Colonization by Extended-Spectrum β-Lactamase-Producing Enterobacterales and Bacteremia in Hematopoietic Stem Cell Transplant Recipients
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Study Design and Setting
4.2. Microbiology
4.3. Whole-Genome Sequencing
4.4. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Puerta-Alcalde, P.; Cardozo, C.; Marco, F.; Suárez-Lledó, M.; Moreno, E.; Morata, L.; Fernández-Avilés, F.; Gutiérrez-Garcia, G.; Chumbita, M.; Rosiñol, L.; et al. Changing epidemiology of bloodstream infection in a 25-years hematopoietic stem cell transplant program: Current challenges and pitfalls on empiric antibiotic treatment impacting outcomes. Bone Marrow Transplant. 2020, 55, 603–612. [Google Scholar] [CrossRef] [PubMed]
- Mikulska, M.; Del Bono, V.; Raiola, A.M.; Bruno, B.; Gualandi, F.; Occhini, D.; di Grazia, C.; Frassoni, F.; Bacigalupo, A.; Viscoli, C.; et al. Blood stream infections in allogeneic hematopoietic stem cell transplant recipients: Reemergence of Gram-negative rods and increasing antibiotic resistance. Biol. Blood Marrow Transplant. 2009, 15, 47–53. [Google Scholar] [CrossRef] [PubMed]
- Stoma, I.; Karpov, I.; Milanovich, N.; Uss, A.; Iskrov, I. Risk factors for mortality in patients with bloodstream infections during the pre-engraftment period after hematopoietic stem cell transplantation. Blood Res. 2016, 51, 102–106. [Google Scholar] [CrossRef] [PubMed]
- Korula, A.; Perumalla, S.; Devasia, A.J.; Abubacker, F.N.; Lakshmi, K.M.; Abraham, A.; Mathews, V.; Srivastava, A.; Anandan, S.; Veeraraghavan, B.; et al. Drug-resistant organisms are common in fecal surveillance cultures, predict bacteremia and correlate with poorer outcomes in patients undergoing allogeneic stem cell transplants. Transpl. Infect. Dis. 2020, 22, e13273. [Google Scholar] [CrossRef]
- Dhanya, R.; Agarwal, R.K.; Ramprakash, S.; Trivedi, D.; Shah, V.; Bhat, N.; Reddy, M.; Elizabeth, S.; Batool, A.; Khalid, S.; et al. Do Weekly Surveillance Cultures Contribute to Antibiotic Stewardship and Correlate with Outcome of HSCT in Children? A Multicenter Real-World Experience of 5 Years from the Indian Subcontinent. Transplant. Cell. Ther. 2022, 28, e1–e170. [Google Scholar] [CrossRef]
- Satlin, M.J.; Chavda, K.D.; Baker, T.M.; Chen, L.; Shashkina, E.; Soave, R.; Small, C.B.; E Jacobs, S.; Shore, T.B.; van Besien, K.; et al. Colonization With Levofloxacin-resistant Extended-spectrum β-Lactamase-producing Enterobacteriaceae and Risk of Bacteremia in Hematopoietic Stem Cell Transplant Recipients. Clin. Infect. Dis. 2018, 67, 1720–1728. [Google Scholar] [CrossRef] [PubMed]
- Girmenia, C.; Bertaina, A.; Piciocchi, A.; Perruccio, K.; Algarotti, A.; Busca, A.; Cattaneo, C.; Raiola, A.M.; Guidi, S.; Iori, A.P.; et al. Incidence, Risk Factors and Outcome of Pre-engraftment Gram-Negative Bacteremia After Allogeneic and Autologous Hematopoietic Stem Cell Transplantation: An Italian Prospective Multicenter Survey. Clin. Infect. Dis. 2017, 65, 1884–1896. [Google Scholar] [CrossRef] [PubMed]
- Kharrat, M.; Chebbi, Y.; Ben Tanfous, F.; Lakhal, A.; Ladeb, S.; Othmen, T.B.; Achour, W. Extended spectrum beta-lactamase-producing Enterobacteriaceae infections in hematopoietic stem cell transplant recipients: Epidemiology and molecular characterization. Int. J. Antimicrob. Agents 2018, 52, 886–892. [Google Scholar] [CrossRef] [PubMed]
- Calatayud, L.; Arnan, M.; Liñares, J.; Dominguez, M.A.; Gudiol, C.; Carratalà, J.; Batlle, M.; Ribera, J.M.; Gudiol, F. Prospective study of fecal colonization by extended-spectrum-beta-lactamase-producing Escherichia coli in neutropenic patients with cancer. Antimicrob. Agents Chemother. 2008, 52, 4187–4190. [Google Scholar] [CrossRef]
- Cornejo-Juárez, P.; Suárez-Cuenca, J.A.; Volkow-Fernández, P.; Silva-Sánchez, J.; Barrios-Camacho, H.; Nájera-León, E.; Velázquez-Acosta, C.; Vilar-Compte, D. Fecal ESBL Escherichia coli carriage as a risk factor for bacteremia in patients with hematological malignancies. Support. Care Cancer 2016, 24, 253–259. [Google Scholar] [CrossRef]
- Arnan, M.; Gudiol, C.; Calatayud, L.; Liñares, J.; Dominguez, M.Á.; Batlle, M.; Ribera, J.M.; Carratalà, J.; Gudiol, F. Risk factors for, and clinical relevance of, faecal extended-spectrum β-lactamase producing Escherichia coli (ESBL-EC) carriage in neutropenic patients with haematological malignancies. Eur. J. Clin. Microbiol. Infect. Dis. 2011, 30, 355–360. [Google Scholar] [CrossRef]
- Wollheim, C.; Guerra, I.M.F.; Conte, V.D.; Hoffman, S.P.; Schreiner, F.J.; Delamare, A.P.L.; Echeverrigaray, S.; da Costa, S.O.P. Nosocomial and community infections due to class A extended-spectrum β-lactamase (ESBLA)-producing Escherichia coli and Klebsiella spp. in southern Brazil. Braz. J. Infect. Dis. 2011, 15, 138–143. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Tollentino, F.M.; Polotto, M.; Nogueira, M.L.; Lincopan, N.; Neves, P.; Mamizuka, E.M.; Remeli, G.A.; De Almeida, M.T.; Rúbio, F.G. High prevalence of blaCTX-M extended spectrum beta-lactamase genes in Klebsiella pneumoniae isolates from a tertiary care hospital: First report of blaSHV-12, blaSHV-31, blaSHV-38, and blaCTX-M-15 in Brazil. Microb. Drug Resist. 2011, 17, 7–16. [Google Scholar] [CrossRef] [PubMed]
- Vehreschild, M.J.G.T.; Hamprecht, A.; Peterson, L.; Schubert, S.; Häntschel, M.; Peter, S.; Schafhausen, P.; Rohde, H.; Lilienfeld-Toal, M.V.; Bekeredjian-Ding, I.; et al. A multicentre cohort study on colonization and infection with ESBL-producing Enterobacteriaceae in high-risk patients with haematological malignancies. J. Antimicrob. Chemother. 2014, 69, 3387–3392. [Google Scholar] [CrossRef] [PubMed]
- Guimarães, T.; Borges, I.C.; Spadão, F.d.S.; Mariano, L.; Nascimento, M.d.M.; Higashino, H.; Rossi, F.; Rocha, V.; Costa, S.F. Impact of discontinuing levofloxacin prophylaxis on bloodstream infections in neutropenic hematopoietic stem cell transplantation patients. Antibiotics 2022, 11, 1269. [Google Scholar] [CrossRef] [PubMed]
- Alevizakos, M.; Karanika, S.; Detsis, M.; Mylonakis, E. Colonisation with extended-spectrum β-lactamase-producing Enterobacteriaceae and risk for infection among patients with solid or haematological malignancy: A systematic review and meta-analysis. Int. J. Antimicrob. Agents 2016, 48, 647–654. [Google Scholar] [CrossRef] [PubMed]
- Liss, B.J.; Vehreschild, J.J.; Cornely, O.A.; Hallek, M.; Fätkenheuer, G.; Wisplinghoff, H.; Seifert, H.; Vehreschild, M.J.G.T. Intestinal colonisation and blood stream infections due to vancomycin-resistant enterococci (VRE) and extended-spectrum beta-lactamase-producing Enterobacteriaceae (ESBLE) in patients with haematological and oncological malignancies. Infection 2012, 40, 613–619. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, A.M.; Moreira, F.; Guimaraes, T.; Spadão, F.; Ramos, J.F.; Batista, M.V.; Filho, J.S.; Costa, S.F.; Rocha, V. Epidemiology, risk factors and outcomes of multi-drug-resistant bloodstream infections in haematopoietic stem cell transplant recipients: Importance of previous gut colonization. J. Hosp. Infect. 2018, 100, 83–91. [Google Scholar] [CrossRef] [PubMed]
- Kropshofer, G.; Hetzer, B.; Knoll, M.; Meryk, A.; Salvador, C.; Rabensteiner, E.; Crazzolara, R. What We Learn from Surveillance of Microbial Colonization in Recipients of Pediatric Hematopoietic Stem Cell Transplantation. Antibiotics 2022, 12, 2. [Google Scholar] [CrossRef]
- Stoma, I.; Littmann, E.R.; Peled, J.U.; Giralt, S.; van den Brink, M.R.M.; Pamer, E.G.; Taur, Y. Compositional Flux Within the Intestinal Microbiota and Risk for Bloodstream Infection With Gram-negative Bacteria. Clin. Infect. Dis. 2021, 73, e4627–e4635. [Google Scholar] [CrossRef]
- Higashino, H.R.; Marchi, A.P.; Martins, R.C.R.; Batista, M.V.; Neto, L.V.P.; Lima, V.A.C.d.C.; Rossi, F.; Guimarães, T.; Levin, A.S.; Rocha, V.; et al. Colistin-resistant Klebsiella pneumoniae co-harboring KPC and MCR-1 in a Hematopoietic Stem Cell Transplantation Unit. Bone Marrow Transplant. 2019, 54, 1118–1120. [Google Scholar] [CrossRef] [PubMed]
- Higashino, H.R.; Marchi, A.P.; Ruedas Martins, R.C.; Bubach Carvalho, L.; Vieira Perdigão Neto, L.; Farrel Côrtes, M.; de Oliveira, F.N.; Duarte, E.L.T.; Guimaraes, T.; Rossi, F.; et al. Carbapenem-resistant Klebsiella pneumoniae colonization and infection is associated with lower overall survival in a cohort of haematopoietic stem-cell transplantation patients: Mechanism of resistance and virulence by whole-genome sequencing. J. Med. Microbiol. 2021, 70, 001422. [Google Scholar] [CrossRef] [PubMed]
- Pitout, J.D.D.; Peirano, G.; Chen, L.; DeVinney, R.; Matsumura, Y. Escherichia coli ST1193: Following in the Footsteps of E. coli ST131. Antimicrob. Agents Chemother. 2022, 66, e0051122. [Google Scholar] [CrossRef] [PubMed]
- Da Cruz Campos, A.C.; Couto, N.; Lucas da Silva Andrade, N.; Friedrich, A.W.; de Paula Rosa, A.C.; Vieira Damasco, P.; Chlebowicz-Fliss, M.A.; Rossen, J.W.A. Virulence and resistance properties of E. coli isolated from urine samples of hospitalized patients in Rio de Janeiro, Brazil—The role of mobile genetic elements. Int. J. Med. Microbiol. 2020, 310, 151453. [Google Scholar] [CrossRef] [PubMed]
- CLSI Supplement M100; CLSI Performance Standards for Antimicrobial Susceptibility Testing. 31st ed. Clinical and Laboratory Standards Institute: Berwyn, PA, USA, 2021.
- Dropa, M. Spread of Antimicrobial Resistance in Enterobacterizceae Clinical and Environmental Strains Identification and Genetic Environment Mapping of ESBL Encoding Genes. Ph.D. Thesis, Universidade de São Paulo, Faculdade de Saúde Pública, Ciências, São Paulo, Brazil, 2013. [Google Scholar]
- Galaxy Community. The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2022 update. Nucleic Acids Res. 2022, 50, W345–W351. [Google Scholar] [CrossRef] [PubMed]
- Larsen, M.V.; Cosentino, S.; Rasmussen, S.; Friis, C.; Hasman, H.; Marvig, R.L.; Jelsbak, L.; Sicheritz-Pontéen, T.; Ussery, D.W.; Aarestrup, F.M.; et al. Multilocus sequence typing of total-genome-sequenced bacteria. J. Clin. Microbiol. 2012, 50, 1355–1361. [Google Scholar] [CrossRef]
- Bortolaia, V.; Kaas, R.S.; Ruppe, E.; Roberts, M.C.; Schwarz, S.; Cattoir, V.; Philippon, A.; Allesoe, R.L.; Rebelo, A.R.; Florensa, A.F.; et al. ResFinder 4.0 for predictions of phenotypes from genotypes. J. Antimicrob. Chemother. 2020, 75, 3491–3500. [Google Scholar] [CrossRef]
Characteristics | n (%) or Median [25th–5th Percentile] |
---|---|
Male | 137 (61.7) |
Age (years) | 47.5 [30.25–57] |
Underlying disease | |
Multiple myeloma | 56 (25.2) |
Hodgkin’s lymphoma | 40 (18.0) |
Another lymphoma | 35 (15.7) |
Acute myeloid leukemia | 26 (11.7) |
Another hematological disease | 23 (10.3) |
Acute lymphocytic leukemia | 19 (8.5) |
Diffuse large B-cell lymphoma | 8 (3.6) |
Chronic myeloid leukemia | 6 (2.7) |
Aplastic anemia | 6 (2.7) |
Myelodysplastic syndrome | 3 (1.3) |
HSCT type | |
Autologous | 149 (67.1) |
Allogeneic | 73 (32.9) |
Haploidentical | 38 (52.0) |
Matched-related donor | 25 (34.2) |
Matched-unrelated donor | 10 (13.7) |
OR a | OR CI b | p-Value | |
---|---|---|---|
E. coli resistant to 3rd-generation cephalosporins BSI | |||
ESBL-E colonization (n/N = 2/132) | 1.015 | 0.994–1.037 | 0.516 |
K. pneumoniae resistant to 3rd-generation cephalosporins BSI | |||
ESBL-E colonization (n/N = 6/132) | 4.238 | 0.501–35.818 | 0.246 |
Enterobacterales resistant to 3rd-generation cephalosporins BSI | |||
ESBL-E colonization (n/N = 8/132) | 5.742 | 0.706–46.731 | 0.087 |
Enterobacterales BSI | |||
ESBL-E colonization (n/N = 23/132) | 1.688 | 0.761–3.744 | 0.250 |
Gene | Oligonucleotide Sequences (5′-3′) | Annealing Temperature | Size (bp) |
---|---|---|---|
blaCTX-M-8 | CTX-M-8 F (240)—GATGAGACATCGCGTTAAG | 52 °C | 861 |
CTX-M-8 R (241)—GGTGACGATTTTCGCGGCA | |||
blaCTX-M-2 | CTXM-2 F GACTCAGAGCATTCGCCGC | 55 °C | 870 |
CTXM-2 R TCAGAAACCGGGGTTACGA | |||
blaTEM | TEM CR F (233)—CGWGTCGCCCTTATTCCCT | 55 °C | 1066 |
TEM R (235)—CCAAWGCTTAATCAGTGA | |||
blaSHV | SHV F CAGCGTGACATCATTCTGTG | 55 °C | 838 |
SHV R TCTGCTTACCAGGCGCATTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gonçalves, L.A.; Anjos, B.B.; Tavares, B.M.; Marchi, A.P.; Côrtes, M.F.; Higashino, H.R.; de Carvalho Moraes, B.d.G.; Bampi, J.V.B.; Pinheiro, L.D.; Spadao, F.d.S.; et al. Colonization by Extended-Spectrum β-Lactamase-Producing Enterobacterales and Bacteremia in Hematopoietic Stem Cell Transplant Recipients. Antibiotics 2024, 13, 448. https://doi.org/10.3390/antibiotics13050448
Gonçalves LA, Anjos BB, Tavares BM, Marchi AP, Côrtes MF, Higashino HR, de Carvalho Moraes BdG, Bampi JVB, Pinheiro LD, Spadao FdS, et al. Colonization by Extended-Spectrum β-Lactamase-Producing Enterobacterales and Bacteremia in Hematopoietic Stem Cell Transplant Recipients. Antibiotics. 2024; 13(5):448. https://doi.org/10.3390/antibiotics13050448
Chicago/Turabian StyleGonçalves, Luiza Arcas, Beatriz Barbosa Anjos, Bruno Melo Tavares, Ana Paula Marchi, Marina Farrel Côrtes, Hermes Ryoiti Higashino, Bruna del Guerra de Carvalho Moraes, José Victor Bortolotto Bampi, Liliane Dantas Pinheiro, Fernanda de Souza Spadao, and et al. 2024. "Colonization by Extended-Spectrum β-Lactamase-Producing Enterobacterales and Bacteremia in Hematopoietic Stem Cell Transplant Recipients" Antibiotics 13, no. 5: 448. https://doi.org/10.3390/antibiotics13050448
APA StyleGonçalves, L. A., Anjos, B. B., Tavares, B. M., Marchi, A. P., Côrtes, M. F., Higashino, H. R., de Carvalho Moraes, B. d. G., Bampi, J. V. B., Pinheiro, L. D., Spadao, F. d. S., Rocha, V., Guimarães, T., & Costa, S. F. (2024). Colonization by Extended-Spectrum β-Lactamase-Producing Enterobacterales and Bacteremia in Hematopoietic Stem Cell Transplant Recipients. Antibiotics, 13(5), 448. https://doi.org/10.3390/antibiotics13050448