Next Article in Journal
Evolutionary Comparison of the Complete Chloroplast Genomes in Convallaria Species and Phylogenetic Study of Asparagaceae
Previous Article in Journal
Long-Read Transcriptome of Equine Bronchoalveolar Cells
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

DDT Resistance in Anopheles pharoensis from Northern Cameroon Associated with High Cuticular Hydrocarbon Production

by
Nelly Armanda Kala-Chouakeu
1,2,
Edmond Kopya
2,3,
Vasileia Balabanidou
4,
Borel Tchamen Djiappi
1,2,
Kyriaki Maria Papapostolou
4,
Timoléon Tchuinkam
1,2 and
Christophe Antonio-Nkondjio
2,*
1
Vector-Borne Diseases Laboratory of the Applied Biology and Ecology Research Unit (VBID-URBEA), Department of Animal Biology, Faculty of Science, University of Dschang, Dschang P.O. Box 067, Cameroon
2
Laboratoire de Recherche sur le Paludisme, Organisation de Coordination Pour la lutte contre les Endémies en Afrique Centrale (OCEAC), Yaoundé P.O. Box 288, Cameroon
3
Faculty of Sciences, University of Yaoundé I, Yaoundé P.O. Box 337, Cameroon
4
Institute of Molecular Biology and Biotechnology, Foundation for Research and Technology Hellas, 71110 Heraklion, Greece
*
Author to whom correspondence should be addressed.
Genes 2022, 13(10), 1723; https://doi.org/10.3390/genes13101723
Submission received: 15 August 2022 / Revised: 5 September 2022 / Accepted: 21 September 2022 / Published: 25 September 2022
(This article belongs to the Section Animal Genetics and Genomics)

Abstract

Despite the contribution of secondary vectors to malaria transmission, there is still not enough information on their susceptibility status to insecticides. The present study assesses the resistance profile of Anopheles pharoensis to DDT. WHO tube tests were used to screen mosquito populations collected from the far-north region of Cameroon for susceptibility to 4% DDT. High DDT resistance in An. pharoensis populations from Maga, Simatou and Yangah with mortality rates ranging from 62.79% to 80% was recorded. Direct sequencing (Sanger) of the VGSC gene was undertaken to search for kdr L1014F/S mutations. However, no kdr allele was detected in the resistant samples. We then looked for cuticle alterations and CHC identification and quantitation were undertaken using GC-MS and GC-FID. High production of cuticular hydrocarbon was recorded in the populations of Yangah and Simatou, with 2420.9 ± 265 and 2372.5 ± 225 ng CHCs/mg dry weight, respectively. The present findings are the first ever describing the development of cuticle resistance in An. pharoensis. The data suggest the need to expand surveillance activities on other vector species.

1. Introduction

Cameroon is among the eleven countries most affected by malaria in the world [1]. Alongside the rapid expansion of insecticide resistance in malaria vectors, the continuous burden of malaria in Cameroon also results from the diversity of vector species taking part in transmission [2,3]. Over 17 species have been reported as major or secondary malaria vectors in the country [2,3]. In dry savannah areas, apart from the major vectors An. gambiae s.l. and An. funestus, species such as An. pharoensis are frequently found to be infected with Plasmodium falciparum and thus contribute to malaria transmission [2,4]. An. pharoensis is a species which has been reported in Cameroon since the 1950s, mainly distributed in the northern part of the country, and is considered to display an opportunistic feeding behaviour, feeding predominantly on domestic animals [2]. An. pharoensis larvae breed in large vegetated swamps along the shores of lakes in the grass zone. The species is also very common in rice fields, along the edges of streams and temporary flooded areas [5]. An. pharoensis is considered to be distributed in many places across Africa. Its distribution extends from Mauritania to Sudan in the north and to South Africa in the south. Many recent studies have documented its presence in countries such as Ethiopia, Nigeria, DRC, Tanzania, Uganda, Cameroon, Benin, Chad, Burundi, Senegal [2,6,7,8,9]. In most places, the species is abundant towards the end of the rainy season; it can also be recorded in high densities during the dry season when flooded areas persist [5]. An. pharoensis is capable of remarkably long migratory flights [10]. The species bites both indoors and outdoors and enters houses at night, but few rest indoors. Studies conducted in Ethiopia indicated increasing resistance level in this species to different compounds including DDT and pyrethroids [11].
Despite the increasing number of studies reporting the rapid expansion of insecticide resistance in both An. gambiae and An. funestus in Cameroon, there is still not enough data on the susceptibility status and profile of resistance mechanisms in other malaria vectors to insecticide commonly used in public health. Studies conducted recently indicated the emergence of insecticide resistance in species such as An. nili, An. paludis and An. rufipes [6,12]. In the frame of the present study, we investigated the resistance profile of An. pharoensis populations from northern Cameroon to DDT.

2. Materials and Methods

2.1. Description of the Study Sites

Mosquito collections took place in the villages of Simatou (10°52′24″ N, 14°58′48″ E), Yangah (14°44′23″ N, 14°58′35″ E) and Maga (10°50′36″ N, 14°56′23″ E), all located in the far-north region of Cameroon (Figure 1). The region belongs to the Sahelian domain, characterized by a long dry season running from October to May with only four months of rains (June to September), with vegetation consisting of shrubby savannah. These villages are situated close to a large dam (Maga Dam) and the Logone river. The population mainly practice farming, fishing and cattle rearing for a living. The main crops cultivated are rice, cotton, maize and groundnuts. Although the area is prone to seasonal malaria transmission, the presence of a dam has created suitable habitats for the development of mosquitoes all year round.

2.2. Mosquito Collection, Rearing and Conservation

Field sampling of anopheline larvae and processing was conducted during the rainy season from August to September 2021 in Maga, Simatou and Yangah. Larval collections were undertaken in typical habitats for An. pharoensis larvae, which are permanent or semi-permanent water collections with vegetation. In each study site, collected samples were pooled per site and reared to the adult stage. Larvae were fed with TetraMin® fish food until pupae. Pupae were collected in cardboard cups and placed in netting cages for adult emergence. After emergence, adults were offered sugar solution until processing. A subset of 30–40 unexposed, non-blood fed, 3–5 days-old female An. pharoensis were air-dried and sent to the Laboratory of Molecular Entomology in IMBB-FORTH for analysis (CHC quantification). Another subset of about 25–100 mosquitoes per population was used for insecticide bioassays; survivors after exposure to insecticide were preserved in 70% alcohol for molecular analysis.

2.3. Insecticide Bioassay

Adult female An. pharoensis aged 3–5 days reared from larval collections in different sites were tested against DDT 4% following WHO guidelines [13]. An. pharoensis females were placed in batches of 20 to 25 mosquitoes per tube and left for observation for one hour. After this period, mosquitoes were transferred in tubes with insecticide-impregnated papers and exposed for 1 h. The susceptible laboratory strain (An. gambiae (Kisumu strain)) was used as control to assess the quality of the impregnated papers. The number of mosquitoes knocked down by the insecticide was recorded after 1 h of exposure; then, mosquitoes were transferred to holding tubes and fed for 24 h before scoring the mortalities. Mosquitoes were considered resistant when the mortality rate was <90% and susceptible when the mortality rate was ≥98%, and resistance status needed further checking when mortality rate was <98% and ˃90% [14].

2.4. Genomic DNA Extraction from Individual Mosquitoes

Genomic DNA was extracted from 72 specimens for molecular species identification using the DNazol protocol, according to the manufacturer’s instructions (Molecular Research Center Inc., Cincinnati, OH, USA). The quantity and purity of DNA were assessed spectrophotometrically via Nanodrop measurements. The quality of DNA was assessed by 1.0% w/v agarose gel electrophoresis.

2.5. Total Nucleic Acid (NA) Extraction from Mosquito Pools

Total NAs were extracted from mosquito pools using a magnetic-bead-based approach with the MagSi kit (MagnaMedics Diagnostics GmbH, Aachem, Germany) for direct sequencing (Sanger) of the VGSC gene. The quantity and purity of DNA and total RNA were assessed spectrophotometrically via Nanodrop measurements. The quality of RNA was assessed by 1.0% w/v agarose gel electrophoresis.

2.6. Species Identification

DNA extracted from individual mosquitoes was used for molecular species identification. The mitochondrial genes COI and COII were sequenced in morphologically identified An. pharoensis samples, according to Krzywinski et al. [15], after cleaning-up the PCR products. PCR amplification reactions were carried out in 20 µL volume reaction mix, containing 1xPCR buffer, 250 µM of each DNTP, 2.5 mM MgCl2, 0.15 mg/mL of bovine serum albumin, one unit of Kappa Taq polymerase, 1 µL of genomic DNA and 600 nM of each primer. PCR product size ranged from 700 bp to 730 bp. For the amplification of COI the following primers were used F (5′-3′): GGA GGATTTGGAAATTGATTAGTTCC; R (5′-3′): GCTAATCATCTAAAAATTTTAATTCC; whereas for COII the following set of primers were used F (5′-3′): TCTAATATGGGAGATTAGTGC; R (5′-3′): ACTTGCTTTCAGTCATCTAAT G. The PCR conditions were 3 min at 95 °C followed by 30 s at 95 °C, 30 s at 55 °C and 45 s at 72 °C for 35 cycles and 10 min at 72 °C for the final extension. The PCR products were then separated by electrophoresis on 1.5% agarose gel with Midori green and visualized under ultraviolet light.

2.7. kdr Detection in Anopheles Mosquitoes

Direct sequencing (Sanger) of the VGSC gene, including the area of the L1014F/S mutation, was applied to An. pharoensis samples to detect the presence of kdr mutations. Initial PCR analyses were conducted to select the area of interest for sequencing. PCR amplification reactions were carried out in 20 µL volume reaction mix, containing 1xPCR buffer, 250 µM of each DNTP, 2 mM MgCl2, 0.15 mg/mL of bovine serum albumin, one unit of Kappa Taq polymerase, 1 µL of genomic DNA and 500 nM of each of following primers. For the amplification of kdr the following were used as primers F (5′-3′): GGMGAATGGATYGAATCMATGTGGGA; R (5′-3′): GATGAACCRAAATTKGACAAAAGCAA. The PCR conditions were 5 min at 94 °C followed by 1 min at 94 °C, 2 min at 50 °C and 2 min at 72 °C for 35 cycles and 2 min at 72 °C for the final extension. The PCR products were then separated by electrophoresis on 1.5% agarose gel with Midori green and visualized under ultraviolet light.

2.8. Cuticular Hydrocarbons (CHCs) Identification and Quantitation by GC-MS and GC-FID

Female mosquitoes from the sites of Yangah (Y), Simatou (S) and Maga (M) were processed. Before analysis, mosquitoes were air-dried at 25 °C. Then, air-dried mosquitoes were pooled (25 female mosquitoes/population, three biological replicates), their dry weight was measured and the corresponding samples proceeded for CHC analysis. CHC identification and quantitation (by GC-MS and GC-FID) was performed as previously described in [16], with minor modifications. Briefly, cuticular lipids from all fifteen samples were extracted by 1 min immersion in hexane (×3) with gentle agitation; extracts were pooled and evaporated under a N2 stream. CHCs were separated from other components and finally concentrated prior to chromatography by Solid Phase Extraction (SPE). Quantitative amounts were estimated by co-injection of nC24 as an internal standard (2890 ng/mL in Hexane). CHC quantitation was calculated as the sum of area of 32 peaks in total, using the internal standard.

3. Results

3.1. Species Identification

A total of 30 specimens (10 per site) were processed in order to confirm the morphological identification using Sanger sequencing of mitochondrial COI/COII genes, and all mosquitoes were confirmed as An. pharoensis (Table 1).

3.2. Bioassay Analysis

A total of 201 An. pharoensis were exposed to DDT 4% to determine their susceptibility profile. All the three populations appeared to be resistant to DDT 4%, with mortality rate ranging from 62.79% in Maga to 80% in Yangah (Table 2).

3.3. kdr L1014F/S Analysis in An. pharoensis Samples

Out of the 114 An. pharoensis mosquitoes expressing phenotypic resistance sequenced, none were detected carrying the kdr allele L1014F (kdr W) and/or L1014S (kdr E) (Table 3 and Figure 1). All mosquito analyzed turned out to be of the wild type.

3.4. Analysis of Amount of Cuticular Hydrocarbon (CHC) in Mosquito

In the present study, the mean amount of CHCs normalized for dry body weight (ng CHCs/mg dry body weight ± SD) from the three An. pharoensis mosquito populations (Yangah (Y), Simatou (S) and Maga (M)) was calculated as 2420.9 ± 265, 2372.5 ± 225, 1409.7 ± 105 ng CHCs/mg, respectively (Figure 2). The difference of the means between Yangah and Maga and Simatou and Maga populations was found to be significant (two-tailed t-test, p = 0.0036 **, p = 0.0026 **, respectively). The raw data of the analysis are presented in Supplementary Table S1.

4. Discussion

The study objective was to assess the profile of DDT resistance in Anopheles pharoensis. High resistance to DDT was recorded in all study sites. The low level of susceptibility detected in An. pharoensis populations was consistent with the general profile of DDT resistance in An. gambiae and An. funestus populations across Cameroon. characterized by no or very low mortality rates to this compound [17,18,19]. To our knowledge, this is the first report of insecticide resistance in An. pharoensis in Cameroon. The present result confirms the emergence of insecticide resistance in other mosquito species. Recent studies in Cameroon also reported increase tolerance of species such as An. nili, An. paludis and An. rufipes to pyrethroids [6,20]. An. pharoensis has been reported resistant to DDT in Ethiopia using standard WHO insecticide bioassay [11]. The emergence of resistance in An. pharoensis could result from the selective pressure induced by the use of LLINs or pesticides in agriculture. This species breeds mainly in permanent and semi-permanent habitats such as irrigation canals, rice field swamps and lake shores which could accumulate a large number of xenobiotics which could exert a high selective pressure on mosquitoes breeding in such habitats during a longer period. It is also possible that resistance could spread through gene flow between close An. pharoensis populations. Molecular identification of species using the COI and COII confirm the presence of An. pharoensis in all study sites. However, it is not clear whether An. pharoensis populations distributed across Africa are genetically homogeneous or differentiated due to the existence of factors that could restrict gene flow between populations, such as geographical distance or physical barriers (mountains), or due to the patchy distribution of breeding habitats. Further investigations using new available genetic tools are needed. Studies conducted so far in Cameroon indicated that An. pharoensis feeds equally indoors and outdoors [14], suggesting that the species’ susceptibility status could also be affected by the use of insecticide-treated nets. However, molecular analysis suggested no implication of kdr mutation in An. pharoensis resistance to DDT.
Based on the study from Balabanidou et al. [16], which showed that pyrethroid-resistant An. gambiae mosquitoes had increased epicuticle thickness, mainly because of a substantially higher amount of CHCs compared to susceptible mosquitoes, we could suggest that Yangah and Simatou field populations could have a thicker epicuticle compared to the Maga population, and this could therefore help uptake insecticide molecules slower. In their study, Talipouo et al. [21] reported a CHC content of 1840 ± 70 ng CHCs/mg dry weight for the resistant samples, whereas the corresponding value was 1552 ± 80.1 ng CHCs/mg dry weight for the susceptible strain. Our data support the implication of cuticular resistance in An. pharoensis resistance to DDT in the sites of Yangah and Simatou. Two mechanisms are considered to reduce the penetration of insecticide in mosquitoes; these include: the cuticle thickening and the altering of cuticle composition [22]. These processes could be under the actions of genes or proteins such as Cyp4g16, laccase 2 or ABC transporters [22]. It is likely that additional mechanisms, such as metabolic detoxification, are involved in DDT resistance in An. pharoensis populations, but this warrants further investigation. Several mechanisms, including target sites and metabolic-based mechanisms, have been reported to be involved in resistance to insecticides in mosquitoes [23].

5. Conclusions

The present study highlights the need for the intensification of surveillance activities on different vector species contributing to malaria transmission across Africa. An. pharoensis, as other secondary malaria vector, is still largely overlooked by control programmes. In order to achieve malaria elimination, more consideration needs to be given to all neglected vectors which contribute to the maintenance of malaria transmission.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/genes13101723/s1, Table S1. Total CHC (ng CHCs/mg mosquitos) in the populations analyzed.

Author Contributions

N.A.K.-C. and E.K. participated in data collection; interpreted the data; wrote the early version of the manuscript; revised the manuscript. K.M.P. and V.B. performed laboratory analysis, analyzed and interpreted the data; critically revised the manuscript. B.T.D. participated in data collection and revised the manuscript; performed laboratory analysis, analyzed and interpreted the data; critically revised the manuscript. T.T. critically revised the manuscript. C.A.-N. Conceived and designed the study protocol; drafted and critically revised the final version of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work received financial support from the Bill & Melinda Gates Foundation, Grant ID: OPP1210340 to CAN, the European Union’s Horizon 2020 Research and Innovation Programme under grant agreement No. 731060 (INFRAVEC2) and the Panafrican Mosquito Association (PAMCA). The funding body did not have any role in the experimental design, collection of data, analysis or interpretation of data or in the writing of the manuscript.

Institutional Review Board Statement

The study was conducted under the ethical clearance No.2020/04/1209/CE/CNERSH/SP delivered by the Cameroon National Ethics (CNE) Committee for Research on Human Health.

Data Availability Statement

All the data from the study are included in the manuscript.

Acknowledgments

We are grateful to the administrative and traditional authorities and the population of Maga, Simatou and Yangah for their participation in the study. We are grateful to Ekoko Wolfgang for his assistance during the field work.

Conflicts of Interest

The authors declare that they have no competing interests.

References

  1. World Health Organization. World Malaria Report 2019; World Health Organization: Geneva Swizerland, 2019. [Google Scholar]
  2. Antonio-Nkondjio, C.; Ndo, C.; Njiokou, F.; Bigoga, J.D.; Awono-Ambene, P.; Etang, J.; Ekobo, A.S.; Wondji, C.S. Review of malaria situation in Cameroon: Technical viewpoint on challenges and prospects for disease elimination. Parasit. Vectors 2019, 12, 501. Available online: https://parasitesandvectors.biomedcentral.com/articles/10.1186/s13071-019-3753-8 (accessed on 29 January 2021). [CrossRef] [PubMed]
  3. Antonio-Nkondjio, C.; Simard, F.D.R.; Awono-Ambene, P.; Chouaibou, M.; Tchuinkam, T.O.; Fontenille, D. Complexity of the Malaria Vectorial System in Cameroon: Contribution of Secondary Vectors to Malaria Transmission. J. Med. Entomol. 2006, 43, 7. [Google Scholar] [CrossRef]
  4. Antonio-Nkondjio, C.; Atangana, J.; Ndo, C.; Awono-Ambene, P.; Fondjo, E.; Fontenille, D.; Simard, F. Malaria transmission and rice cultivation in Lagdo, northern Cameroon. Trans. R. Soc. Trop. Med. Hyg. 2008, 102, 352–359. Available online: https://www.sciencedirect.com/science/article/pii/S0035920307004415 (accessed on 25 May 2022). [CrossRef] [PubMed]
  5. Gillies, M.T.; De Meillon, B. The Anophelinae of Africa South of the Sahara (Ethiopian Zoogeographical Region). Anophelinae Afr South Sahara Ethiop Zoogeographical Reg. Johannesburg: South African Institute for Medical Research, P.O. Box 1038, S. Africa. 1968. Available online: https://www.cabdirect.org/cabdirect/abstract/19692900946 (accessed on 25 May 2022).
  6. Awono-Ambene, P.H.; Etang, J.; Antonio-Nkondjio, C.; Ndo, C.; Eyisap, W.E.; Piameu, M.C.; Mandeng, E.S.; Mbakop, R.L.; Toto, J.C.; Patchoke, S.; et al. The bionomics of the malaria vector Anopheles rufipes Gough, 1910 and its susceptibility to deltamethrin insecticide in North Cameroon. Parasit. Vectors 2018, 11, 253. Available online: https://parasitesandvectors.biomedcentral.com/articles/10.1186/s13071-018-2809-5 (accessed on 24 May 2022). [CrossRef] [PubMed]
  7. Ibrahim, S.S.; Mukhtar, M.M.; Irving, H.; Labbo, R.; Kusimo, M.O.; Mahamadou, I.; Wondji, C.S. High Plasmodium infection and multiple insecticide resistance in a major malaria vector Anopheles coluzzii from Sahel of Niger Republic. Malar. J. 2019, 18, 181. Available online: https://malariajournal.biomedcentral.com/articles/10.1186/s12936-019-2812-0 (accessed on 3 June 2022). [CrossRef] [PubMed]
  8. Kerah-Hinzoumbé, C.; Péka, M.; Antonio-Nkondjio, C.; Donan-Gouni, I.; Awono-Ambene, P.; Samè-Ekobo, A.; Simard, F. Malaria vectors and transmission dynamics in Goulmoun, a rural city in south-western Chad. BMC Infect Dis. BioMed Cent. 2009, 9, 1–11. Available online: https://bmcinfectdis.biomedcentral.com/articles/10.1186/1471-2334-9-71 (accessed on 31 July 2022).
  9. Sinka, M.E.; Bangs, M.J.; Manguin, S.; Rubio-Palis, Y.; Chareonviriyaphap, T.; Coetzee, M.; Mbogo, C.M.; Hemingway, J.; Patil, A.P.; Temperley, W.H.; et al. A global map of dominant malaria vectors. Parasit. Vectors 2012, 5, 69. [Google Scholar] [CrossRef] [PubMed]
  10. Garrett-Jones, C. The possibility of active long-distance migrations by Anopheles pharoensis Theobald. Bull. World Health Organ. 1962, 27, 299–302. Available online: https://apps.who.int/iris/handle/10665/267602 (accessed on 13 August 2022). [PubMed]
  11. Balkew, M.; Elhassan, I.; Ibrahim, M.; Gebre-Michael, T.; Engers, H. Very high DDT-resistant population of Anopheles pharoensis Theobald (Diptera: Culicidae) from Gorgora, Northern Ethiopia. Parasite 2007, 13, 327–329. [Google Scholar] [CrossRef] [PubMed]
  12. Bamou, R.; Kopya, E.; Djamouko-Djonkam, L.; Awono-Ambene, P.; Tchuinkam, T.; Njiokou, F.; Antonio-Nkondjio, C. Assessment of the Anophelinae blood seeking bionomic and pyrethroids resistance of local malaria vectors in the forest region of Southern Cameroon. JEZS 2020, 8, 1054–1062. [Google Scholar]
  13. Rapport 2016 sur le Paludisme dans le Monde–OMS–ReMed. Available online: http://remed.org/ressources/1084/ (accessed on 27 July 2022).
  14. Tabue, R.N.; Awono-Ambene, P.; Etang, J.; Atangana, J.; C, A.-N.; Toto, J.C.; Patchoke, S.; Leke, R.G.; Fondjo, E.; Mnzava, A.P.; et al. Role of Anopheles (Cellia) rufipes (Gough, 1910) and other local anophelines in human malaria transmission in the northern savannah of Cameroon: A cross-sectional survey. Parasit. Vectors 2017, 10, 22. [Google Scholar] [CrossRef] [PubMed]
  15. Krzywinski, J.; Wilkerson, R.C.; Besansky, N.J. Evolution of mitochondrial and ribosomal gene sequences in anophelinae (Diptera: Culicidae): Implications for phylogeny reconstruction. Mol. Phylogenet. Evol. 2001, 18, 479–487. [Google Scholar] [CrossRef] [PubMed]
  16. Balabanidou, V.; Kampouraki, A.; MacLean, M.; Blomquist, G.J.; Tittiger, C.; Juárez, M.P.; Mijailovsky, S.J.; Chalepakis, G.; Anthousi, A.; Lynd, A.; et al. Cytochrome P450 associated with insecticide resistance catalyzes cuticular hydrocarbon production in Anopheles gambiae. Proc. Natl. Acad. Sci. USA 2016, 113, 9268–9273. [Google Scholar] [CrossRef] [PubMed]
  17. Antonio-Nkondjio, C.; Fossog, B.T.; Kopya, E.; Poumachu, Y.; Djantio, B.M.; Ndo, C.; Tchuinkam, T.; Awono-Ambene, P.; Wondji, C.S. Rapid evolution of pyrethroid resistance prevalence in Anopheles gambiae populations from the cities of Douala and Yaoundé (Cameroon). Malar. J. 2015, 14, 155. [Google Scholar] [CrossRef] [PubMed]
  18. Sonhafouo-Chiana, N.; Nkahe, L.D.; Kopya, E.; Awono-Ambene, P.H.; Wanji, S.; Wondji, C.S.; Antonio-Nkondjio, C. Rapid evolution of insecticide resistance and patterns of pesticides usage in agriculture in the city of Yaoundé, Cameroon. Parasit. Vectors 2022, 15, 186. Available online: https://parasitesandvectors.biomedcentral.com/articles/10.1186/s13071-022-05321-8 (accessed on 27 July 2022). [CrossRef] [PubMed]
  19. Menze, B.D.; Wondji, M.J.; Tchapga, W.; Tchoupo, M.; Riveron, J.M.; Wondji, C.S. Bionomics and insecticides resistance profiling of malaria vectors at a selected site for experimental hut trials in central Cameroon. Malar. J. 2018, 17, 317. Available online: https://malariajournal.biomedcentral.com/articles/10.1186/s12936-018-2467-2 (accessed on 23 May 2022). [CrossRef] [PubMed]
  20. Bamou, R.; Kopya, E.; Nkahe, L.D.; Menze, B.D.; Awono-Ambene, P.; Tchuinkam, T.; Njiokou, F.; Wondji, C.S.; Antonio-Nkondjio, C. Increased prevalence of insecticide resistance in Anopheles coluzzii populations in the city of Yaoundé, Cameroon and influence on pyrethroid-only treated bed net efficacy. Parasite 2021, 28, 8. Available online: https://www.parasite-journal.org/10.1051/parasite/2021003 (accessed on 22 May 2022). [CrossRef] [PubMed]
  21. Talipouo, A.; Mavridis, K.; Nchoutpouen, E.; Djiappi-Tchamen, B.; Fotakis, E.A.; Kopya, E.; Bamou, R.; Kekeunou, S.; Awono-Ambene, P.; Balabanidou, V.; et al. High insecticide resistance mediated by different mechanisms in Culex quinquefasciatus populations from the city of Yaoundé, Cameroon. Sci. Rep. 2021, 11, 7322. Available online: http://www.nature.com/articles/s41598-021-86850-7 (accessed on 23 May 2022). [CrossRef] [PubMed]
  22. Balabanidou, V.; Grigoraki, L.; Vontas, J. Insect cuticle: A critical determinant of insecticide resistance. Curr. Opin. Insect. Sci. 2018, 27, 68–74. Available online: https://linkinghub.elsevier.com/retrieve/pii/S2214574517301190 (accessed on 6 June 2022). [CrossRef] [PubMed]
  23. Hemingway, J.; Ranson, H. Insecticide Resistance in Insect Vectors of Human Disease. Annu. Rev. Entomol. 2000, 45, 371–391. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Representative electropherogram of a wild-type (TTA) An. pharoensis sample for the kdr L1014F mutation.
Figure 1. Representative electropherogram of a wild-type (TTA) An. pharoensis sample for the kdr L1014F mutation.
Genes 13 01723 g001
Figure 2. Mean cuticular hydrocarbon (CHC) amounts from three Anopheles mosquito populations. Yangah (Y) and Simatou (S) An. pharoensis have significantly higher amounts of CHCs compared to Maga (M) mosquitoes normalized for their size differences (two-tailed t-test, p value < 0.05).
Figure 2. Mean cuticular hydrocarbon (CHC) amounts from three Anopheles mosquito populations. Yangah (Y) and Simatou (S) An. pharoensis have significantly higher amounts of CHCs compared to Maga (M) mosquitoes normalized for their size differences (two-tailed t-test, p value < 0.05).
Genes 13 01723 g002
Table 1. Molecular identification of An. pharoensis from the Yangah, Simatou and Maga populations after amplification of COI and COII genes.
Table 1. Molecular identification of An. pharoensis from the Yangah, Simatou and Maga populations after amplification of COI and COII genes.
PopulationNSpecies ID
Yangah10100% An. pharoensis
Simatou10100% An. pharoensis
Maga10100% An. pharoensis
N: Number of mosquitoes.
Table 2. Susceptibility status of An. pharoensis populations to 4% DDT.
Table 2. Susceptibility status of An. pharoensis populations to 4% DDT.
Sites/StrainSpeciesTestedDeadMortality Rate (95% CI)
MagaAn. pharoensis865462.79% (47.2–81.9)
SimatouAn. pharoensis906976.67% (59.65–97.03)
YangahAn. pharoensis252080% (48.87–123.55)
KisumuAn. gambiae100100100%
95% CI: confidence interval.
Table 3. Genotyping of An. pharoensis mosquitoes for the L1014F/S mutation.
Table 3. Genotyping of An. pharoensis mosquitoes for the L1014F/S mutation.
PopulationSample Size
(Alleles)
Phenotypekdr L1014F/S
Genotype
Yangah20DDT resistantWild type (TTA or TTG)
Simatou20DDT resistantWild type (TTA or TTG)
Maga74DDT resistantWild type (TTA or TTG)
Kisumu30susceptible strainWild type (TTA or TTG)
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Kala-Chouakeu, N.A.; Kopya, E.; Balabanidou, V.; Djiappi, B.T.; Papapostolou, K.M.; Tchuinkam, T.; Antonio-Nkondjio, C. DDT Resistance in Anopheles pharoensis from Northern Cameroon Associated with High Cuticular Hydrocarbon Production. Genes 2022, 13, 1723. https://doi.org/10.3390/genes13101723

AMA Style

Kala-Chouakeu NA, Kopya E, Balabanidou V, Djiappi BT, Papapostolou KM, Tchuinkam T, Antonio-Nkondjio C. DDT Resistance in Anopheles pharoensis from Northern Cameroon Associated with High Cuticular Hydrocarbon Production. Genes. 2022; 13(10):1723. https://doi.org/10.3390/genes13101723

Chicago/Turabian Style

Kala-Chouakeu, Nelly Armanda, Edmond Kopya, Vasileia Balabanidou, Borel Tchamen Djiappi, Kyriaki Maria Papapostolou, Timoléon Tchuinkam, and Christophe Antonio-Nkondjio. 2022. "DDT Resistance in Anopheles pharoensis from Northern Cameroon Associated with High Cuticular Hydrocarbon Production" Genes 13, no. 10: 1723. https://doi.org/10.3390/genes13101723

APA Style

Kala-Chouakeu, N. A., Kopya, E., Balabanidou, V., Djiappi, B. T., Papapostolou, K. M., Tchuinkam, T., & Antonio-Nkondjio, C. (2022). DDT Resistance in Anopheles pharoensis from Northern Cameroon Associated with High Cuticular Hydrocarbon Production. Genes, 13(10), 1723. https://doi.org/10.3390/genes13101723

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop