxin genes in cheese and meat products. Braz. J. Microbiol. Publ. Braz. Soc. Microbiol. 2009, 40, 145–148. [Google Scholar] [CrossRef]
  39. Rall, V.L.M.; Vieira, F.P.; Rall, R.; Vieitis, R.L.; Fernandes, A.; Candeias, J.M.G.; Cardoso, K.F.G.; Araújo, J.P. PCR detection of staphylococcal enterotoxin genes in Staphylococcus aureus strains isolated from raw and pasteurized milk. Vet. Microbiol. 2008, 132, 408–413. [Google Scholar] [CrossRef]
  40. Scherrer, D.; Corti, S.; Muehlherr, J.E.; Zweifel, C.; Stephan, R. Phenotypic and genotypic characteristics of Staphylococcus aureus isolates from raw bulk-tank milk samples of goats and sheep. Vet. Microbiol. 2004, 101, 101–107. [Google Scholar] [CrossRef]
  41. Valle, J.; Gomez-Lucia, E.; Piriz, S.; Goyache, J.; Orden, J.A.; Vadillo, S. Enterotoxin production by staphylococci isolated from healthy goats. Appl. Environ. Microbiol. 1990, 56, 1323–1326. [Google Scholar] [CrossRef]
  42. Bianchi, D.M.; Gallina, S.; Bellio, A.; Chiesa, F.; Civera, T.; Decastelli, L. Enterotoxin gene profiles of Staphylococcus aureus isolated from milk and dairy products in Italy. Lett. Appl. Microbiol. 2014, 58, 190–196. [Google Scholar] [CrossRef] [PubMed]
  43. Hummerjohann, J.; Naskova, J.; Baumgartner, A.; Graber, H.U. Enterotoxin-producing Staphylococcus aureus genotype B as a major contaminant in Swiss raw milk cheese. J. Dairy Sci. 2014, 97, 1305–1312. [Google Scholar] [CrossRef] [PubMed]
  44. Johler, S.; Macori, G.; Bellio, A.; Acutis, P.L.; Gallina, S.; Decastelli, L. Short communication: Characterization of Staphylococcus aureus isolated along the raw milk cheese production process in artisan dairies in Italy. J. Dairy Sci. 2018, 101, 2915–2920. [Google Scholar] [CrossRef] [PubMed]
  45. Poli, A.; Guglielmini, E.; Sembeni, S.; Spiazzi, M.; Dellaglio, F.; Rossi, F.; Torriani, S. Detection of Staphylococcus aureus and enterotoxin genotype diversity in Monte Veronese, a Protected Designation of Origin Italian cheese. Lett. Appl. Microbiol. 2007, 45, 529–534. [Google Scholar] [CrossRef] [PubMed]
  46. Zhang, J.; Wang, J.; Jin, J.; Li, X.; Zhang, H.; Shi, X.; Zhao, C. Prevalence, antibiotic resistance, and enterotoxin genes of Staphylococcus aureus isolated from milk and dairy products worldwide: A systematic review and meta-analysis. Food Res. Int. 2022, 162, 111969. [Google Scholar] [CrossRef] [PubMed]
  47. Hennekinne, J.A.; De Buyser, M.L.; Dragacci, S. Staphylococcus aureus and its food poisoning toxins: Characterization and outbreak investigation. FEMS Microbiol. Rev. 2012, 36, 815–836. [Google Scholar] [CrossRef] [PubMed]
  48. Asao, T.; Kumeda, Y.; Kawai, T.; Shibata, T.; Oda, H.; Haruki, K.; Nakazawa, H.; Kozaki, S. An extensive outbreak of staphylococcal food poisoning due to low-fat milk in Japan: Estimation of enterotoxin A in the incriminated milk and powdered skim milk. Epidemiol. Infect. 2003, 130, 33–40. [Google Scholar] [CrossRef] [PubMed]
  49. Notermans, S.; Dormans, J.A.M.A.; Mead, G.C. Contribution of surface attachment to the establishment of micro-organisms in food processing plants: A review. Biofouling 1991, 5, 21–36. [Google Scholar] [CrossRef]
  50. Ljevaković-Musladin, I.; Lakić, M.; Levak, S.; Kozačinski, L. Microbiological Quality of Domestic Cheese in Dubrovnik Croatia Region. In Prooceedings of the Hygiena Alimentorum XXXVII, Safety and Quality of Dairy and Vegetable Commodities, Štrbské pleso, Slovakia, 18–20 May 2016; pp. 228–233. [Google Scholar]
  51. EN ISO 6888-1:2021; C.S. Mikrobiologija u Lancu Hrane—Horizontalna Metoda Određivanja Broja Koagulaza-Pozitivnih Stafilokoka (Staphylococcus aureus i Ostale Vrste)—1. Dio: Postupak Primjene Baird-Parker Agara. Croatian Standards Institute: Zagreb, Croatia, 2021.
  52. (EUCAST) European Committee on Antimicrobial Susceptibility Testing. Disk Diffusion Method for Antimicrobial Susceptibility Testing Manual, Version 8.0. Available online: https://www.eucast.org (accessed on 18 September 2020).
  53. (EUCAST) European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 13.1. Available online: https://www.eucast.org (accessed on 18 October 2023).
  54. Nakayama, A.; Okayama, A.; Hashida, M.; Yamamoto, Y.; Takebe, H.; Ohnaka, T.; Tanaka, T.; Imai, S. Development of a routine laboratory direct detection system of staphylococcal enterotoxin genes. J. Med. Microbiol. 2006, 55, 273–277. [Google Scholar] [CrossRef]
  55. Salasia, S.I.; Khusnan, Z.; Lammler, C.; Zschock, M. Comparative studies on pheno- and genotypic properties of Staphylococcus aureus isolated from bovine subclinical mastitis in central Java in Indonesia and Hesse in Germany. J. Vet. Sci. 2004, 5, 103–109. [Google Scholar] [CrossRef][Green Version]
  56. Jaki Taklec, V. Detection of Genes Encoding Virulence Factors and mecA Gene in Staphylococcus aureus Field Strains Isolated from Mastitic Cows; University of Zagreb: Zagreb, Croatia, 2013. [Google Scholar]
  57. Stephan, R.; Annemüller, C.; Hassan, A.A.; Lämmler, C. Characterization of enterotoxigenic Staphylococcus aureus strains isolated from bovine mastitis in north-east Switzerland. Vet. Microbiol. 2001, 78, 373–382. [Google Scholar] [CrossRef] [PubMed]
  58. Jørgensen, H.J.; Mørk, T.; Rørvik, L.M. The Occurrence of Staphylococcus aureus on a Farm with Small-Scale Production of Raw Milk Cheese. J. Dairy Sci. 2005, 88, 3810–3817. [Google Scholar] [CrossRef] [PubMed]
  59. Hájek, V.; Marsálek, E. A study of staphylococci of bovine origin Staphylococcus aureus var. bovis. Zentralblatt Bakteriol. Parasitenkd. Infekt. Hyg. 1969, 209, 154–160. [Google Scholar]
  60. André, M.C.D.P.B.; Campos, M.R.H.; Borges, L.J.; Kipnis, A.; Pimenta, F.C.; Serafini, Á.B. Comparison of Staphylococcus aureus isolates from food handlers, raw bovine milk and Minas Frescal cheese by antibiogram and pulsed-field gel electrophoresis following SmaI digestion. Food Control 2008, 19, 200–207. [Google Scholar] [CrossRef]
  61. Grispoldi, L.; Massetti, L.; Sechi, P.; Iulietto, M.F.; Ceccarelli, M.; Karama, M.; Popescu, P.A.; Pandolfi, F.; Cenci-Goga, B.T. Short communication: Characterization of enterotoxin-producing Staphylococcus aureus isolated from mastitic cows. J. Dairy Sci. 2019, 102, 1059–1065. [Google Scholar] [CrossRef] [PubMed]
  62. Papadopoulos, P.; Papadopoulos, T.; Angelidis, A.S.; Kotzamanidis, C.; Zdragas, A.; Papa, A.; Filioussis, G.; Sergelidis, D. Prevalence, antimicrobial susceptibility and characterization of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus isolated from dairy industries in north-central and north-eastern Greece. Int. J. Food Microbiol. 2019, 291, 35–41. [Google Scholar] [CrossRef] [PubMed]
  63. Hunt, K.; Schelin, J.; Rådström, P.; Butler, F.; Jordan, K. Classical enterotoxins of coagulase-positive Staphylococcus aureus isolates from raw milk and products for raw milk cheese production in Ireland. Dairy Sci. Technol. 2012, 92, 487–499. [Google Scholar] [CrossRef]
  64. Shalaby, M.; Reboud, J.; Forde, T.; Zadoks, R.N.; Busin, V. Distribution and prevalence of enterotoxigenic Staphylococcus aureus and staphylococcal enterotoxins in raw ruminants’ milk: A systematic review. Food Microbiol. 2024, 118, 104405. [Google Scholar] [CrossRef]
  65. Morandi, S.; Brasca, M.; Andrighetto, C.; Lombardi, A.; Lodi, R. Phenotypic and Genotypic Characterization of Staphylococcus aureus Strains from Italian Dairy Products. Int. J. Microbiol. 2009, 2009, 501362. [Google Scholar] [CrossRef]
  66. Ertas, N.; Gonulalan, Z.; Yildirim, Y.; Kum, E. Detection of Staphylococcus aureus enterotoxins in sheep cheese and dairy desserts by multiplex PCR technique. Int. J. Food Microbiol. 2010, 142, 74–77. [Google Scholar] [CrossRef]
  67. Rosec, J.P.; Gigaud, O. Staphylococcal enterotoxin genes of classical and new types detected by PCR in France. Int. J. Food Microbiol. 2002, 77, 61–70. [Google Scholar] [CrossRef]
  68. Rosec, J.P.; Guiraud, J.P.; Dalet, C.; Richard, N. Enterotoxin production by staphylococci isolated from foods in France. Int. J. Food Microbiol. 1997, 35, 213–221. [Google Scholar] [CrossRef]
  69. Tamarapu, S.; McKillip, J.L.; Drake, M. Development of a Multiplex Polymerase Chain Reaction Assay for Detection and Differentiation of Staphylococcus aureus in Dairy Products. J. Food Prot. 2001, 64, 664–668. [Google Scholar] [CrossRef]
  70. Fueyo, J.M.; Martín, M.C.; González-Hevia, M.A.; Mendoza, M.C. Enterotoxin production and DNA fingerprinting in Staphylococcus aureus isolated from human and food samples. Relations between genetic types and enterotoxins. Int. J. Food Microbiol. 2001, 67, 139–145. [Google Scholar] [CrossRef]
  71. Borelli, B.M.; Ferreira, E.G.; Lacerda, I.C.A.; Santos, D.A.; Carmo, L.S.; Dias, R.S.; Silva, M.C.C. Enteroxigenic Staphylococcus spp. and other microbial contaminants during production of Canastra cheese. Brazil. Braz. J. Microbiol. 2006, 37, 545–550. [Google Scholar] [CrossRef]
  72. Holecková, B.; Holoda, E.; Fotta, M.; Kalinácova, V.; Gondol, J.; Grolmus, J. Occurrence of enterotoxigenic Staphylococcus aureus in food. Ann. Agric. Environ. Med. AAEM 2002, 9, 179–182. [Google Scholar] [PubMed]
Figure 1. Cluster dendrogram for 175 S. aureus isolates.
Figure 1. Cluster dendrogram for 175 S. aureus isolates.
Microorganisms 11 02993 g001
Figure 2. Cluster dendrogram for 34 SEC-positive S. aureus isolates.
Figure 2. Cluster dendrogram for 34 SEC-positive S. aureus isolates.
Microorganisms 11 02993 g002
Table 1. The primers and probes used in the real-time PCR.
Table 1. The primers and probes used in the real-time PCR.
GenePrimer/ProbeOligonucleotide Sequence (5′-3′) [54]Position *GenBank
Accession no.
seaeta-FTTTGGAAACGGTTAAAACGAATAAG489–513M18970
eta-RTTTCCTGTAAATAACGTCTTGCTTGA543–568
eta-TFAM-CTGTTCAGGAGTTGGATC-MGB524–541
sebetb-FAGGTGACTGCTCAAGAATTAGATTACC785–811M11118
etb-RAAGGCGAGTTGTTAAATTCATAGAGTT842–868
etb-TFAM-AACTCGTCACTATTTGGTG-MGB813–831
secetc-FGGCGATAAGTTTGACCAATCTAAATAT811–837X05815
etc-RAAGGTGGACTTCTATCTTCACACTTTT864–900
etc-TFAM-TGTACAACGACAATAAA-MGB845–861
sedetd-FCACAAGCAAGGCGCTATTTG836–855M28521
etd-RTCGGGAAAATCACCCTTAACA966–986
etd-TFAM-ATACAGCGCGGAAA-MGB901–914
seeete-FCTTTGGCGGTAAGGTGCAA594–612M21319
ete-RACCGTGGACCCTTCAGAAGA634–653
ete-TFAM-AGGCTTGATTGTGTTTCA-MGB615–632
F—forward primer; R—reverse primer; FAM—6-carboxy-fluorescein; MGB—minor groove binder. * Positions correspond to the nucleotide numbers downstream from the ATG start codon of the respective enterotoxin genes.
Table 2. The primers used in the classical PCR.
Table 2. The primers used in the classical PCR.
GenePrimerOligonucleotide Sequence (5′-3′) [54,55]Amplification Conditions
seaeta-FAAAGTCCCGATCAATTTATGGCTA94 °C 5′; 94 °C 3′; 58 °C 30″;
72 °C 5″;
30 cycles
72°C 10′
eta-RGTAATTAACCGAAGGTTCTGTAGA
sebetb-FTCGCATCAAACTGACAAACG94 °C 5′; 94 °C 2′
55 °C 2′;
72 °C 1′;
30 cycles
72 °C 10′
etb-RGCAGGTACTCTATAAGTGCC
secetc-FGACATAAAAGCTAGGAATTT94 °C 5′; 94 °C 2′
55 °C 2′;
72 °C 1′;
30 cycles
72 °C 10′
etc-RAAATCGGATTAACATTATCC
sedetd-FCTAGTTTGGTAATATCTCCT94 °C 5′; 94 °C 2′
55 °C 2′;
72 °C 1′;
30 cycles
72 °C 10′
etd-RTAATGCTATATCTTATAGGG
seeete-FAGGTTTTTTCACAGGTCATCC94 °C 5′; 94 °C 2′
57 °C 2′;
72 °C 1′;
35 cycles
72 °C 7′
ete-RCTTTTTTTTCTTCGGTCAATC
Table 3. Phenotypic characteristics of S. aureus isolates (n = 175).
Table 3. Phenotypic characteristics of S. aureus isolates (n = 175).
Coagulase Latex
Agglutination
Egg Yolk
Reaction
Catalase DnaseHaemolysis
Positive 17517594 a + 32 b175175103 c + 64 d
Negative 0049008
a—characteristic egg yolk reaction; b—weak “egg yolk” reaction; c—β-haemolysis; d—double-haemolysis (α + β).
Table 4. Results of the detection of enterotoxin production in vitro using the RPLA method and the detection of classical sea-see genes using real-time PCR and classical PCR.
Table 4. Results of the detection of enterotoxin production in vitro using the RPLA method and the detection of classical sea-see genes using real-time PCR and classical PCR.
SampleNo. of
Isolates
RPLA
Phenotype
Real-Time PCR
Genotype
Classical PCR
Genotype
S17SEC (5)sec (5)sec (4)
S29SEC (9)sec (9)sec (9)
S310NegativeNegative-
S410NegativeNegative-
S810NegativeNegative-
S1110NegativeNegative-
S1210NegativeNegative-
S1310NegativeNegative-
S1410SEC (7)sec (7)sec (5)
S159NegativeNegative-
S1610SEC (8)sec (8)sec (8)
S1710NegativeNegative-
S2110SEC (1)sec (1)sec (1)
S2210SEC (1)sec (1)sec (1)
S2310SEC (3)sec (3)sec (3)
S2810NegativeNegative-
S2910NegativeNegative-
S3010NegativeNegative-
Total 175343431
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ljevaković-Musladin, I.; Kozačinski, L.; Krilanović, M.; Vodnica Martucci, M.; Lakić, M.; Grispoldi, L.; Cenci-Goga, B.T. Enterotoxigenic and Antimicrobic Susceptibility Profile of Staphylococcus aureus Isolates from Fresh Cheese in Croatia. Microorganisms 2023, 11, 2993. https://doi.org/10.3390/microorganisms11122993

AMA Style

Ljevaković-Musladin I, Kozačinski L, Krilanović M, Vodnica Martucci M, Lakić M, Grispoldi L, Cenci-Goga BT. Enterotoxigenic and Antimicrobic Susceptibility Profile of Staphylococcus aureus Isolates from Fresh Cheese in Croatia. Microorganisms. 2023; 11(12):2993. https://doi.org/10.3390/microorganisms11122993

Chicago/Turabian Style

Ljevaković-Musladin, Ivana, Lidija Kozačinski, Marija Krilanović, Marina Vodnica Martucci, Mato Lakić, Luca Grispoldi, and Beniamino T. Cenci-Goga. 2023. "Enterotoxigenic and Antimicrobic Susceptibility Profile of Staphylococcus aureus Isolates from Fresh Cheese in Croatia" Microorganisms 11, no. 12: 2993. https://doi.org/10.3390/microorganisms11122993

APA Style

Ljevaković-Musladin, I., Kozačinski, L., Krilanović, M., Vodnica Martucci, M., Lakić, M., Grispoldi, L., & Cenci-Goga, B. T. (2023). Enterotoxigenic and Antimicrobic Susceptibility Profile of Staphylococcus aureus Isolates from Fresh Cheese in Croatia. Microorganisms, 11(12), 2993. https://doi.org/10.3390/microorganisms11122993

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop