Improvement of Stable Restorer Lines for Blast Resistance through Functional Marker in Rice (Oryza sativa L.)
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Marker-Assisted Selection for Blasts and Fertility Restoration Genes
2.3. PCR Amplification
2.4. Screening for Blast Resistance, Pollen Fertility, and Evaluation of Agronomic Characters in Improved Lines
2.5. Statistical Analysis
3. Results
3.1. Assessment of Blast Resistance in the Pi54 Gene-Introgressed Lines
3.2. Agronomic Traits in Improved Restorer Lines
3.3. Cluster Analysis
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Vijay Kumar, S.; Rambabu, R.; Bhaskar, B.; Madhavi, K.R.; Srikanth, S.; Prakasam, V.; Sundaram, R.M.; Sheshu Madhav, M.; Subba Rao, L.V.; Prasad, M.S. Introgression of durable blast resistance gene Pi-54 into indica rice cv. samba Mahsuri, through Marker Assisted Backcross Breeding. Electron. J. Plant. Breed. 2018, 9, 705–715. [Google Scholar] [CrossRef]
- Tanweer, F.A.; Rafii, M.Y.; Sijam, K.; Rahim, H.A.; Ahmed, F.; Latif, M.A. Current advance methods for the identification of blast resistance genes in rice. C. R. Biol. 2015, 338. [Google Scholar] [CrossRef] [PubMed]
- Mackill, D.J.; Bonman, J.M. Inheritance of Blast Resistance in Near-Isogenic Lines of Rice. Phytopathology 1992, 82. [Google Scholar] [CrossRef]
- Dean, R.A.; Talbot, N.J.; Ebbole, D.J.; Farman, M.L.; Mitchell, T.K.; Orbach, M.J.; Thon, M.; Kulkarni, R.; Xu, J.-R.; Pan, H.; et al. The genome sequence of the rice blast fungus Magnaporthe Grisea. Nature 2005, 434, 980–986. [Google Scholar] [CrossRef] [PubMed]
- Ebbole, D. Magnaporthe as a Model for Understanding Host-Pathogen Interactions. Annu. Rev. Phytopathol. 2007, 45, 437–456. [Google Scholar] [CrossRef] [PubMed]
- Skamnioti, P.; Gurr, S. Against the grain: Safeguarding rice from rice blast disease. Trends Biotechnol. 2009, 27, 141–150. [Google Scholar] [CrossRef]
- Sharma, T.R.; Rai, A.K.; Gupta, S.K.; Vijayan, J.; Devanna, B.N.; Ray, S. Rice Blast Management Through Host-Plant Resistance: Retrospect and Prospects. Agric. Res. 2012, 1, 37–52. [Google Scholar] [CrossRef]
- Musiime, O.; Tenywa, M.M.; Majaliwa, M.J.G.; Lufafa, A.; Nanfumba, D.; Wasige, J.E.; Woomer, P.L.; Kyondha, M. Constraints to rice production in Bugiri District. Afr. Crop. Sci. Conf. Proc. 2005, 7, 1495–1499. [Google Scholar]
- Srinivasan, B.; Gnanamanickam, S.S. Identification of a new source of resistance in wild rice, Oryza rufipogon to bacterial blight of rice caused by Indian strains of Xanthomonas oryzae pv. oryzae. Curr. Sci. 2005, 88, 1229–1231. [Google Scholar]
- Khush, G.S.; Jena, K.K. Advances in Genetics, Genomics and Control of Rice Blast Disease. Adv. Genet. Genomics Control. Rice Blast Dis. 2009, 1–10. [Google Scholar] [CrossRef]
- Araujo, L.; Soares, J.M.; de Filippi, M.C.C.; Rodrigues, F.Á. Cytological aspects of incompatible and compatible interactions between rice, wheat and the blast pathogen Pyricularia oryzae. Sci. Agric. 2016, 73, 177–183. [Google Scholar] [CrossRef][Green Version]
- Ning, X.; Yunyu, W.; Aihong, L. Strategy for Use of Rice Blast Resistance Genes in Rice Molecular Breeding. Rice Sci. 2020, 27, 263–277. [Google Scholar] [CrossRef]
- Sharma, T.R.; Rai, A.K.; Gupta, S.K.; Singh, N.K. Broad-spectrum Blast Resistance Gene Pi-kh Cloned from Rice Line Tetep Designated as Pi54. J. Plant. Biochem. Biotechnol. 2010, 19, 87–89. [Google Scholar] [CrossRef]
- Rai, A.; Kumar, S.; Gupta, S.; Gautam, N.; Singh, N.; Sharma, T. Functional complementation of rice blast resistance gene Pik h (Pi54) conferring resistance to diverse strains of Magnaporthe oryzae. J. Plant. Biochem. Biotechnol. 2011, 20, 55–65. [Google Scholar] [CrossRef]
- Sharma, T.R.; Madhav, M.S.; Singh, B.K.; Shanker, P.; Jana, T.K.; Dalal, V.; Pandit, A.; Singh, A.; Gaikwad, K.; Upreti, H.C.; et al. High-resolution mapping, cloning and molecular characterization of the Pi-khg ene of rice, which confers resistance to Magnaporthe grisea. Mol. Genet. Genomics 2005, 274, 569–578. [Google Scholar] [CrossRef] [PubMed]
- Gupta, S.K.; Rai, A.K.; Kanwar, S.S.; Sharma, T.R. Comparative Analysis of Zinc Finger Proteins Involved in Plant Disease Resistance. PLoS ONE 2012, 7, e42578. [Google Scholar] [CrossRef]
- Gupta, S.K.; Rai, A.K.; Kanwar, S.S.; Chand, D.; Singh, N.K.; Sharma, T.R. The single functional blast resistance gene Pi54 activates a complex defence mechanism in rice. J. Exp. Bot. 2011, 63, 757–772. [Google Scholar] [CrossRef]
- Devanna, N.B.; Vijayan, J.; Sharma, T.R. The Blast Resistance Gene Pi54of Cloned from Oryza officinalis Interacts with Avr-Pi54 through Its Novel Non-LRR Domains. PLoS ONE 2014, 9, e104840. [Google Scholar] [CrossRef]
- Ramalingam, J.; Savitha, P.; Alagarasan, G.; Saraswathi, R.; Chandrababu, R. Functional marker assisted improvement of stable cytoplasmic male sterile lines of rice for bacterial blight resistance. Front. Plant. Sci. 2017, 8, 1–9. [Google Scholar] [CrossRef]
- Ramkumar, G.; Srinivasarao, K.; Mohan, K.M.; Sudarshan, I.; Sivaranjani, A.K.P.; Gopalakrishna, K.; Neeraja, C.N.; Balachandran, S.M.; Sundaram, R.M.; Prasad, M.S.; et al. Development and validation of functional marker targeting an InDel in the major rice blast disease resistance gene Pi54 (Pikh). Mol. Breed. 2011, 27, 129–135. [Google Scholar] [CrossRef]
- Balaji Suresh, P.; Srikanth, B.; Hemanth Kishore, V.; Subhakara Rao, I.; Vemireddy, L.R.; Dharika, N.; Sundaram, R.M.; Ramesha, M.S.; Sambasiva Rao, K.R.S.; Viraktamath, B.C.; et al. Fine mapping of Rf3 and Rf4 fertility restorer loci of WA-CMS of rice (Oryza sativa L.) and validation of the developed marker system for identification of restorer lines. Euphytica 2012, 187, 421–435. [Google Scholar] [CrossRef]
- Sheeba, N.K.; Viraktamath, B.C.; Sivaramakrishnan, S.; Gangashetti, M.G.; Khera, P.; Sundaram, R.M. Validation of molecular markers linked to fertility restorer gene(s) for WA-CMS lines of rice. Euphytica 2009, 167, 217–227. [Google Scholar] [CrossRef]
- Zhang, G.; Lu, Y.; Bharaj, T.S.; Virmani, S.S.; Huang, N. Mapping of the Rf-3 nuclear fertility-restoring gene for WA cytoplasmic male sterility in rice using RAPD and RFLP markers. Theor. Appl. Genet. 1997, 94, 27–33. [Google Scholar] [CrossRef]
- Chithrameenal, K.; Ganesh Alagarasan, G.; Raveendran, M.; Robin, S.; Meena, S.; Ramanathan, A.; Ramalingam, J. Genetic enhancement of phosphorus starvation tolerance through marker assisted introgression of OsPSTOL1 gene in rice genotypes harbouring bacterial blight and blast resistance. PLoS ONE 2018, 13, e0204144. [Google Scholar] [CrossRef]
- Srivastava, D.; Shamim, M.; Kumar, M.; Mishra, A.; Pandey, P.; Kumar, D.; Yadav, P.; Siddiqui, M.; Singh, K. Current Status of Conventional and Molecular Interventions for Blast Resistance in Rice. Rice Sci. 2017, 25. [Google Scholar] [CrossRef]
- Hari, Y.; Srinivasarao, K.; Viraktamath, B.C.; Hari Prasad, A.S.; Laha, G.S.; Ahmed, M.I.; Natarajkumar, P.; Sujatha, K.; Srinivas Prasad, M.; Pandey, M.; et al. Marker-assisted introgression of bacterial blight and blast resistance into IR 58025B, an elite maintainer line of rice. Plant. Breed. 2013, 132, 586–594. [Google Scholar] [CrossRef]
- Abhilash Kumar, V.; Balachiranjeevi, C.H.; Bhaskar Naik, S.B.; Rambabu, R.; Rekha, G.; Harika, G.; Hajira, S.K.; Pranathi, K.; Anila, M.; Kousik, M.; et al. Development of gene-pyramid lines of the elite restorer line, RPHR-1005 possessing durable bacterial blight and blast resistance. Front. Plant. Sci. 2016, 7. [Google Scholar] [CrossRef]
- Li, W.; Chern, M.; Yin, J.; Wang, J.; Chen, X. Recent advances in broad-spectrum resistance to the rice blast disease. Curr. Opin. Plant. Biol. 2019, 50, 114–120. [Google Scholar] [CrossRef]
- Li, W.; Deng, Y.; Ning, Y.; He, Z.; Wang, G.-L. Exploiting Broad-Spectrum Disease Resistance in Crops: From Molecular Dissection to Breeding. Annu. Rev. Plant. Biol. 2020, 71, 575–603. [Google Scholar] [CrossRef]
- Hayashi, N.; Inoue, H.; Kato, T.; Funao, T.; Shirota, M.; Shimizu, T.; Kanamori, H.; Yamane, H.; Hayano-Saito, Y.; Matsumoto, T.; et al. Durable panicle blast-resistance gene Pb1 encodes an atypical CC-NBS-LRR protein and was generated by acquiring a promoter through local genome duplication. Plant. J. 2010, 64, 498–510. [Google Scholar] [CrossRef]
- Chen, J.; Shi, Y.; Liu, W.; Chai, R.; Fu, Y.; Zhuang, J.; Wu, J. A Pid3 allele from rice cultivar Gumei2 confers resistance to Magnaporthe oryzae. J. Genet. Genomics 2011, 38, 209–216. [Google Scholar] [CrossRef] [PubMed]
- Ma, J.; Chen, J.; Wang, M.; Ren, Y.; Wang, S.; Lei, C.; Cheng, Z. Sodmergen Disruption of OsSEC3A increases the content of salicylic acid and induces plant defense responses in rice. J. Exp. Bot. 2017, 69, 1051–1064. [Google Scholar] [CrossRef] [PubMed]
- Cao, N.; Chen, Y.; Ji, Z.J.; Zeng, Y.X.; Yang, C.D.; Liang, Y. Recent progress in molecular mechanism of rice blast resistance. Chin. J. Rice Sci. 2019, 33, 489–498. [Google Scholar]
- Hittalmani, S.; Parco, A.; Mew, T.V.; Zeigler, R.S.; Huang, N. Fine mapping and DNA marker-assisted pyramiding of the three major genes for blast resistance in rice. Theor. Appl. Genet. 2000, 100, 1121–1128. [Google Scholar] [CrossRef]
- Yueqiu, H.; Wenhua, T.; Leung, H.; Zeigler, R.S. Identification of CO39 near-isogenic lines for rice blast. Zuo Wu Xue Bao 2001, 27, 838–841. [Google Scholar]
- Xiao, N.; Wu, Y.; Pan, C.; Yu, L.; Chen, Y.; Liu, G.; Li, Y.; Zhang, X.; Wang, Z.; Dai, Z.; et al. Improving of rice blast resistances in Japonica by pyramiding major R genes. Front. Plant. Sci. 2017, 7, 1–10. [Google Scholar] [CrossRef]
- Wu, Y.; Xiao, N.; Chen, Y.; Yu, L.; Pan, C.; Li, Y.; Zhang, X.; Huang, N.; Ji, H.; Dai, Z.; et al. Comprehensive evaluation of resistance effects of pyramiding lines with different broad-spectrum resistance genes against Magnaporthe oryzae in rice (Oryza sativa L.). Rice 2019, 12, 11. [Google Scholar] [CrossRef]
- Xiao, N.; Wu, Y.; Wang, Z.; Li, Y.; Pan, C.; Zhang, X.; Yu, L.; Liu, G.; Zhou, C.; Ji, H.; et al. Improvement of seedling and panicle blast resistance in Xian rice varieties following Pish introgression. Mol. Breed. 2018, 38, 142. [Google Scholar] [CrossRef]
- Singh, V.K.; Singh, A.; Singh, S.P.; Ellur, R.K.; Choudhary, V.; Sarkel, S.; Singh, D.; Krishnan, S.G.; Nagarajan, M.; Vinod, K.K.; et al. Incorporation of blast resistance into “PRR78”, an elite Basmati rice restorer line, through marker assisted backcross breeding. Field Crop. Res. 2012, 128, 8–16. [Google Scholar] [CrossRef]
- Ellur, R.; Khanna, A.; Yadav, A.; Pathania, S.; Hosahatti, R.; Singh, V.; Krishnan, S.; Bhowmick, P.; Nagarajan, M.; Kurungara, V.; et al. Improvement of Basmati rice varieties for resistance to blast and bacterial blight diseases using marker assisted backcross breeding. Plant. Sci. 2015. [Google Scholar] [CrossRef]
- Khan, G.; Najeeb, S.; Bhat, Z.; Padder, B.A.; Parray, G.; Wani, S.; Shikari, A.; Kashmir, J. Molecular marker-based validation of blast resistance gene Pi54 and identification of potential donors in temperate high altitude rice (Oryza Sativa L.). Indian J. Genet. Plant. Breed. 2017, 77. [Google Scholar] [CrossRef]
- Swathi, G.; Rani, C.; Md, J.; Satturu, V.; Anuradha, C.; Nagireddy, R.; Arunakumari, K.; Kumar, N.; Bhogadhi, S.; Eruvuri, R.; et al. Marker-assisted introgression of the major bacterial blight resistance genes, Xa21 and xa13, and blast resistance gene, Pi54, into the popular rice variety, JGL1798. Mol. Breed. 2019, 39, 58. [Google Scholar] [CrossRef]
- Kumar, P.N.; Sujatha, K.; Laha, G.S.; Rao, K.S.; Mishra, B.; Viraktamath, B.C.; Hari, Y.; Reddy, C.S.; Balachandran, S.M.; Ram, T.; et al. Identification and fine-mapping of Xa33, a novel gene for resistance to Xanthomonas oryzae pv. oryzae. Phytopathology 2012, 102, 222–228. [Google Scholar] [CrossRef] [PubMed]
- Brinkman, M.A.; Frey, K.J. Yield-component Analysis of Oat Isolines that Produce Different Grain Yields1. Crop. Sci. 1977, 17. [Google Scholar] [CrossRef]
- Thiyagarajan, K.; Jeyaprakash, P.; Rajeswari, S.; Rabindran, R. CORH 3—A Short Duration Non aromatic rice hybrid. Electron. J. Plant Breed. 2009, 1, 1–5. [Google Scholar]
S.No | Marker Types | Primer | Primer Sequences 5′→3′ | Annealing Temperature (°C) | Amplified Product Size (bp) | Base Pair/cM | Chromosomal Location | Citation |
---|---|---|---|---|---|---|---|---|
Blast Marker | ||||||||
1 | Functional | Pi54 MAS | F- CAATCTCCAAAGTTTTCAGG R-GCTTCAATCACTGCTAGACC | 56 °C | 359 | - | 11 | [20] |
Rf3 Locus | ||||||||
2 | SSR | DRRM-RF3-10 | TCTGTGCATTGCCTGAACAT TCGTATGGAACGATGTGATGA | 56 °C | 140 | 4982046 | 1 | [21] |
Rf4 Locus | ||||||||
3 | SSR | DRCG-RF4-8 | F-TGGGATCATGAAAGCCATAC R-GCTTTATAGGCGCCGATTTT | 57 °C | 845 | 18211995 | 10 | [21] |
4 | SSR | RM 6100 | F- TCCTCTACCAGTACCGCACC R- GCTGGATCACAGATCATTGC | 58 °C | 160 | 1.2 cM | 10 | [22] |
S.No | CB 87 R × B 95 | CB 174 R × B 95 | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Markers | Observed Frequency | Observed Frequency | |||||||||
RR | Rr | rr | Total | χ2 (1:2:1) | RR | Rr | rr | Total | χ2 (1:2:1) | ||
1 | Pi54 MAS | 41 | 106 | 63 | 210 | 1.504 | 46 | 127 | 87 | 260 | 1.487 |
S. No | Pyramided Lines | Allelic Status (Pi54, Rf3, Rf4) | Resistance Genes Genotyped by Linked Marker | Reaction Against to Blast | Pollen Fertility Status (%) | |
---|---|---|---|---|---|---|
* Disease Scoring for Rice Blast (0–9 scale) | R/S | |||||
CB 87 R × B 95—Improved CB 87 R | ||||||
1 | 5-3-7-1 | Pi54 + Rf3 + Rf4 | ++ | 1 | R | 92.1 |
2 | 5-3-7-3 | Pi54 + Rf3 + Rf4 | ++ | 1 | R | 92.8 |
3 | 5-3-7-4 | Pi54 + Rf3 + Rf4 | ++ | 0 | R | 92.3 |
4 | 5-3-7-5 | Pi54 + Rf3 + Rf4 | ++ | 2 | R | 82.6 |
5 | 5-3-7-6 | Pi54 + Rf3 + Rf4 | ++ | 1 | R | 91.2 |
6 | 5-3-7-8 | Pi54 + Rf3 + Rf4 | ++ | 1 | R | 82.3 |
7 | 5-3-7-9 | Pi54 + Rf3 + Rf4 | ++ | 2 | R | 80.1 |
8 | 5-3-7-10 | Pi54 + Rf3 + Rf4 | ++ | 2 | R | 93.8 |
9 | 5-3-7-12 | Pi54 + Rf3 + Rf4 | ++ | 1 | R | 91.7 |
CB 174 R × B 95—Improved CB 174 R | ||||||
10 | 5-3-8-1 | Pi54 + Rf3 + Rf4 | ++ | 1 | R | 81.1 |
11 | 5-3-8-2 | Pi54 + Rf3 + Rf4 | ++ | 2 | R | 90.8 |
12 | 5-3-8-4 | Pi54 + Rf3 + Rf4 | ++ | 0 | R | 80.4 |
13 | 5-3-8-6 | Pi54 + Rf3 + Rf4 | ++ | 1 | R | 81.7 |
14 | 5-3-8-7 | Pi54 + Rf3 + Rf4 | ++ | 2 | R | 91.6 |
15 | 5-3-8-8 | Pi54 + Rf3 + Rf4 | ++ | 2 | R | 83.9 |
16 | 5-3-8-10 | Pi54 + Rf3 + Rf4 | ++ | 2 | R | 93.8 |
17 | 5-3-8-11 | Pi54 + Rf3 + Rf4 | ++ | 0 | R | 91.2 |
18 | 5-3-8-15 | Pi54 + Rf3 + Rf4 | ++ | 1 | R | 81.4 |
19 | 5-3-8-16 | Pi54 + Rf3 + Rf4 | ++ | 1 | R | 88.9 |
20 | 5-3-8-17 | Pi54 + Rf3 + Rf4 | ++ | 1 | R | 91.2 |
21 | 5-3-8-19 | Pi54 + Rf3 + Rf4 | ++ | 1 | R | 90.3 |
22 | 5-3-8-22 | Pi54 + Rf3 + Rf4 | ++ | 1 | R | 80.9 |
23 | IR 24 (Negative check) | −− | 9 | S | ||
24 | CB 87 R (Recurrent parent) | Rf3 + Rf4 | −− | 9 | S | 95.6 |
25 | CB 174 R (Recurrent parent) | Rf3 + Rf4 | −− | 9 | S | 92.9 |
26 | B 95 (Donor parent) | Pi54 | ++ | 1 | R | |
27 | Tetep (positive check) | Pi54 | ++ | 1 | R | - |
S.No | Plant No. | Days to Flowering | Plant Height (cm) | No. Productive Tillers | Panicle Length (cm) | No. Filled Grains | 100 Grain Weight (g) | Grain Yield (g) |
---|---|---|---|---|---|---|---|---|
1 | 5-3-7-1 | 73.9 1 | 78.2 | 13.5 | 22.7 | 124.9 | 2.17 1 | 24.17 |
2 | 5-3-7-3 | 72.3 1 | 73.5 | 12.8 | 21.6 | 116.7 | 1.83 | 22.87 |
3 | 5-3-7-4 | 73.2 1 | 76.8 | 13.7 | 20.8 | 118.5 | 2.07 1 | 19.43 |
4 | 5-3-7-5 | 71.5 1 | 84.9 | 11.5 | 23.3 | 138.3 1 | 2.17 1 | 22.30 |
5 | 5-3-7-6 | 77.1 | 84.4 | 15.8 1 | 23.1 | 123.0 | 1.77 | 27.07 |
6 | 5-3-7-8 | 71.8 1 | 78.1 | 14.4 | 20.8 | 109.8 | 1.73 | 21.43 |
7 | 5-3-7-9 | 68.6 1 | 68.6 | 15.2 1 | 18.7 | 128.6 | 2.13 1 | 18.73 |
8 | 5-3-7-10 | 71.7 1 | 77.3 | 13.1 | 22.0 | 128.6 | 2.30 1 | 21.23 |
9 | 5-3-7-12 | 75.6 | 85.5 | 14.9 1 | 21.2 | 123.2 | 2.03 1 | 20.17 |
10 | 5-3-8-1 | 73.2 2 | 75.5 | 13.4 | 22.7 | 110.5 | 2.17 | 22.30 |
11 | 5-3-8-2 | 69.1 2 | 89.1 | 13.8 | 18.6 | 125.6 2 | 2.27 | 19.07 |
12 | 5-3-8-4 | 74.7 2 | 74.7 | 14.7 2 | 15.2 | 115.0 | 2.13 | 20.87 |
13 | 5-3-8-6 | 78.7 | 96.3 | 13.3 | 18.4 | 117.7 | 2.23 | 18.47 |
14 | 5-3-8-7 | 71.6 2 | 77.0 | 13.3 | 22.2 | 123.6 2 | 1.83 | 21.77 |
15 | 5-3-8-8 | 75.2 2 | 75.4 | 13.6 | 18.8 | 116.1 | 2.07 | 19.17 |
16 | 5-3-8-10 | 77.5 | 95.8 | 16.0 2 | 24.1 | 126.8 2 | 2.40 | 26.40 |
17 | 5-3-8-11 | 72.7 2 | 85.8 | 13.0 | 17.3 | 125.6 2 | 2.13 | 19.60 |
18 | 5-3-8-15 | 72.22 | 84.6 | 12.2 | 19.0 | 116.9 | 2.03 | 20.13 |
19 | 5-3-8-16 | 71.8 2 | 81.8 | 11.3 | 21.6 | 117.5 | 1.97 | 21.30 |
20 | 5-3-8-17 | 76.2 | 83.9 | 12.3 | 16.1 | 112.7 | 1.73 | 19.63 |
21 | 5-3-8-19 | 71.2 2 | 76.0 | 12.4 | 21.2 | 120.9 | 1.97 | 21.73 |
22 | 5-3-8-22 | 73.3 2 | 76.7 | 13.2 | 22.1 | 109.3 | 2.17 | 20.83 |
23 | IR 24 | 83.3 | 86.0 | 13.3 | 24.0 | 119.3 | 2.33 | 29.17 |
24 | CB 87 R | 76.8 | 86.8 | 13.2 | 22.9 | 127.5 | 1.83 | 27.90 |
25 | CB174 R | 77.2 | 95.5 | 12.6 | 23.4 | 115.5 | 2.50 | 26.03 |
26 | B 95 | 77.4 | 114.3 | 12.4 | 22.9 | 98.3 | 2.13 | 25.60 |
Mean ± 2SE | 73.11 | 85.78 | 14.35 | 21.97 | 124.75 | 3.40 | 23.46 | |
CV% | 1.16 | 2.68 | 6.16 | 4.42 | 3.73 | 3.60 | 4.89 | |
LSD | 1.4 | 3.7 | 1.4 | 1.5 | 7.3 | 0.58 | 1.78 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ramalingam, J.; Palanisamy, S.; Alagarasan, G.; Renganathan, V.G.; Ramanathan, A.; Saraswathi, R. Improvement of Stable Restorer Lines for Blast Resistance through Functional Marker in Rice (Oryza sativa L.). Genes 2020, 11, 1266. https://doi.org/10.3390/genes11111266
Ramalingam J, Palanisamy S, Alagarasan G, Renganathan VG, Ramanathan A, Saraswathi R. Improvement of Stable Restorer Lines for Blast Resistance through Functional Marker in Rice (Oryza sativa L.). Genes. 2020; 11(11):1266. https://doi.org/10.3390/genes11111266
Chicago/Turabian StyleRamalingam, Jegadeesan, Savitha Palanisamy, Ganesh Alagarasan, Vellaichamy Gandhimeyyan Renganathan, Ayyasamy Ramanathan, and Ramasamy Saraswathi. 2020. "Improvement of Stable Restorer Lines for Blast Resistance through Functional Marker in Rice (Oryza sativa L.)" Genes 11, no. 11: 1266. https://doi.org/10.3390/genes11111266
APA StyleRamalingam, J., Palanisamy, S., Alagarasan, G., Renganathan, V. G., Ramanathan, A., & Saraswathi, R. (2020). Improvement of Stable Restorer Lines for Blast Resistance through Functional Marker in Rice (Oryza sativa L.). Genes, 11(11), 1266. https://doi.org/10.3390/genes11111266