Identification of New Genes and Genetic Variant Loci Associated with Breast Muscle Development in the Mini-Cobb F2 Chicken Population Using a Genome-Wide Association Study
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Experimentation Ethical Statement
2.2. Animals and Management
2.3. Phenotypes
2.4. Whole Genome Sequencing and Quality Control
2.5. Genome-Wide Association Study
2.6. SNP Identification, Candidate Gene Annotation, and QTL Overlapping
2.7. mRNA Expression Analysis
2.8. Statistical Analysis
3. Results
3.1. Breast Muscle Development-Related Traits in the F2 Population and Correlation Analysis
3.2. Genetic Variation in the F2 Population
3.3. Candidate SNPs and Genes
3.4. Comparing with Previous QTL
3.5. GO Annotation
3.6. The Relationship between Breast Muscle Weight and the Expression Levels of Candidate Genes
4. Discussion
4.1. Traits and Correlation Coefficients
4.2. Selecting of Candidate SNP
4.3. Candidate Genes
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Scheuermann, G.N.; Bilgili, S.F.; Hess, J.B.; Mulvaney, D.R. Breast muscle development in commercial broiler chickens. Poult. Sci. 2003, 82, 1648–1658. [Google Scholar] [CrossRef] [PubMed]
- Ali, M.; Lee, S.Y.; Park, J.Y.; Jung, S.; Jo, C.; Nam, K.C. Comparison of Functional Compounds and Micronutrients of Chicken Breast Meat by Breeds. Food Sci. Anim. Resour. 2019, 39, 632–642. [Google Scholar] [CrossRef] [PubMed]
- Chumngoen, W.; Tan, F.J. Relationships between Descriptive Sensory Attributes and Physicochemical Analysis of Broiler and Taiwan Native Chicken Breast Meat. Asian Australas J. Anim. Sci. 2015, 28, 1028–1037. [Google Scholar] [CrossRef]
- Dehghan, A. Genome-Wide Association Studies. Methods Mol. Biol. 2018, 1793, 37–49. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Glubb, D.M.; O’Mara, T.A. 10 Years of GWAS discovery in endometrial cancer: Aetiology, function and translation. EBioMedicine 2022, 77, 103895. [Google Scholar] [CrossRef] [PubMed]
- Meigs, J.B. The Genetic Epidemiology of Type 2 Diabetes: Opportunities for Health Translation. Curr. Diab. Rep. 2019, 19, 62. [Google Scholar] [CrossRef] [PubMed]
- Horwitz, T.; Lam, K.; Chen, Y.; Xia, Y.; Liu, C. A decade in psychiatric GWAS research. Mol. Psychiatry 2019, 24, 378–389. [Google Scholar] [CrossRef]
- Luo, Y.; Zhang, M.; Liu, Y.; Liu, J.; Li, W.; Chen, G.; Peng, Y.; Jin, M.; Wei, W.; Jian, L.; et al. Genetic variation in YIGE1 contributes to ear length and grain yield in maize. New Phytol. 2022, 234, 513–526. [Google Scholar] [CrossRef]
- Vikas, V.K.; Pradhan, A.K.; Budhlakoti, N.; Mishra, D.C.; Chandra, T.; Bhardwaj, S.C.; Kumar, S.; Sivasamy, M.; Jayaprakash, P.; Nisha, R.; et al. Multi-locus genome-wide association studies (ML-GWAS) reveal novel genomic regions associated with seedling and adult plant stage leaf rust resistance in bread wheat (Triticum aestivum L.). Heredity 2022, 128, 434–449. [Google Scholar] [CrossRef]
- Sheet, S.; Kim, J.S.; Ko, M.J.; Kim, N.Y.; Lim, Y.J.; Park, M.R.; Lee, S.J.; Kim, J.M.; Oh, S.I.; Choi, B.H. Insight into the Candidate Genes and Enriched Pathways Associated with Height, Length, Length to Height Ratio and Body-Weight of Korean Indigenous Breed, Jindo Dog Using Gene Set Enrichment-Based GWAS Analysis. Animals 2021, 11, 3136. [Google Scholar] [CrossRef]
- Tao, L.; He, X.Y.; Pan, L.X.; Wang, J.W.; Gan, S.Q.; Chu, M.X. Genome-wide association study of body weight and conformation traits in neonatal sheep. Anim. Genet. 2020, 51, 336–340. [Google Scholar] [CrossRef] [PubMed]
- Tan, X.; Liu, L.; Liu, X.; Cui, H.; Liu, R.; Zhao, G.; Wen, J. Large-Scale Whole Genome Sequencing Study Reveals Genetic Architecture and Key Variants for Breast Muscle Weight in Native Chickens. Genes 2021, 13, 3. [Google Scholar] [CrossRef] [PubMed]
- Xie, L.; Luo, C.; Zhang, C.; Zhang, R.; Tang, J.; Nie, Q.; Ma, L.; Hu, X.; Li, N.; Da, Y.; et al. Genome-wide association study identified a narrow chromosome 1 region associated with chicken growth traits. PLoS ONE 2012, 7, e30910. [Google Scholar] [CrossRef] [PubMed]
- Kang, H.; Zhao, D.; Xiang, H.; Li, J.; Zhao, G.; Li, H. Large-scale transcriptome sequencing in broiler chickens to identify candidate genes for breast muscle weight and intramuscular fat content. Genet. Sel. Evol. 2021, 53, 66. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Sun, Y.; Zhao, G.; Wang, H.; Zheng, M.; Li, P.; Liu, L.; Wen, J. Identification of loci and genes for growth related traits from a genome-wide association study in a slow- x fast-growing broiler chicken cross. Genes Genom. 2015, 37, 829–836. [Google Scholar] [CrossRef]
- Liu, L.X.; Dou, T.F.; Li, Q.H.; Rong, H.; Tong, H.Q.; Xu, Z.Q.; Huang, Y.; Gu, D.H.; Chen, X.B.; Ge, C.R.; et al. Myostatin mRNA expression and its association with body weight and carcass traits in Yunnan Wuding chicken. Genet. Mol. Res. 2016, 15, 3001–3004. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Sun, C.; Xu, N.; Bian, P.; Tian, X.; Wang, X.; Wang, Y.; Jia, X.; Heller, R.; Wang, M.; et al. De Novo Assembly of 20 Chicken Genomes Reveals the Undetectable Phenomenon for Thousands of Core Genes on Microchromosomes and Subtelomeric Regions. Mol. Biol. Evol. 2022, 39, msac066. [Google Scholar] [CrossRef] [PubMed]
- Jia, X.X.; Tang, X.J.; Lu, J.X.; Fan, Y.F.; Chen, D.W.; Tang, M.J.; Gu, R.; Gao, Y.S. The investigation of genetic diversity and evolution of Daweishan Mini chicken based on the complete mitochondrial (mt)DNA D-loop region sequence. Mitochondrial DNA Part A 2016, 27, 3001–3004. [Google Scholar] [CrossRef]
- Dou, T.; Zhao, S.; Rong, H.; Gu, D.; Li, Q.; Huang, Y.; Xu, Z.; Chu, X.; Tao, L.; Liu, L.; et al. Biological mechanisms discriminating growth rate and adult body weight phenotypes in two Chinese indigenous chicken breeds. BMC Genom. 2017, 18, 469. [Google Scholar] [CrossRef]
- Dou, T.; Li, Z.; Wang, K.; Liu, L.; Rong, H.; Xu, Z.; Huang, Y.; Gu, D.; Chen, X.; Hu, W.; et al. Regulation of myostatin expression is associated with growth and muscle development in commercial broiler and DMC muscle. Mol. Biol. Rep. 2018, 45, 511–522. [Google Scholar] [CrossRef]
- Li, H.; Durbin, R. Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics 2010, 26, 589–595. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Li, M.; Hakonarson, H. ANNOVAR: Functional annotation of genetic variants from high-throughput sequencing data. Nucleic. Acids. Res. 2010, 38, e164. [Google Scholar] [CrossRef] [PubMed]
- Purcell, S.; Neale, B.; Todd-Brown, K.; Thomas, L.; Ferreira, M.; Bender, D.; Maller, J.; Sklar, P.; de Bakker, P.; Daly, M.J.; et al. PLINK: A tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 2007, 81, 559–575. [Google Scholar] [CrossRef]
- Zhou, X.; Stephens, M. Genome-wide efficient mixed-model analysis for association studies. Nat. Genet. 2012, 44, 821–824. [Google Scholar] [CrossRef] [PubMed]
- Alexander, D.H.; Novembre, J.; Lange, K. Fast model-based estimation of ancestry in unrelated individuals. Genome. Res. 2009, 19, 1655–1664. [Google Scholar] [CrossRef]
- Yang, J.; Lee, S.H.; Goddard, M.E.; Visscher, P.M. GCTA: A tool for genome-wide complex trait analysis. Am. J. Hum. Genet. 2011, 88, 76–82. [Google Scholar] [CrossRef]
- Wang, H.; Wang, X.; Yan, D.; Sun, H.; Chen, Q.; Li, M.; Dong, X.; Pan, Y.; Lu, S. Genome-wide association study identifying genetic variants associated with carcass backfat thickness, lean percentage and fat percentage in a four-way crossbred pig population using SLAF-seq technology. BMC Genom. 2022, 23, 594. [Google Scholar] [CrossRef]
- Williams, S.M.; Price, S.E.; Siegel, P.B. Heterosis of growth and reproductive traits in fowl. Poult. Sci. 2002, 81, 1109–1112. [Google Scholar] [CrossRef]
- Silva, S.R.; Pinheiro, V.M.; Guedes, C.M.; Mourao, J.L. Prediction of carcase and breast weights and yields in broiler chickens using breast volume determined in vivo by real-time ultrasonic measurement. Br. Poult. Sci. 2006, 47, 694–699. [Google Scholar] [CrossRef]
- Zheng, H.K.; Fang, C.; Zhang, T.M.; Zhao, H.Z.; Yang, J.K.; Ma, C. Shank length and circumference measurement algorithm of breeder chickens based on extraction of regional key points. Comput. Electron. Agr. 2022, 197, 106989. [Google Scholar] [CrossRef]
- Van den Heuvel, E.; Zhan, Z.Z. Myths About Linear and Monotonic Associations: Pearson’s r, Spearman’s rho, and Kendall’s tau. Am. Stat. 2022, 76, 44–52. [Google Scholar] [CrossRef]
- Wang, H.; Wang, X.; Li, M.; Sun, H.; Chen, Q.; Yan, D.; Dong, X.; Pan, Y.; Lu, S. Genome-Wide Association Study of Growth Traits in a Four-Way Crossbred Pig Population. Genes 2022, 13, 1990. [Google Scholar] [CrossRef]
- de Winter, J.; Gosling, S.D.; Potter, J. Comparing the Pearson and Spearman Correlation Coefficients Across Distributions and Sample Sizes: A Tutorial Using Simulations and Empirical Data. Psychol. Methods 2016, 21, 273–290. [Google Scholar] [CrossRef] [PubMed]
- Armstrong, R.A. Should Pearson’s correlation coefficient be avoided? Ophthal. Physl. Opt. 2019, 39, 316–327. [Google Scholar] [CrossRef]
- Cheng, Y.Y.; Burt, D.W. Chicken genomics. Int. J. Dev. Biol. 2018, 62, 265–271. [Google Scholar] [CrossRef]
- Emrani, H.; Masoudi, A.A.; Vaez, T.R.; Ehsani, A. Genome-wide association study of shank length and diameter at different developmental stages in chicken F2 resource population. Anim. Genet. 2020, 51, 722–730. [Google Scholar] [CrossRef]
- Zhu, B.; Li, Q.H.; Liu, R.R.; Zheng, M.Q.; Wen, J.; Zhao, G.P. Genome-Wide Association Study of H/L Traits in Chicken. Animals 2019, 9, 260. [Google Scholar] [CrossRef]
- Rice, T.K.; Schork, N.J.; Rao, D.C. Methods for handling multiple testing. Adv. Genet. 2008, 60, 293–308. [Google Scholar] [CrossRef]
- Cilensek, I.; Seruga, M.; Makuc, J.; Zavrsnik, M.; Petrovic, D. The ALOXA5AP gene (rs38022789) is associated with diabetic nephropathy in Slovenian patients with type 2 diabetes mellitus. Gene 2020, 741, 144551. [Google Scholar] [CrossRef]
- Zhang, Y.; Yang, J.; Zhang, J.; Sun, L.; Hirankarn, N.; Pan, H.F.; Lau, C.S.; Chan, T.M.; Lee, T.L.; Leung, A.M.; et al. Genome-wide search followed by replication reveals genetic interaction of CD80 and ALOX5AP associated with systemic lupus erythematosus in Asian populations. Ann. Rheum. Dis. 2016, 75, 891–898. [Google Scholar] [CrossRef] [PubMed]
- Kowal-Bielecka, O.; Chwiesko-Minarowska, S.; Bernatowicz, P.L.; Allanore, Y.; Radstake, T.; Matucci-Cerinic, M.; Broen, J.; Hesselstrand, R.; Krasowska, D.; Riemekasten, G.; et al. The arachidonate 5-lipoxygenase activating protein gene polymorphism is associated with the risk of scleroderma-related interstitial lung disease: A multicentre European Scleroderma Trials and Research group (EUSTAR) study. Rheumatology 2017, 56, 844–852. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Werner, J.U.; Todter, K.; Xu, P.; Lockhart, L.; Jahnert, M.; Gottmann, P.; Schurmann, A.; Scheja, L.; Wabitsch, M.; Knippschild, U. Comparison of Fatty Acid and Gene Profiles in Skeletal Muscle in Normal and Obese C57BL/6J Mice before and after Blunt Muscle Injury. Front. Physiol 2018, 9, 19. [Google Scholar] [CrossRef] [PubMed]
- Prisco, F.; De Biase, D.; Piegari, G.; D’Aquino, I.; Lama, A.; Comella, F.; Mercogliano, R.; Dipineto, L.; Papparella, S.; Paciello, O. Pathologic characterization of white striping myopathy in broiler chickens. Poult. Sci. 2021, 100, 101150. [Google Scholar] [CrossRef] [PubMed]
- Soglia, F.; Baldi, G.; Laghi, L.; Mudalal, S.; Cavani, C.; Petracci, M. Effect of white striping on turkey breast meat quality. Animal 2018, 12, 2198–2204. [Google Scholar] [CrossRef]
- Schulz, S.; Chachami, G.; Kozaczkiewicz, L.; Winter, U.; Stankovic-Valentin, N.; Haas, P.; Hofmann, K.; Urlaub, H.; Ovaa, H.; Wittbrodt, J.; et al. Ubiquitin-specific protease-like 1 (USPL1) is a SUMO isopeptidase with essential, non-catalytic functions. EMBO Rep. 2012, 13, 930–938. [Google Scholar] [CrossRef]
- Hutten, S.; Chachami, G.; Winter, U.; Melchior, F.; Lamond, A.I. A role for the Cajal-body-associated SUMO isopeptidase USPL1 in snRNA transcription mediated by RNA polymerase II. J. Cell Sci. 2014, 127, 1065–1078. [Google Scholar] [CrossRef]
- Aromolaran, K.A.; Benzow, K.A.; Cribbs, L.L.; Koob, M.D.; Piedras-Renteria, E.S. T-type current modulation by the actin-binding protein Kelch-like 1. Am. J. Physiol. Cell Physiol. 2010, 298, C1353–C1362. [Google Scholar] [CrossRef]
- Wang, C.; Tao, B.; Li, S.; Li, B.; Wang, X.; Hu, G.; Li, W.; Yu, Y.; Lu, Y.; Liu, J. Characterizing the role of PCDH9 in the regulation of glioma cell apoptosis and invasion. J. Mol. Neurosci. 2014, 52, 250–260. [Google Scholar] [CrossRef]
- Wu, Q.; Shi, X.; Pan, Y.; Liao, X.; Xu, J.; Gu, X.; Yu, W.; Chen, Y.; Yu, G. The Chemopreventive Role of β-Elemene in Cholangiocarcinoma by Restoring PCDH9 Expression. Front. Oncol. 2022, 12, 874457. [Google Scholar] [CrossRef]
- Asahina, H.; Masuba, A.; Hirano, S.; Yuri, K. Distribution of protocadherin 9 protein in the developing mouse nervous system. Neuroscience 2012, 225, 88–104. [Google Scholar] [CrossRef] [PubMed]
- Lin, J.; Wang, C.; Redies, C. Expression of delta-protocadherins in the spinal cord of the chicken embryo. J. Comp. Neurol. 2012, 520, 1509–1531. [Google Scholar] [CrossRef] [PubMed]
- Mandel, H.; Cohen, K.N.; Fedida, A.; Shuster, B.E.; Odeh, M.; Kalfon, L.; Ben-Harouch, S.; Fleischer, S.V.; Hoffman, Y.; Goldberg, Y.; et al. COG6-CDG: Expanding the phenotype with emphasis on glycosylation defects involved in the causation of male disorders of sex development. Clin. Genet. 2020, 98, 402–407. [Google Scholar] [CrossRef]
- Yuan, H.; Yuan, H.; Wang, Q.; Ye, W.; Yao, R.; Xu, W.; Liu, Y. Two novel KCNA1 variants identified in two unrelated Chinese families affected by episodic ataxia type 1 and neurodevelopmental disorders. Mol. Genet. Genomic. Med. 2020, 8, e1434. [Google Scholar] [CrossRef]
- Liu, Y.; Sun, Y.; Li, Y.; Bai, H.; Xu, S.; Xu, H.; Ni, A.; Yang, N.; Chen, J. Identification and differential expression of microRNAs in the testis of chicken with high and low sperm motility. Theriogenology 2018, 122, 94–101. [Google Scholar] [CrossRef]
- Gao, Q.; Khan, R.; Yu, C.; Alsheimer, M.; Jiang, X.; Ma, H.; Shi, Q. The testis-specific LINC component SUN3 is essential for sperm head shaping during mouse spermiogenesis. J. Biol. Chem. 2020, 295, 6289–6298. [Google Scholar] [CrossRef] [PubMed]
- Bhattacharjee, M.; Sharma, R.; Goel, R.; Balakrishnan, L.; Renuse, S.; Advani, J.; Gupta, S.T.; Verma, R.; Pinto, S.M.; Sekhar, N.R.; et al. A multilectin affinity approach for comparative glycoprotein profiling of rheumatoid arthritis and spondyloarthropathy. Clin. Proteom. 2013, 10, 11. [Google Scholar] [CrossRef]
- Yuan, L.; Pan, J.W.; Zhu, S.H.; Li, Y.; Yao, J.B.; Li, Q.L.; Fang, S.T.; Liu, C.Y.; Wang, X.Y.; Li, B.; et al. Evolution and Functional Divergence of SUN Genes in Plants. Front. Plant. Sci. 2021, 12, 646622. [Google Scholar] [CrossRef]
- Shah, M.; Arabia, S.; Islam, T.; Ghosh, A. Molecular evolution of SUN-domain containing proteins in diverse plant species and their expression profiling in response to developmental and perturbation stimuli. Phytochemistry 2019, 157, 28–42. [Google Scholar] [CrossRef]
- Munoz, L.M.; Zayachkivsky, A.; Kunz, R.B.; Hunt, J.M.; Wang, G.; Scott, S.A. Ephrin-A5 inhibits growth of embryonic sensory neurons. Dev. Biol. 2005, 283, 397–408. [Google Scholar] [CrossRef]
- Zmojdzian, M.; Jagla, K. The relationship between muscle stem cells and motor neurons. Cell. Mol. Life Sci. 2021, 78, 5043–5049. [Google Scholar] [CrossRef] [PubMed]
- Zhao, F.; Gong, X.; Liu, A.; Lv, X.; Hu, B.; Zhang, H. Downregulation of Nedd4L predicts poor prognosis, promotes tumor growth and inhibits MAPK/ERK signal pathway in hepatocellular carcinoma. Biochem. Biophys. Res. Commun. 2018, 495, 1136–1143. [Google Scholar] [CrossRef] [PubMed]
- Kuo, R.L.; Lin, Y.H.; Wang, R.Y.; Hsu, C.W.; Chiu, Y.T.; Huang, H.I.; Kao, L.T.; Yu, J.S.; Shih, S.R.; Wu, C.C. Proteomics analysis of EV71-infected cells reveals the involvement of host protein NEDD4L in EV71 replication. J. Proteome Res. 2015, 14, 1818–1830. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Gong, W.Y.; Liu, M.; Zhou, W.; Rao, J.; Li, Y.Q.; Wu, J.H.; Luo, D.; Wang, C.; Peng, H. A Variant in the NEDD4L Gene Associates With Hypertension in Chronic Kidney Disease in the Southeastern Han Chinese Population. Am. J. Hypertens. 2020, 33, 341–349. [Google Scholar] [CrossRef]
- Li, C.; Tian, D.; Tang, B.; Liu, X.; Teng, X.; Zhao, W.; Zhang, Z.; Song, S. Genome Variation Map: A worldwide collection of genome variations across multiple species. Nucleic Acids Res. 2021, 49, D1186–D1191. [Google Scholar] [CrossRef]
Components | 1–7 Weeks (%) | 8–14 Weeks (%) |
---|---|---|
Corn | 63.26 | 67.19 |
Soybean meal | 30.2 | 18.88 |
Wheat bran | 0.00 | 10.00 |
Fishmeal | 2.50 | 0.00 |
Coarse powder | 0.40 | 0.46 |
Fine stone powder | 0.71 | 0.60 |
Dicalcium phosphate | 1.50 | 1.50 |
Methionine | 0.08 | 0.07 |
Salt | 0.35 | 0.30 |
Metabolic energy | 13.02 | 12.80 |
Protein | 20.00 | 18.60 |
a Commercial premix | 1.00 | 1.00 |
Phenotypes | Measurement |
---|---|
Breast width | The straight-line distance on the body’s surface between two shoulder joints |
Breast depth | The distance from the first thoracic vertebra to the anterior edge of the keel |
Keel length | The distance from the front of the keel protrusion to the end |
Full evisceration weight | The weight of the body after respiratory organs, digestive organs, reproductive organs, heart, abdominal fat, head, and feet removal |
Breast muscle weight | The weight of the breast after skin and adherent fat removal |
Sternum weight | The weight of sternum after muscle removal |
Gene | ID | Primer sequence (5′-3′) | Length (bp) | Produce Size (bp) | Annealing Temperature (°C) |
---|---|---|---|---|---|
GADPH | NM_204305.2 | F: GACAGCCATTCCTCCACCTT R: AACTGAGCGGTGGTGAAGAG | 20 20 | 222 | 59 |
ALOX5AP | NM_001278144.2 | F: GGCAGAAGTACTTTGTGGGC R: TATGTGAAGCAGGCTGACCC | 20 20 | 243 | 59 |
USPL1 | NM_001162393.3 | F: GGGAGAAAGGTCACTGATATCACAC R: AGAGGGAAGCAACACAAAAGTAAAC | 20 25 | 281 | 59 |
CHRNA9 | NM_204760.2 | F: GCTGTTCACAGCCACGATGC R: TGCATCATACCAGCTTTGTCGAA | 20 23 | 232 | 61 |
EFNA5 | NM_001397572.1 | F: CCAGATTCCAGCAGGGAGACT R: CCCACCTCTTGAACCCTTTGG | 21 21 | 180 | 60 |
Trait | Sample Size | Max | Min | Mean | a Sd | b Cv (%) |
---|---|---|---|---|---|---|
Body weight (g) | 478 | 3030.5 | 648.0 | 1569.05 | 363.25 | 23 |
Breast muscle weight (g) | 478 | 616.0 | 73.0 | 213.92 | 70.25 | 33 |
Sternum weight (g) | 478 | 231.0 | 43.5 | 90.42 | 30.16 | 33 |
Breast width (mm) | 478 | 95.54 | 45.08 | 70.59 | 7.52 | 11 |
Breast depth (mm) | 478 | 113.49 | 49.30 | 83.0 | 11.61 | 14 |
Keel length (mm) | 478 | 165.21 | 63.46 | 98.11 | 9.85 | 10 |
Full evisceration weight (g) | 478 | 1961 | 312 | 1054.15 | 267.92 | 25 |
c Breast muscle percent (%) | 478 | 31.41 | 7.10 | 20.19 | 3.53 | 18 |
Trait a | SNP b | Pos (bp) c | MAF d | p-Value | −log10p | Allele | PVE (%) e | Genes f | Distance (bp) g |
---|---|---|---|---|---|---|---|---|---|
Breast muscle weight | rs731233898 | GGA1: 176412883 | 0.20 | 6.42 × 10−10 | 9.19 | G/C | 8.56 | ALOX5AP USPL1 | U:3688 U:16919 |
Breast percent | rs733077910 | GGA1: 159574698 | 0.3 | 4.67 × 10−12 | 11.33 | G/A | 10.44 | KLHL1 PCDH9 | D:282679 D:868651 |
rs738075929 | GGA1: 159575031 | 0.31 | 8.26 × 10−12 | 11.08 | G/C | 8.37 | |||
GGA1: 159574275 | 0.29 | 9.54 × 10−11 | 10.02 | A/G | 9.22 | ||||
GGA1: 73837197 | 0.26 | 8.26 × 10−12 | 12.03 | A/G | 10.33 | KCNA1 | D:38851 | ||
rs315941028 | GGAZ: 43140769 | 0.27 | 1.78 × 10−12 | 11.75 | G/A | 9.9 | gag-pro | D:8 | |
GGA2: 80832197 | 0.23 | 7.74 × 10−9 | 8.11 | A/G | 7.49 | Sun3 (LOC428505) | U:5539 | ||
Breast depth | GGA1: 73837197 | 0.26 | 6.7 × 10−9 | 8.17 | A/G | 9.73 | KCNA1 | D:12470 | |
rs733077910 | GGA1: 159574698 | 0.3 | 8.3 × 10−11 | 10.08 | G/A | 10.44 | KLHL1 PCDH9 | D:282679 D:868651 | |
rs738075929 | GGA1: 159575031 | 0.31 | 6.7 × 10−9 | 8.07 | G/C | 9.2 | |||
GGA1: 159574275 | 0.29 | 1.85 × 10−10 | 9.73 | A/G | 8.55 | ||||
GGAW: 3138376 | 0.22 | 7 × 10−11 | 10.15 | T/G | 10.68 | NEDD4L ERVK-8 | Intronic:0 U:11796 | ||
GGAW: 3138452 | 0.22 | 1.85 × 10−10 | 9.73 | A/G | 10.38 | ||||
rs315941028 | GGAZ: 43140769 | 0.27 | 4.77 × 10−10 | 9.32 | G/A | 10 | gag-pro | D:8 | |
GGA2: 80832197 | 0.23 | 9.16 × 10−9 | 8.03 | A/G | 7.85 | Sun3 (LOC428505) | U:5539 | ||
Body weight | GGA1: 73837197 | 0.26 | 9.16 × 10−21 | 20.87 | A/G | 20.7 | KCNA1 | D:12470 | |
rs733077910 | GGA1: 159574698 | 0.3 | 1.77 × 10−21 | 20.75 | G/A | 21.45 | KLHL1 PCDH9 | D:282679 D:868651 | |
rs738075929 | GGA1: 159575031 | 0.31 | 9.39 × 10−17 | 16.03 | G/C | 23.7 | |||
GGAW: 3138376 | 0.22 | 8.62 × 10−17 | 16.06 | T/G | 18.51 | NEDD4L ERVK-8 | Intronic:0 U:11796 | ||
rs731233898 | GGA1: 176412883 | 0.20 | 2.47 × 10−10 | 9.61 | G/C | 8.21 | ALOX5AP Uspl1 | U:3688 U:16919 | |
rs315941028 | GGAZ: 43140769 | 0.27 | 1.60 × 10−20 | 19.79 | G/A | 23.23 | gag-pro | D:8 | |
GGA2: 80832197 | 0.23 | 9.39 × 10−19 | 18.03 | A/G | 19.89 | Sun3 (LOC428505) | U:5539 | ||
Keel length | GGA1: 73837197 | 0.26 | 1.9 × 10−26 | 25.72 | A/G | 21.82 | KCNA1 | D:12470 | |
GGA2: 80832197 | 0.23 | 5.25 × 10−21 | 20.28 | A/G | 20.25 | Sun3 (LOC428505) | U:5539 | ||
GGAZ: 48759869 | 0.02 | 9.52 × 10−9 | 8.02 | G/T | 5.32 | EFNA5 | D:424581 | ||
rs733077910 | GGA1: 159574698 | 0.3 | 3.58 × 10−24 | 23.45 | G/A | 23.21 | KLHL1 PCDH9 | D:282679 D:868651 | |
rs738075929 | GGA1: 159575031 | 0.31 | 4.49 × 10−25 | 24.35 | G/C | 24.22 | |||
GGA1: 159574275 | 0.29 | 3.07 × 10−24 | 23.51 | A/G | 23.4 | ||||
rs313037222 | GGA4: 68943073 | 0.12 | 1.34 × 10−8 | 7.87 | C/T | 5.6 | Rbm47 CHRNA9 | D:9239 U:20141 | |
rs13973830 | GGA1: 172204015 | 0.33 | 1.39 × 10−8 | 7.86 | T/C | 9.24 | COG6 | U:14052 | |
rs315941028 | GGAZ: 43140769 | 0.27 | 1.19 × 10−22 | 21.93 | G/A | 24.29 | gag-pro | D:8 | |
GGAW: 3138452 | 0.22 | 5.26 × 10−21 | 20.28 | A/G | 19.27 | NEDD4L ERVK-8 | Intronic:0 U:11796 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, Y.; Shi, H.; Li, Z.; Kang, J.; Li, M.; Liu, M.; Liu, Y.; Zhao, J.; Dou, T.; Jia, J.; et al. Identification of New Genes and Genetic Variant Loci Associated with Breast Muscle Development in the Mini-Cobb F2 Chicken Population Using a Genome-Wide Association Study. Genes 2022, 13, 2153. https://doi.org/10.3390/genes13112153
He Y, Shi H, Li Z, Kang J, Li M, Liu M, Liu Y, Zhao J, Dou T, Jia J, et al. Identification of New Genes and Genetic Variant Loci Associated with Breast Muscle Development in the Mini-Cobb F2 Chicken Population Using a Genome-Wide Association Study. Genes. 2022; 13(11):2153. https://doi.org/10.3390/genes13112153
Chicago/Turabian StyleHe, Yang, Hongmei Shi, Zijian Li, Jiajia Kang, Mengyuan Li, Mengqian Liu, Yong Liu, Jinbo Zhao, Tengfei Dou, Junjing Jia, and et al. 2022. "Identification of New Genes and Genetic Variant Loci Associated with Breast Muscle Development in the Mini-Cobb F2 Chicken Population Using a Genome-Wide Association Study" Genes 13, no. 11: 2153. https://doi.org/10.3390/genes13112153
APA StyleHe, Y., Shi, H., Li, Z., Kang, J., Li, M., Liu, M., Liu, Y., Zhao, J., Dou, T., Jia, J., Duan, Y., Wang, K., & Ge, C. (2022). Identification of New Genes and Genetic Variant Loci Associated with Breast Muscle Development in the Mini-Cobb F2 Chicken Population Using a Genome-Wide Association Study. Genes, 13(11), 2153. https://doi.org/10.3390/genes13112153