Genome-Wide Identification of the CIF Gene Family and Protein Interaction with GSO1s Under the p-HBA-Induced Continuous Cropping Obstacle in Pogostemon cablin
Abstract
1. Introduction
2. Results
2.1. Identification of PatCIF Genes and Their Physicochemical Characteristics
2.2. Analysis of Gene Characteristics and Chromosome Localization of PatCIF Genes
2.3. Analysis of Cis-Acting Elements of the PatCIFs
2.4. Phylogenetic Analysis of the PatCIF Gene Family
2.5. Interspecific Collinearity Analysis of the PatCIF Gene Family
2.6. PatCIF Genes Expression Analysis
2.7. Analysis of Tertiary Structure and Protein Interaction Between PatCIFs and PatGSO1s
2.8. qRT-PCR Validation
3. Discussion
4. Materials and Methods
4.1. Genome-Wide CIF Identification in P. cablin
4.2. Analysis of Gene Characteristics and Chromosomal Localization of the CIF Small Peptide Family
4.3. Cis-Elements Analysis of CIF Gene Family Members in P. cablin
4.4. CIF Gene Family Members’ Phylogenetic Analysis in P. cablin
4.5. CIF Gene Family Members’ Interspecific Collinearity Analysis in P. cablin
4.6. PatCIF Gene Family Members’ Expression Study in P. cablin
4.7. RNA Extraction, cDNA Synthesis, and qRT-PCR Analysis in P. cablin
4.8. The Tertiary Protein Structure and Protein Interaction Analysis of the PatCIFs and PatGSO1s in P. cablin
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- He, Y.; Peng, F.; Deng, C.; Xiong, L.; Huang, Z.; Zhang, R.; Liu, M.; Peng, C. Building an Octaploid Genome and Transcriptome of the Medicinal Plant Pogostemon cablin from Lamiales. Sci. Data 2018, 5, 180274. [Google Scholar] [CrossRef]
- Li, Z.; Chen, Y.; Li, Y.; Zeng, Y.; Li, W.; Ma, X.; Huang, L.; Shen, Y. Whole-Genome Resequencing Reveals the Diversity of Patchouli Germplasm. Int. J. Mol. Sci. 2023, 24, 10970. [Google Scholar] [CrossRef]
- Wu, Y.-G.; Guo, Q.-S.; He, J.-C.; Lin, Y.-F.; Luo, L.-J.; Liu, G.-D. Genetic Diversity Analysis among and within Populations of Pogostemon cablin from China with ISSR and SRAP Markers. Biochem. Syst. Ecol. 2010, 38, 63–72. [Google Scholar] [CrossRef]
- Santos, P.V.L.; Jerônimo, L.B.; Ribeiro, W.S.C.; Lopes, G.M.; de Castro Leão Neto, J.H.; da Silva, H.B.O.; da Silva, P.I.C.; Silva, R.C.; da Silva, J.K.; Freitas, J.J.S.; et al. Exploring the Impact of Seasonal Variations on the Chemical Composition, Antinociceptive, and Anti-Inflammatory Properties of Pogostemon heyneanus Benth. Essential Oil. Front. Pharmacol. 2024, 15, 1336878. [Google Scholar] [CrossRef]
- Chen, X.; Wang, X.; Wu, D.; Li, J.; Huang, H.; Wang, X.; Zhan, R.; Chen, L. PatDREB Transcription Factor Activates Patchoulol Synthase Gene Promoter and Positively Regulates Jasmonate-Induced Patchoulol Biosynthesis. J. Agric. Food Chem. 2022, 70, 7188–7201. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.; Wu, D.; Guo, T.; Zhang, D.; Wang, X.; Zhuang, J.; Zou, X.; Gong, L.; Zhan, R.; Chen, L. The PcbZIP44 Transcription Factor Inhibits Patchoulol Synthase Gene Expression and Negatively Regulates Patchoulol Biosynthesis in Pogostemon cablin. Ind. Crops Prod. 2022, 188, 115561. [Google Scholar] [CrossRef]
- Xu, F.; Cai, W.; Ma, T.; Zeng, H.; Kuang, X.; Chen, W.; Liu, B. Traditional Uses, Phytochemistry, Pharmacology, Quality Control, Industrial Application, Pharmacokinetics and Network Pharmacology of Pogostemon cablin: A Comprehensive Review. Am. J. Chin. Med. 2022, 50, 691–721. [Google Scholar] [CrossRef] [PubMed]
- Wu, D.; Chen, L.; Zhong, B.; Zhang, Z.; Huang, H.; Gong, L.; Zou, X.; Zhan, R.; Chen, L. PcENO3 Interacts with Patchoulol Synthase to Positively Affect the Enzymatic Activity and Patchoulol Biosynthesis in Pogostemon cablin. Physiol. Plant 2023, 175, e14055. [Google Scholar] [CrossRef]
- Mo, M.; Lin, W.; Zeeshan Ul Haq, M.; Wang, Y.; Yang, E.; Yu, J.; Xia, P. Exogenous Glutathione (GSH/GSSG) Promoted the Synthesis of Patchoulol and Pogostone, Main Active Components of Pogostemon cablin (Patchouli). Ind. Crops Prod. 2024, 222, 119788. [Google Scholar] [CrossRef]
- Feng, Y.; Zhang, H.; Song, X.; Ge, T.; Zhu, J.; Zhou, C.; Cobb, K.; Yan, X.; Ruan, R.; Cheng, P. Microalgae as a Potential Conditioner for Continuous Cropping Obstacles for Taro (Colocasia esculenta L. Schott) Production. J. Clean. Prod. 2022, 369, 133356. [Google Scholar] [CrossRef]
- Tan, G.; Liu, Y.; Peng, S.; Yin, H.; Meng, D.; Tao, J.; Gu, Y.; Li, J.; Yang, S.; Xiao, N.; et al. Soil Potentials to Resist Continuous Cropping Obstacle: Three Field Cases. Environ. Res. 2021, 200, 111319. [Google Scholar] [CrossRef] [PubMed]
- Song, X.; Huang, L.; Li, Y.; Zhao, C.; Tao, B.; Zhang, W. Characteristics of Soil Fungal Communities in Soybean Rotations. Front. Plant Sci. 2022, 13, 926731. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Ding, H.; Zhang, G.; Li, Z.; Guo, Q.; Feng, H.; Qin, F.; Dai, L.; Zhang, Z. Green Manure Increases Peanut Production by Shaping the Rhizosphere Bacterial Community and Regulating Soil Metabolites Under Continuous Peanut Production Systems. BMC Plant Biol. 2023, 23, 69. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Z.; Lu, C.; Wu, Z.; Li, X.; Ding, K.; Zhu, Z.; Han, R.; Zhao, J.; Ge, T.; Li, G.; et al. Continuous Cropping Disorders of Eggplants (Solanum melongena L.) and Tomatoes (Solanum lycopersicum L.) in Suburban Agriculture: Microbial Structure and Assembly Processes. Sci. Total Environ. 2024, 909, 168558. [Google Scholar] [CrossRef] [PubMed]
- Cheng, F.; Ali, M.; Liu, C.; Deng, R.; Cheng, Z. Garlic Allelochemical Diallyl Disulfide Alleviates Autotoxicity in the Root Exudates Caused by Long-Term Continuous Cropping of Tomato. J. Agric. Food Chem. 2020, 68, 11684–11693. [Google Scholar] [CrossRef]
- Tang, L.; Hamid, Y.; Chen, Z.; Lin, Q.; Shohag, M.J.I.; He, Z.; Yang, X. A Phytoremediation Coupled with Agro-Production Mode Suppresses Fusarium Wilt Disease and Alleviates Cadmium Phytotoxicity of Cucumber (Cucumis sativus L.) in Continuous Cropping Greenhouse Soil. Chemosphere 2021, 270, 128634. [Google Scholar] [CrossRef] [PubMed]
- Wu, F.; Ding, Y.; Nie, Y.; Wang, X.-J.; An, Y.-Q.; Roessner, U.; Walker, R.; Du, B.; Bai, J.-G. Plant Metabolomics Integrated with Transcriptomics and Rhizospheric Bacterial Community Indicates the Mitigation Effects of Klebsiella Oxytoca P620 on p-Hydroxybenzoic Acid Stress in Cucumber. J. Hazard. Mater. 2021, 415, 125756. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Zeeshan Ul Haq, M.; Yu, J.; Liu, Y.; Yang, H.; Cui, H.; Yang, D.; Wu, Y. Identification of the CDPK Gene Family in Patchouli and Functional Analysis in Response to Continuous Cropping Stress. Front. Plant Sci. 2023, 14, 1300073. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Zhou, T.; Wang, Y.; Dong, J.; Bai, Y.; Huang, X.; Chen, C. Exploring the Allelopathic Autotoxicity Mechanism of Ginsenosides Accumulation under Ginseng Decomposition Based on Integrated Analysis of Transcriptomics and Metabolomics. Front. Bioeng. Biotechnol. 2024, 12, 1365229. [Google Scholar] [CrossRef]
- Liu, Y.; Liu, Y.; Zeng, C.; Wang, J.; Nyimbo, W.J.; Jiao, Y.; Wu, L.; Chen, T.; Fang, C.; Lin, W. Intercropping with Achyranthes bidentata Alleviates Rehmannia glutinosa Consecutive Monoculture Problem by Reestablishing Rhizosphere Microenvironment. Front. Plant Sci. 2022, 13, 1041561. [Google Scholar] [CrossRef] [PubMed]
- Shang, J.-H.; Li, X.-X.; Wang, X.-X.; Zhu, H.-T.; Wang, D.; Yang, C.-R.; Zhang, Y.-J. UPLC-MS2 Combined Molecular Networking Based Discovery of Nortriterpenoids from Biotransformation of Ginsenosides in Sanqi Rhizosphere Soil. J. Ginseng Res. 2024, 48, 535–542. [Google Scholar] [CrossRef]
- Liu, N.; Shao, C.; Sun, H.; Liu, Z.; Guan, Y.; Wu, L.; Zhang, L.; Pan, X.; Zhang, Z.; Zhang, Y.; et al. Arbuscular Mycorrhizal Fungi Biofertilizer Improves American Ginseng (Panax quinquefolius L.) Growth under the Continuous Cropping Regime. Geoderma 2020, 363, 114155. [Google Scholar] [CrossRef]
- Wang, M.; Deng, J.; Duan, G.; Chen, L.; Huang, X.; Wang, W.; Gong, L.; Zhang, Y.; Yu, K.; Guo, L. Insights into the Impacts of Autotoxic Allelochemicals from Rhizosphere of Atractylodes lancea on Soil Microenvironments. Front. Plant Sci. 2023, 14, 1136833. [Google Scholar] [CrossRef]
- Li, Z.; Alami, M.M.; Tang, H.; Zhao, J.; Nie, Z.; Hu, J.; Shu, S.; Zhu, D.; Yang, T. Applications of Streptomyces Jingyangensis T. and Bacillus mucilaginosus A. Improve Soil Health and Mitigate the Continuous Cropping Obstacles for Pinellia ternata (Thunb.) Breit. Ind. Crops Prod. 2022, 180, 114691. [Google Scholar] [CrossRef]
- Yan, W.; Ye, Z.; Cao, S.; Yao, G.; Yu, J.; Yang, D.; Chen, P.; Zhang, J.; Wu, Y. Transcriptome Analysis of Two Pogostemon cablin Chemotypes Reveals Genes Related to Patchouli Alcohol Biosynthesis. PeerJ 2021, 9, e12025. [Google Scholar] [CrossRef] [PubMed]
- Swamy, M.K.; Sinniah, U.R. A Comprehensive Review on the Phytochemical Constituents and Pharmacological Activities of Pogostemon cablin Benth.: An Aromatic Medicinal Plant of Industrial Importance. Molecules 2015, 20, 8521–8547. [Google Scholar] [CrossRef] [PubMed]
- Yan, W.; Liu, X.; Cao, S.; Yu, J.; Zhang, J.; Yao, G.; Yang, H.; Yang, D.; Wu, Y. Molecular Basis of Pogostemon cablin Responding to Continuous Cropping Obstacles Revealed by Integrated Transcriptomic, miRNA and Metabolomic Analyses. Ind. Crops Prod. 2023, 200, 116862. [Google Scholar] [CrossRef]
- Uddin, N.; Li, X.; Ullah, M.W.; Sethupathy, S.; Ma, K.; Zahoor; Elboughdiri, N.; Khan, K.A.; Zhu, D. Lignin Developmental Patterns and Casparian Strip as Apoplastic Barriers: A Review. Int. J. Biol. Macromol. 2024, 260, 129595. [Google Scholar] [CrossRef]
- Gao, Y.-Q.; Huang, J.-Q.; Reyt, G.; Song, T.; Love, A.; Tiemessen, D.; Xue, P.-Y.; Wu, W.-K.; George, M.W.; Chen, X.-Y.; et al. A Dirigent Protein Complex Directs Lignin Polymerization and Assembly of the Root Diffusion Barrier. Science 2023, 382, 464–471. [Google Scholar] [CrossRef]
- Yan, W.; Cao, S.; Wu, Y.; Ye, Z.; Zhang, C.; Yao, G.; Yu, J.; Yang, D.; Zhang, J. Integrated Analysis of Physiological, mRNA Sequencing, and miRNA Sequencing Data Reveals a Specific Mechanism for the Response to Continuous Cropping Obstacles in Pogostemon cablin Roots. Front. Plant Sci. 2022, 13, 853110. [Google Scholar] [CrossRef]
- Nakayama, T.; Shinohara, H.; Tanaka, M.; Baba, K.; Ogawa-Ohnishi, M.; Matsubayashi, Y. A Peptide Hormone Required for Casparian Strip Diffusion Barrier Formation in Arabidopsis Roots. Science 2017, 355, 284–286. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; He, G.; Li, J.; Perez-Hormaeche, J.; Becker, T.; Luo, M.; Wallrad, L.; Gao, J.; Li, J.; Pardo, J.M.; et al. A Salt Stress-activated GSO1-SOS2-SOS1 Module Protects the Arabidopsis Root Stem Cell Niche by Enhancing Sodium Ion Extrusion. EMBO J. 2023, 42, e113004. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Qin, X.; Tian, X.; Yang, T.; Deng, R.; Huang, J. Effects of Continuous Cropping of Pinellia ternata (Thunb.) Breit. on Soil Physicochemical Properties, Enzyme Activities, Microbial Communities and Functional Genes. Chem. Biol. Technol. Agric. 2021, 8, 43. [Google Scholar] [CrossRef]
- Kamiya, T.; Borghi, M.; Wang, P.; Danku, J.M.C.; Kalmbach, L.; Hosmani, P.S.; Naseer, S.; Fujiwara, T.; Geldner, N.; Salt, D.E. The MYB36 Transcription Factor Orchestrates Casparian Strip Formation. Proc. Natl. Acad. Sci. USA 2015, 112, 10533–10538. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Yamaji, N.; Huang, S.; Zhang, X.; Shi, M.; Fu, S.; Yang, G.; Ma, J.F.; Xia, J. OsCASP1 is Required for Casparian Strip Formation at Endodermal Cells of Rice Roots for Selective Uptake of Mineral Elements. Plant Cell 2019, 31, 2636–2648. [Google Scholar] [CrossRef]
- Song, T.; Tian, Y.-Q.; Liu, C.-B.; Gao, Y.-Q.; Wang, Y.-L.; Zhang, J.; Su, Y.; Xu, L.-N.; Han, M.-L.; Salt, D.E.; et al. A New Family of Proteins Is Required for Tethering of Casparian Strip Membrane Domain and Nutrient Homoeostasis in Rice. Nat. Plants 2023, 9, 1749–1759. [Google Scholar] [CrossRef] [PubMed]
- Cui, B.; Liu, R.; Flowers, T.J.; Song, J. Casparian Bands and Suberin Lamellae: Key Targets for Breeding Salt Tolerant Crops? Environ. Exp. Bot. 2021, 191, 104600. [Google Scholar] [CrossRef]
- Murphy, E.; Smith, S.; De Smet, I. Small Signaling Peptides in Arabidopsis Development: How Cells Communicate Over a Short Distance. Plant Cell 2012, 24, 3198–3217. [Google Scholar] [CrossRef]
- Okuda, S.; Fujita, S.; Moretti, A.; Hohmann, U.; Doblas, V.G.; Ma, Y.; Pfister, A.; Brandt, B.; Geldner, N.; Hothorn, M. Molecular Mechanism for the Recognition of Sequence-Divergent CIF Peptides by the Plant Receptor Kinases GSO1/SGN3 and GSO2. Proc. Natl. Acad. Sci. USA 2020, 117, 2693–2703. [Google Scholar] [CrossRef]
- Doblas, V.G.; Smakowska-Luzan, E.; Fujita, S.; Alassimone, J.; Barberon, M.; Madalinski, M.; Belkhadir, Y.; Geldner, N. Root Diffusion Barrier Control by a Vasculature-Derived Peptide Binding to the SGN3 Receptor. Science 2017, 355, 280–284. [Google Scholar] [CrossRef] [PubMed]
- Fujita, S. CASPARIAN STRIP INTEGRITY FACTOR (CIF) Family Peptides—Regulator of Plant Extracellular Barriers. Peptides 2021, 143, 170599. [Google Scholar] [CrossRef] [PubMed]
- Doll, N.M.; Royek, S.; Fujita, S.; Okuda, S.; Chamot, S.; Stintzi, A.; Widiez, T.; Hothorn, M.; Schaller, A.; Geldner, N.; et al. A Two-Way Molecular Dialogue between Embryo and Endosperm Is Required for Seed Development. Science 2020, 367, 431–435. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Li, X.; Wang, W.; Li, H.; Cui, Y.; Zhu, Y.; Kui, H.; Yi, J.; Li, J.; Gou, X. SERKs Regulate Embryonic Cuticle Integrity through the TWS1-GSO1/2 Signaling Pathway in Arabidopsis. New Phytol. 2022, 233, 313–328. [Google Scholar] [CrossRef]
- Royek, S.; Bayer, M.; Pfannstiel, J.; Pleiss, J.; Ingram, G.; Stintzi, A.; Schaller, A. Processing of a Plant Peptide Hormone Precursor Facilitated by Posttranslational Tyrosine Sulfation. Proc. Natl. Acad. Sci. USA 2022, 119, e2201195119. [Google Scholar] [CrossRef] [PubMed]
- Yan, W.; Cao, S.; Liu, X.; Yao, G.; Yu, J.; Zhang, J.; Bian, T.; Yu, W.; Wu, Y. Combined Physiological and Transcriptome Analysis Revealed the Response Mechanism of Pogostemon cablin Roots to P-Hydroxybenzoic Acid. Front. Plant Sci. 2022, 13, 980745. [Google Scholar] [CrossRef]
- Su, Y.; Zeeshan Ul Haq, M.; Liu, X.; Li, Y.; Yu, J.; Yang, D.; Wu, Y.; Liu, Y. A Genome-Wide Identification and Expression Analysis of the Casparian Strip Membrane Domain Protein-like Gene Family in Pogostemon cablin in Response to p-HBA-Induced Continuous Cropping Obstacles. Plants 2023, 12, 3901. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Zhang, Q.; Zhou, J.; Zou, Q. A Survey on the Algorithm and Development of Multiple Sequence Alignment. Brief. Bioinform. 2022, 23, bbac069. [Google Scholar] [CrossRef] [PubMed]
- Truskina, J.; Brück, S.; Stintzi, A.; Boeuf, S.; Doll, N.M.; Fujita, S.; Geldner, N.; Schaller, A.; Ingram, G.C. A Peptide-Mediated, Multilateral Molecular Dialogue for the Coordination of Pollen Wall Formation. Proc. Natl. Acad. Sci. USA 2022, 119, e2201446119. [Google Scholar] [CrossRef]
- Shen, Y.; Li, W.; Zeng, Y.; Li, Z.; Chen, Y.; Zhang, J.; Zhao, H.; Feng, L.; Ma, D.; Mo, X.; et al. Chromosome-Level and Haplotype-Resolved Genome Provides Insight into the Tetraploid Hybrid Origin of Patchouli. Nat. Commun 2022, 13, 3511. [Google Scholar] [CrossRef] [PubMed]
- Levy, A.A.; Feldman, M. Evolution and Origin of Bread Wheat. Plant Cell 2022, 34, 2549–2567. [Google Scholar] [CrossRef]
- Su, Y.; Feng, T.; Liu, C.-B.; Huang, H.; Wang, Y.-L.; Fu, X.; Han, M.-L.; Zhang, X.; Huang, X.; Wu, J.-C.; et al. The Evolutionary Innovation of Root Suberin Lamellae Contributed to the Rise of Seed Plants. Nat. Plants 2023, 9, 1968–1977. [Google Scholar] [CrossRef]
- Meinke, D.W. Genome-Wide Identification of EMBRYO-DEFECTIVE (EMB) Genes Required for Growth and Development in Arabidopsis. New Phytol. 2020, 226, 306–325. [Google Scholar] [CrossRef] [PubMed]
- Zeeshan Ul Haq, M.; Yu, J.; Yao, G.; Yang, H.; Iqbal, H.A.; Tahir, H.; Cui, H.; Liu, Y.; Wu, Y. A Systematic Review on the Continuous Cropping Obstacles and Control Strategies in Medicinal Plants. Int. J. Mol. Sci. 2023, 24, 12470. [Google Scholar] [CrossRef] [PubMed]
- Song, T.; Chen, J.-X.; Shan, L.-M.; Qian, Y.-C.; Chen, M.-X.; Han, J.-G.; Zhu, F.-Y. Allelopathy Research on the Continuous Cropping Problem of Poplar (Populus). Phytochem. Rev. 2024, 23, 1477–1495. [Google Scholar] [CrossRef]
- Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A “One for All, All for One” Bioinformatics Platform for Biological Big-Data Mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef]
- Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef]
- Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a Database of Plant Cis-Acting Regulatory Elements and a Portal to Tools for in Silico Analysis of Promoter Sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef] [PubMed]
- Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. ProtTest 3: Fast Selection of Best-Fit Models of Protein Evolution. Bioinformatics 2011, 27, 1164–1165. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Tang, H.; Wang, X.; Sun, Y.; Joseph, P.V.; Paterson, A.H. Detection of Colinear Blocks and Synteny and Evolutionary Analyses Based on Utilization of MCScanX. Nat. Protoc. 2024, 19, 2206–2229. [Google Scholar] [CrossRef]
- Abramson, J.; Adler, J.; Dunger, J.; Evans, R.; Green, T.; Pritzel, A.; Ronneberger, O.; Willmore, L.; Ballard, A.J.; Bambrick, J.; et al. Accurate Structure Prediction of Biomolecular Interactions with AlphaFold 3. Nature 2024, 630, 493–500. [Google Scholar] [CrossRef] [PubMed]
Gene ID | Gene Name | Amino Acids | Molecular Weight (kDa) | Theoretical pI | Instability Index | Aliphatic Index | GRAVY |
---|---|---|---|---|---|---|---|
Pat_A01G112600.m1 | PatCIF1 | 89 | 10.17 | 6.73 | 39.54 | 99.55 | −0.20 |
Pat_B01G091200.m1 | PatCIF2 | 89 | 10.15 | 5.60 | 39.54 | 99.55 | −0.19 |
Pat_A02G108200.m1 | PatCIF3 | 87 | 9.89 | 6.73 | 38.49 | 94.02 | −0.34 |
Pat_B02G081600.m1 | PatCIF4 | 88 | 9.97 | 8.01 | 35.98 | 94.09 | −0.24 |
Pat_A10G111700.m1 | PatTWS1 | 112 | 11.88 | 9.51 | 42.00 | 79.20 | −0.15 |
Pat_B09G103800.m1 | PatTWS2 | 112 | 11.87 | 9.51 | 41.71 | 78.30 | −0.16 |
Pat_A09G128900.m1 | PatTWS3 | 112 | 11.90 | 9.51 | 41.71 | 80.00 | −0.14 |
Pat_B10G099600.m1 | PatTWS4 | 112 | 11.89 | 9.51 | 43.05 | 79.20 | −0.16 |
Pat_A19G079100.m1 | PatTWS5 | 84 | 9.27 | 8.09 | 61.47 | 58.10 | −0.88 |
Pat_A20G075400.m1 | PatTWS6 | 117 | 12.65 | 9.05 | 41.81 | 75.04 | −0.39 |
Pat_B20G071600.m1 | PatTWS7 | 118 | 12.81 | 9.05 | 43.17 | 74.41 | −0.37 |
Pat_B19G076300.m1 | PatTWS8 | 116 | 12.71 | 9.05 | 47.58 | 69.83 | −0.44 |
Gene Name | Alpha Helix% | Extended Strand% | Beta Turn% | Random Oil% |
---|---|---|---|---|
PatCIF1 | 47.19 | 4.49 | 5.62 | 42.70 |
PatCIF2 | 31.46 | 11.24 | 13.48 | 43.82 |
PatCIF3 | 40.23 | 9.20 | 5.75 | 44.83 |
PatCIF4 | 44.32 | 9.09 | 1.14 | 45.45 |
PatTWS1 | 20.54 | 14.29 | 0.00 | 65.18 |
PatTWS2 | 10.71 | 20.54 | 3.57 | 65.18 |
PatTWS3 | 14.37 | 19.38 | 9.38 | 56.88 |
PatTWS4 | 11.61 | 19.64 | 0.89 | 67.86 |
PatTWS5 | 9.52 | 13.10 | 0.00 | 77.38 |
PatTWS6 | 20.51 | 11.97 | 5.13 | 62.39 |
PatTWS7 | 13.56 | 20.34 | 8.47 | 57.63 |
PatTWS8 | 16.38 | 17.24 | 3.45 | 62.93 |
Gene Name | Forward Primer Sequence (5′ → 3′) | Reverse Primer Sequence (5′ → 3′) |
---|---|---|
PatCIF1 | GCTACCAGTGGTGTCAAAGGA | AGGTGGCTTAACGAGTGCTG |
PatCIF2 | AGCTACCAGTGGTGTCAAATGA | AGTGCTGGCGTAGGATCATAAT |
PatCIF3 | CTTCTGAAGGTCGGAGAGTGAAT | TGGCGTAGGATCATAATTCCCA |
PatCIF4 | TTCTTTTGCAGGTCGGAGAGT | AGTGCTGGCGTAGGATCATAAT |
18S rRNA | CCGACCATAAACGATGCCGACC | TTTCAGCTTTGCAACCATACTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fang, J.; Liu, S.; Su, Y.; Zeeshan Ul Haq, M.; Wu, Y.; Liu, Y.; Ren, X. Genome-Wide Identification of the CIF Gene Family and Protein Interaction with GSO1s Under the p-HBA-Induced Continuous Cropping Obstacle in Pogostemon cablin. Int. J. Mol. Sci. 2025, 26, 1568. https://doi.org/10.3390/ijms26041568
Fang J, Liu S, Su Y, Zeeshan Ul Haq M, Wu Y, Liu Y, Ren X. Genome-Wide Identification of the CIF Gene Family and Protein Interaction with GSO1s Under the p-HBA-Induced Continuous Cropping Obstacle in Pogostemon cablin. International Journal of Molecular Sciences. 2025; 26(4):1568. https://doi.org/10.3390/ijms26041568
Chicago/Turabian StyleFang, Jieyun, Siru Liu, Yating Su, Muhammad Zeeshan Ul Haq, Yougen Wu, Ya Liu, and Xiuxia Ren. 2025. "Genome-Wide Identification of the CIF Gene Family and Protein Interaction with GSO1s Under the p-HBA-Induced Continuous Cropping Obstacle in Pogostemon cablin" International Journal of Molecular Sciences 26, no. 4: 1568. https://doi.org/10.3390/ijms26041568
APA StyleFang, J., Liu, S., Su, Y., Zeeshan Ul Haq, M., Wu, Y., Liu, Y., & Ren, X. (2025). Genome-Wide Identification of the CIF Gene Family and Protein Interaction with GSO1s Under the p-HBA-Induced Continuous Cropping Obstacle in Pogostemon cablin. International Journal of Molecular Sciences, 26(4), 1568. https://doi.org/10.3390/ijms26041568