The Effect of Cold-Water Swimming on Energy Metabolism, Dynamics, and Mitochondrial Biogenesis in the Muscles of Aging Rats
Abstract
1. Introduction
2. Results
2.1. ATP Concentration in the Muscle of Rats
2.2. ADP Concentration in the Muscle of Rats
2.3. AMP Concentration in the Muscle of Rats
2.4. Ado Concentration in the Muscle of Rats
2.5. TAN Concentration in the Muscle of Rats
2.6. AEC Value in Rat Muscles
2.7. Expression of PGC-1α in Rat Muscles
2.8. Expression of Mfn1 in Rat Muscles
2.9. Expression of Mfn2 in Rat Muscles
2.10. Expression of Opa1 in Rat Muscles
2.11. Expression of Drp1 in Rat Muscles
3. Discussion
3.1. Swimming in Cold Water
3.2. Mitochondrial Biogenesis and Energy Metabolism
4. Materials and Methods
4.1. Animals
- Control groups (n = 16 animals)-animals kept in sedentary conditions: Control group males (n = 8); Control group females (n = 8)
- Study groups 5 °C (n = 24 animals)-animals underwent swimming training in cold water at 5 ± 2 °C: Group 5 °C males (n = 12); Group 5 °C females (n = 12)
- Study groups 36 °C (n = 24 animals)-animals underwent swimming training in water with a thermal comfort temperature of 36 ± 2 °C: Group 36 °C males (n = 12); Group 36 °C females (n = 12)
4.2. Experimental Procedure
4.3. Determination of ATP, ADP, AMP, and Ado Concentrations Using High-Performance Liquid Chromatography (HPLC)
4.4. Analysis of PGC-1α, Mfn1, Mfn2, Opa1, and Drp1 Gene Expression Using Real-Time Polymerase Chain Reaction (qRT-PCR)
- name: Gapdh_F
- sequence: ATGACTCTACCCACGGCAAG
- name: Gapdh_R
- sequence: CTGGAAGATGGTGATGGGTT
- name: Ppargc1a_F
- sequence: TATGGAGTGACATAGAGTGTGCT
- name: Ppargc1a_R
- sequence: GTCACTACACCACTTCAATCC
- name: Mfn1_F
- sequence: ATGGCAGAAACGGTATCTCCA
- name: Mfn1_R
- sequence: GCCCTCAGTAACAAACTCCAGT
- name: Mfn2_F
- sequence: AGAACTGGACCCAGTTACTA
- name: Mfn2_R
- sequence: CACCTCGCTGATTCCCCTGA
- name: Opa1_F
- sequence: CCGTGTGAGCAGAAGAACAC
- name: Opa1_R
- sequence: AGCCTCAAGGCCAACTATGT
- name: Drp1_F
- sequence: CAGGAACTGTTACGGTTCCCTAA
- name: Drp1_R
- sequence: CCTGAATTAACTTGTCTCGCGA
4.5. Analysis of PGC-1α, Mfn1, Mfn2, Opa1, and Drp1 Protein Expression Using ELISA Method
4.6. Immunohistochemical (IHC) Analysis
4.7. Statistical Analysis
5. Conclusions
Limitation of the Study
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Blüher, M. Obesity: Global epidemiology and pathogenesis. Nat. Rev. Endocrinol. 2019, 15, 288–298. [Google Scholar] [CrossRef]
- Carbone, S.; Del Buono, M.G.; Ozemek, C.; Lavie, C.J. Obesity, risk of diabetes and role of physical activity, exercise training and cardiorespiratory fitness. Prog. Cardiovasc. Dis. 2019, 62, 327–333. [Google Scholar] [CrossRef]
- Osiński, W. Gerontokinesiology. In Learning and Practicing Physical Activity in Old Age; PZWL: Warsaw, Poland, 2013. [Google Scholar]
- Thai, P.K.; Cândido, C.; Asumadu-Sakyi, A.; Barnett, A.; Morawska, L. Variation of indoor minimum mortality temperature in different cities: Evidence of local adaptations. Environ. Pollut. 2019, 246, 745–752. [Google Scholar] [CrossRef]
- Celi, F.S.; Le, T.N.; Ni, B. Physiology and relevance of human adaptive thermogenesis response. Trends Endocrinol. Metab. 2015, 26, 238–247. [Google Scholar] [CrossRef]
- Lee, J.Y.; Park, J.; Kim, S. Cold adaptation, aging, and Korean women divers haenyeo. J. Physiol. Anthropol. 2017, 36, 33. [Google Scholar] [CrossRef]
- Teległów, A.; Bilski, J.; Marchewka, A.; Gogdzik, J.; Jaskiewicz, J. Characteristic of the body’s reaction to physical exercise at low water temperature. Med. Sport. Pract. 2008, 9, 66–72. [Google Scholar]
- Launay, J.C.; Savourey, G. Cold adaptations. Ind. Health 2009, 47, 221–227. [Google Scholar] [CrossRef]
- Friedman, J.R.; Nunnari, J. Mitochondrial form and function. Nature 2014, 505, 335–343. [Google Scholar] [CrossRef]
- Carelli, V.; Chan, D.C. Mitochondrial DNA: Impacting central and peripheral nervous systems. Neuron 2014, 84, 1126–1142. [Google Scholar] [CrossRef]
- Lightowlers, R.N.; Taylor, R.W.; Turnbull, D.M. Mutations causing mitochondrial disease: What is new and what challenges remain? Science 2015, 349, 1494–1499. [Google Scholar] [CrossRef]
- Liesa, M.; Palacín, M.; Zorzano, A. Mitochondrial dynamics in mammalian health and disease. Physiol. Rev. 2009, 89, 799–845. [Google Scholar] [CrossRef]
- Pernas, L.; Scorrano, L. Mito-Morphosis: Mitochondrial Fusion, Fission, and Cristae Remodeling as Key Mediators of Cellular Function. Annu. Rev. Physiol. 2016, 78, 505–531. [Google Scholar] [CrossRef]
- Westermann, B. Bioenergetic role of mitochondrial fusion and fission. Biochim. Biophys. Acta 2012, 1817, 1833–1838. [Google Scholar] [CrossRef]
- Zorzano, A.; Claret, M. Implications of mitochondrial dynamics on neurodegeneration and on hypothalamic dysfunction. Front. Aging Neurosci. 2015, 7, 101. [Google Scholar] [CrossRef]
- Tiraby, C.; Tavernier, G.; Lefort, C.; Larrouy, D.; Bouillaud, F.; Ricquier, D.; Langin, D. Acquirement of brown fat cell features by human white adipocytes. J. Biol. Chem. 2003, 278, 33370–33376. [Google Scholar] [CrossRef]
- International Winter Swimming Association (IWSA). Available online: https://iwsa.world (accessed on 1 December 2021).
- Knechtle, B.; Waśkiewicz, Z.; Sousa, C.V.; Hill, L.; Nikolaidis, P.T. Cold Water Swimming-Benefits and Risks: A Narrative Review. Int. J. Environ. Res. Public Health 2020, 17, 8984. [Google Scholar] [CrossRef]
- International Indian Statistical Association (IISA). Available online: www.internationaliceswimming.com (accessed on 15 January 2021).
- Knechtle, B.; Stjepanovic, M.; Knechtle, C.; Rosemann, T.; Sousa, C.V.; Nikolaidis, P.T. Physiological Responses to Swimming Repetitive “Ice Miles”. J. Strength Cond. Res. 2021, 35, 487–494. [Google Scholar] [CrossRef]
- Gibas-Dorna, M.; Chęcińska, Z.; Korek, E.; Kupsz, J.; Sowińska, A.; Krauss, H. Cold Water Swimming Beneficially Modulates Insulin Sensitivity in Middle-Aged Individuals. J. Aging Phys. Act. 2016, 24, 547–554. [Google Scholar] [CrossRef]
- Zenner, R.J.; De Decker, D.E.; Clement, D.L. Blood-pressure response to swimming in ice-cold water. Lancet 1980, 1, 120–121. [Google Scholar] [CrossRef]
- Kralova Lesna, I.; Rychlikova, J.; Vavrova, L.; Vybiral, S. Could human cold adaptation decrease the risk of cardiovascular disease? J. Therm. Biol. 2015, 52, 192–198. [Google Scholar] [CrossRef]
- Brož, P.; Rajdl, D.; Racek, J.; Zeman, V.; Novák, J.; Trefil, L. Relationship between cold water swimming and increased cardiac markers: A pilot study. Klin. Biochem. Metab. 2017, 25, 27–31. [Google Scholar]
- Manolis, A.S.; Manolis, S.A.; Manolis, A.A.; Manolis, T.A.; Apostolaki, N.; Melita, H. Winter Swimming: Body Hardening and Cardiorespiratory Protection Via Sustainable Acclimation. Curr. Sport. Med. Rep. 2019, 18, 401–415. [Google Scholar] [CrossRef]
- Huttunen, P.; Lando, N.G.; Meshtsheryakov, V.A.; Lyutov, V.A. Effects of long-distance swimming in cold water on temperature, blood pressure and stress hormones in winter swimmers. J. Therm. Biol. 2000, 25, 171–174. [Google Scholar] [CrossRef]
- Kauppinen, K.; Pajari-Backas, M.; Volin, P.; Vakkuri, O. Some endocrine responses to sauna, shower and ice water immersion. Arct. Med. Res. 1989, 48, 131–139. [Google Scholar]
- Huttunen, P.; Rintamäki, H.; Hirvonen, J. Effect of regular winter swimming on the activity of the sympathoadrenal system before and after a single cold water immersion. Int. J. Circumpolar Health 2001, 60, 400–406. [Google Scholar] [CrossRef]
- Gundle, L.; Atkinson, A. Pregnancy, cold water swimming and cortisol: The effect of cold water swimming on obstetric outcomes. Med. Hypotheses 2020, 144, 109977. [Google Scholar] [CrossRef]
- Hermanussen, M.; Jensen, F.; Hirsch, N.; Friedel, K.; Kröger, B.; Lang, R.; Just, S.; Ulmer, J.; Schaff, M.; Ahnert, P.; et al. Acute and chronic effects of winter swimming on LH, FSH, prolactin, growth hormone, TSH, cortisol, serum glucose and insulin. Arct. Med. Res. 1995, 54, 45–51. [Google Scholar]
- Kormanovski, A.; Castañeda Ibarra, F.; Lara Padilla, E.; Campos Rodriguez, R. Resistance to respiratory illness and antibody response in open water swimmers during training and long distance swims. Int. J. Med. Med. Sci. 2010, 2, 80–87. [Google Scholar]
- Eccles, R.; Wilkinson, J.E. Exposure to cold and acute upper respiratory tract infection. Rhinology 2015, 53, 99–106. [Google Scholar] [CrossRef]
- Collier, N.; Lomax, M.; Harper, M.; Tipton, M.; Massey, H. Habitual cold-water swimming and upper respiratory tract infection. Rhinology 2021, 59, 485–487. [Google Scholar] [CrossRef]
- Dulac, S.; Quirion, A.; DeCarufel, D.; LeBlanc, J.; Jobin, M.; Côte, J.; Brisson, G.R.; Lavoie, J.M.; Diamond, P. Metabolic and hormonal responses to long-distance swimming in cold water. Int. J. Sports Med. 1987, 8, 352–356. [Google Scholar] [CrossRef]
- Checinska-Maciejewska, Z.; Miller-Kasprzak, E.; Checinska, A.; Korek, E.; Gibas-Dorna, M.; Adamczak-Ratajczak, A.; Bogdanski, P.; Krauss, H. Gender-related effect of cold water swimming on the seasonal changes in lipid profile, ApoB/ApoA-I ratio, and homocysteine concentration in cold water swimmers. J. Physiol. Pharmacol. 2017, 68, 887–896. [Google Scholar]
- Wcisło, M.; Teległów, A.; Marchewka, J. Effect of winter swimming on morphological parameters of blood and a thermal evaluation of the body based on winter swimmers. Med. Rehabil. 2014, 18, 4–10. [Google Scholar]
- Teległów, A.; Marchewka, J.; Tabarowski, Z.; Rembiasz, K.; Głodzik, J.; Scisłowska-Czarnecka, A. Comparison of Selected Morphological, Rheological and Biochemical Parameters of Winter Swimmers’ Blood at the End of One Winter Swimming Season and at the Beginning of Another. Folia Biol. 2015, 63, 221–228. [Google Scholar] [CrossRef][Green Version]
- Lubkowska, A.; Dołęgowska, B.; Szyguła, Z.; Bryczkowska, I.; Stańczyk-Dunaj, M.; Sałata, D.; Budkowska, M. Winter-swimming as a building-up body resistance factor inducing adaptive changes in the oxidant/antioxidant status. Scand. J. Clin. Lab. Investig. 2013, 73, 315–325. [Google Scholar] [CrossRef]
- Mila-Kierzenkowska, C.; Woźniak, A.; Szpinda, M.; Boraczyński, T.; Woźniak, B.; Rajewski, P.; Sutkowy, P. Effects of thermal stress on the activity of selected lysosomal enzymes in blood of experienced and novice winter swimmers. Scand. J. Clin. Lab. Investig. 2012, 72, 635–641. [Google Scholar] [CrossRef]
- Brazaitis, M.; Eimantas, N.; Daniuseviciute, L.; Mickeviciene, D.; Steponaviciute, R.; Skurvydas, A. Two strategies for response to 14 °C cold-water immersion: Is there a difference in the response of motor, cognitive, immune and stress markers? PLoS ONE 2014, 9, e109020. [Google Scholar] [CrossRef]
- Van Tulleken, C.; Tipton, M.; Massey, H.; Harper, C.M. Open water swimming as a treatment for major depressive disorder. BMJ Case Rep. 2018, 2018, bcr2018225007. [Google Scholar] [CrossRef]
- Huttunen, P.; Kokko, L.; Ylijukuri, V. Winter swimming improves general well-being. Int. J. Circumpolar Health 2004, 63, 140–144. [Google Scholar] [CrossRef]
- Gibas-Dorna, M.; Checinska, Z.; Korek, E.; Kupsz, J.; Sowinska, A.; Wojciechowska, M.; Krauss, H.; Piątek, J. Variations in leptin and insulin levels within one swimming season in non-obese female cold water swimmers. Scand. J. Clin. Lab. Investig. 2016, 76, 486–491. [Google Scholar] [CrossRef]
- Leppäluoto, J.; Westerlund, T.; Huttunen, P.; Oksa, J.; Smolander, J.; Dugué, B.; Mikkelsson, M. Effects of long-term whole-body cold exposures on plasma concentrations of ACTH, β-endorphin, cortisol, catecholamines and cytokines in healthy females. Scand. J. Clin. Lab. Investig. 2008, 68, 145–153. [Google Scholar] [CrossRef] [PubMed]
- Shevchuk, N.A. Adapted cold shower as a potential treatment for depression. Med. Hypotheses 2008, 70, 995–1001. [Google Scholar] [CrossRef] [PubMed]
- Brenke, R. Winter swimming—An extreme form of body hardening. Therapeutikon 1990, 4, 466–472. [Google Scholar]
- Siems, W.G.; Brenke, R.; Sommerburg, O.; Grune, T. Improved antioxidative protection in winter swimmers. QJM 1999, 92, 193–198. [Google Scholar] [CrossRef]
- Lombardi, G.; Ricci, C.; Banfi, G. Effect of winter swimming on haematological parameters. Biochem. Med. 2011, 21, 71–78. [Google Scholar] [CrossRef] [PubMed]
- Dhabhar, F.S. Effects of stress on immune function: The good, the bad, and the beautiful. Immunol. Res. 2014, 58, 193–210. [Google Scholar] [CrossRef] [PubMed]
- Dugué, B.; Leppänen, E. Adaptation related to cytokines in man: Effects of regular swimming in ice-cold water. Clin. Physiol. 2000, 20, 114–121. [Google Scholar] [CrossRef] [PubMed]
- Janský, L.; Pospísilová, D.; Honzová, S.; Ulicný, B.; Srámek, P.; Zeman, V.; Kamínková, J. Immune system of cold-exposed and cold-adapted humans. Eur. J. Appl. Physiol. Occup. Physiol. 1996, 72, 445–450. [Google Scholar] [CrossRef] [PubMed]
- Kolettis, T.M.; Kolettis, M.T. Winter swimming: Healthy or hazardous?: Evidence and hypotheses. Med. Hypotheses 2003, 61, 654–656. [Google Scholar] [CrossRef]
- Lubkowska, A.; Bryczkowska, I.; Gutowska, I.; Rotter, I.; Marczuk, N.; Baranowska-Bosiacka, I.; Banfi, G. The Effects of Swimming Training in Cold Water on Antioxidant Enzyme Activity and Lipid Peroxidation in Erythrocytes of Male and Female Aged Rats. Int. J. Environ. Res. Public Health. 2019, 16, 647. [Google Scholar] [CrossRef]
- Konarzewski, M.; Diamond, J. Peak sustained metabolic rate in cold-stressed mice. Physiol. Zool. 1994, 67, 1186–1212. [Google Scholar] [CrossRef]
- Dudzinska, W.; Lubkowska, A. Changes in the concentration of purine and pyridine as a response to single whole-body cryostimulation. Front. Physiol. 2021, 12, 634816. [Google Scholar] [CrossRef] [PubMed]
- Hoffman-Goetz, L.; German, E. Cold acclimation and exercise as modulators of age associated hypothermia in mice. In Homeostasis and Thermal Stress, 6th International Symposium on the Pharmacology of Thermoregulation; Cooper, K., Lomax, P., Schonbaum, E., Veale, W.L., Eds.; Karger: Jasper, Alta, 1986; pp. 46–48. [Google Scholar]
- Mondon, C.E.; Dolkas, C.B.; Reaven, G.M. Site of enhanced insulin sensitivity in exercise-trained rats at rest. Am. J. Physiol. 1980, 239, E169–E177. [Google Scholar] [CrossRef] [PubMed]
- Mercer, S.W.; Trayhurn, P. The development of insulin resistance in brown adipose tissue may impair the acute cold-induced activation of thermogenesis in genetically obese (ob/ob) mice. Biosci. Rep. 1984, 4, 933–940. [Google Scholar] [CrossRef] [PubMed]
- Arnold, J.; Richard, D. Exercise during intermittent cold exposure prevents acclimation to cold rats. J. Physiol. 1987, 390, 45–54. [Google Scholar] [CrossRef] [PubMed]
- Hawley, J.A.; Morton, J.P. Ramping up the signal: Promoting endurance training adaptation in skeletal muscle by nutritional manipulation. Clin. Exp. Pharmacol. Physiol. 2014, 41, 608–613. [Google Scholar] [CrossRef] [PubMed]
- Hawley, J.A. Adaptations of skeletal muscle to prolonged, intense endurance training. Clin. Exp. Pharmacol. Physiol. 2002, 29, 218–222. [Google Scholar] [CrossRef]
- Hood, D.A. Invited Review: Contractile activity-induced mitochondrial biogenesis in skeletal muscle. J. Appl. Physiol. (1985) 2001, 90, 1137–1157. [Google Scholar] [CrossRef] [PubMed]
- Holloszy, J.O. Biochemical adaptations in muscle. Effects of exercise on mitochondrial oxygen uptake and respiratory enzyme activity in skeletal muscle. J. Biol. Chem. 1967, 242, 2278–2282. [Google Scholar]
- Parra, J.; Cadefau, J.A.; Rodas, G.; Amigó, N.; Cussó, R. The distribution of rest periods affects performance and adaptations of energy metabolism induced by high-intensity training in human muscle. Acta Physiol. Scand. 2000, 169, 157–165. [Google Scholar] [CrossRef]
- Perry, C.G.; Talanian, J.L.; Heigenhauser, G.J.; Spriet, L.L. The effects of training in hyperoxia vs. normoxia on skeletal muscle enzyme activities and exercise performance. J. Appl. Physiol. (1985) 2007, 102, 1022–1027. [Google Scholar] [CrossRef][Green Version]
- MacInnis, M.J.; Gibala, M.J. Physiological adaptations to interval training and the role of exercise intensity. J. Physiol. 2017, 595, 2915–2930. [Google Scholar] [CrossRef]
- Gollnick, P.D.; King, D.W. Effect of exercise and training on mitochondria of rat skeletal muscle. Am. J. Physiol. 1969, 216, 1502–1509. [Google Scholar] [CrossRef]
- Oscai, L.B.; Holloszy, J.O. Biochemical adaptations in muscle. II. Response of mitochondrial adenosine triphosphatase, creatine phosphokinase, and adenylate kinase activities in skeletal muscle to exercise. J. Biol. Chem. 1971, 246, 6968–6972. [Google Scholar] [CrossRef] [PubMed]
- Varnauskas, E.; Björntorp, P.; Fahlén, M.; Prerovský, I.; Stenberg, J. Effects of physical training on exercise blood flow and enzymatic activity in skeletal muscle. Cardiovasc. Res. 1970, 4, 418–422. [Google Scholar] [CrossRef]
- Booth, F.W.; Narahara, K.A. Vastus lateralis cytochrome oxidase activity and its relationship to maximal oxygen consumption in man. Pflug. Arch. 1974, 349, 319–324. [Google Scholar] [CrossRef]
- Hoppeler, H.; Lüthi, P.; Claassen, H.; Weibel, E.R.; Howald, H. The ultrastructure of the normal human skeletal muscle. A morphometric analysis on untrained men, women and well-trained orienteers. Pflug. Arch. 1973, 344, 217–232. [Google Scholar] [CrossRef] [PubMed]
- Kiessling, K.H.; Pilström, L.; Bylund, A.C.; Saltin, B.; Piehl, K. Enzyme activities and morphometry in skeletal muscle of middle-aged men after training. Scand. J. Clin. Lab. Investig. 1974, 33, 63–69. [Google Scholar] [CrossRef] [PubMed]
- Holloszy, J.O.; Booth, F.W. Biochemical adaptations to endurance exercise in muscle. Annu. Rev. Physiol. 1976, 38, 273–291. [Google Scholar] [CrossRef]
- Gollnick, P.D.; Saltin, B. Significance of skeletal muscle oxidative enzyme enhancement with endurance training. Clin. Physiol. 1982, 2, 1–12. [Google Scholar] [CrossRef]
- Dudley, G.A.; Tullson, P.C.; Terjung, R.L. Influence of mitochondrial content on the sensitivity of respiratory control. J. Biol. Chem. 1987, 262, 9109–9114. [Google Scholar] [CrossRef] [PubMed]
- Williams, R.S.; Salmons, S.; Newsholme, E.A.; Kaufman, R.E.; Mellor, J. Regulation of nuclear and mitochondrial gene expression by contractile activity in skeletal muscle. J. Biol. Chem. 1986, 261, 376–380. [Google Scholar] [CrossRef] [PubMed]
- Scarpulla, R.C. Nuclear control of respiratory gene expression in mammalian cells. J. Cell. Biochem. 2006, 97, 673–683. [Google Scholar] [CrossRef] [PubMed]
- Sadana, P.; Park, E.A. Characterization of the transactivation domain in the peroxisome-proliferator-activated receptor γ co-activator (PGC-1). Biochem. J. 2007, 403, 511–518. [Google Scholar] [CrossRef] [PubMed]
- Meirhaeghe, A.; Crowley, V.; Lenaghan, C.; Lelliott, C.; Green, K.; Stewart, A.; Hart, K.; Schinner, S.; Sethi, J.K.; Yeo, G.; et al. Characterization of the human, mouse and rat PGC1β (peroxisome-proliferator-activated receptor-γ co-activator 1 β) gene in vitro and in vivo. Biochem. J. 2003, 373, 155–165. [Google Scholar] [CrossRef] [PubMed]
- Edgett, B.A.; Foster, W.S.; Hankinson, P.B.; Simpson, C.A.; Little, J.P.; Graham, R.B.; Gurd, B.J. Dissociation of increases in PGC-1α and its regulators from exercise intensity and muscle activation following acute exercise. PLoS ONE 2013, 8, e71623. [Google Scholar] [CrossRef]
- Kuhl, J.E.; Ruderman, N.B.; Musi, N.; Goodyear, L.J.; Patti, M.E.; Crunkhorn, S.; Dronamraju, D.; Thorell, A.; Nygren, J.; Ljungkvist, O.; et al. Exercise training decreases the concentration of malonyl-CoA and increases the expression and activity of malonyl-CoA decarboxylase in human muscle. Am. J. Physiol. Endocrinol. Metab. 2006, 290, E1296–E1303. [Google Scholar] [CrossRef] [PubMed]
- Perry, C.G.; Lally, J.; Holloway, G.P.; Heigenhauser, G.J.; Bonen, A.; Spriet, L.L. Repeated transient mRNA bursts precede increases in transcriptional and mitochondrial proteins during training in human skeletal muscle. J. Physiol. 2010, 588, 4795–4810. [Google Scholar] [CrossRef]
- Granata, C.; Oliveira, R.S.; Little, J.P.; Renner, K.; Bishop, D.J. Training intensity modulates changes in PGC-1α and p53 protein content and mitochondrial respiration, but not markers of mitochondrial content in human skeletal muscle. FASEB J. 2016, 30, 959–970. [Google Scholar] [CrossRef]
- Saleem, A.; Carter, H.N.; Hood, D.A. p53 is necessary for the adaptive changes in cellular milieu subsequent to an acute bout of endurance exercise. Am. J. Physiol. Cell Physiol. 2014, 306, C241–C249. [Google Scholar] [CrossRef]
- Winder, W.W.; Holmes, B.F.; Rubink, D.S.; Jensen, E.B.; Chen, M.; Holloszy, J.O. Activation of AMP-activated protein kinase increases mitochondrial enzymes in skeletal muscle. J. Appl. Physiol. (1985) 2000, 88, 2219–2226. [Google Scholar] [CrossRef] [PubMed]
- Wadley, G.D.; Lee-Young, R.S.; Canny, B.J.; Wasuntarawat, C.; Chen, Z.P.; Hargreaves, M.; Kemp, B.E.; McConell, G.K. Effect of exercise intensity and hypoxia on skeletal muscle AMPK signaling and substrate metabolism in humans. Am. J. Physiol. Endocrinol. Metab. 2006, 290, E694–E702. [Google Scholar] [CrossRef] [PubMed]
- McConell, G.K.; Lee-Young, R.S.; Chen, Z.P.; Stepto, N.K.; Huynh, N.N.; Stephens, T.J.; Canny, B.J.; Kemp, B.E. Short-term exercise training in humans reduces AMPK signalling during prolonged exercise independent of muscle glycogen. J. Physiol. 2005, 568, 665–676. [Google Scholar] [CrossRef] [PubMed]
- Smolenski, R.T.; Lachno, D.R.; Ledingham, S.J.M.; Yacoub, M.H. Determination of sixteen nucleotides, nucleosides and bases using high-performance liquid chromatography and its application to the study of purine metabolism in hearts for transplantation. J. Chromatogr. 1990, 527, 414–420. [Google Scholar] [CrossRef] [PubMed]










| Male | Female | |||||
|---|---|---|---|---|---|---|
| Control | Group 5 °C | Group 36 °C | Control | Group 5 °C | Group 36 °C | |
| Mfn1 | +/− | +++ | ++ | +/− | ++ | ++ |
| Mfn2 | + | ++ | ++ | + | ++ | ++ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bosiacki, M.; Tarnowski, M.; Misiakiewicz-Has, K.; Lubkowska, A. The Effect of Cold-Water Swimming on Energy Metabolism, Dynamics, and Mitochondrial Biogenesis in the Muscles of Aging Rats. Int. J. Mol. Sci. 2024, 25, 4055. https://doi.org/10.3390/ijms25074055
Bosiacki M, Tarnowski M, Misiakiewicz-Has K, Lubkowska A. The Effect of Cold-Water Swimming on Energy Metabolism, Dynamics, and Mitochondrial Biogenesis in the Muscles of Aging Rats. International Journal of Molecular Sciences. 2024; 25(7):4055. https://doi.org/10.3390/ijms25074055
Chicago/Turabian StyleBosiacki, Mateusz, Maciej Tarnowski, Kamila Misiakiewicz-Has, and Anna Lubkowska. 2024. "The Effect of Cold-Water Swimming on Energy Metabolism, Dynamics, and Mitochondrial Biogenesis in the Muscles of Aging Rats" International Journal of Molecular Sciences 25, no. 7: 4055. https://doi.org/10.3390/ijms25074055
APA StyleBosiacki, M., Tarnowski, M., Misiakiewicz-Has, K., & Lubkowska, A. (2024). The Effect of Cold-Water Swimming on Energy Metabolism, Dynamics, and Mitochondrial Biogenesis in the Muscles of Aging Rats. International Journal of Molecular Sciences, 25(7), 4055. https://doi.org/10.3390/ijms25074055

