Epidemiological Investigation and Genetic Analysis of Duck Circovirus in Korea from 2013 to 2022
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. DNA Extraction
2.3. Virus Detection and Whole-Genome Amplification
2.4. Sequence Analysis
3. Results
3.1. Epidemiological Investigation
3.2. Phylogenetic Analysis
3.3. Homology Analysis
3.4. Amino Acid Mutation Analysis
3.5. Recombination Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hattermann, K.; Schmitt, C.; Soike, D.; Mankertz, A. Cloning and sequencing of Duck circovirus (DuCV). Arch. Virol. 2003, 148, 2471–2480. [Google Scholar] [CrossRef] [PubMed]
- Lei, X.N.; Wang, A.P.; Zhu, S.Y.; Wu, S. From obscurity to urgency: A comprehensive analysis of the rising threat of duck circovirus. Vet Res. 2024, 55, 12. [Google Scholar] [CrossRef] [PubMed]
- Ji, J.; Chen, Q.X.; Sui, C.G.; Yu, Z.L.; Xu, X.; Yao, L.G.; Kan, Y.C.; Bi, Y.Z.; Xie, Q.M. Novel genotype definition and genome characteristics of duck circovirus in central and Eastern China. Transbound. Emerg. Dis. 2020, 67, 2993–3004. [Google Scholar] [CrossRef] [PubMed]
- Liao, J.Y.; Xiong, W.J.; Tang, H.; Xiao, C.T. Identification and characterization of a novel circovirus species in domestic laying ducks designated as duck circovirus 3 (DuCV3) from Hunan province, China. Vet. Microbiol. 2022, 275, 109598. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Yang, C.; Jia, R.Y.; Wang, M.S.; Chen, S.; Liu, M.F.; Zhu, D.K.; Zhao, X.X.; Yang, Q.; Wu, Y.; et al. Induction of a protective response in ducks vaccinated with a DNA vaccine encoding engineered duck circovirus Capsid protein. Vet. Microbiol. 2018, 225, 40–47. [Google Scholar] [CrossRef]
- Xiang, Q.W.; Wang, X.; Xie, Z.J.; Sun, Y.N.; Zhu, Y.L.; Wang, S.J.; Liu, H.J.; Jiang, S.J. ORF3 of duck circovirus: A novel protein with apoptotic activity. Vet. Microbiol. 2012, 159, 251–256. [Google Scholar] [CrossRef]
- Fu, G.H.; Shi, S.H.; Huang, Y.; Cheng, L.F.; Peng, C.X.; Wan, C.H.; Chen, H.M.; Lin, F.; Lin, J.S. Genetic Diversity and Genotype Analysis of Duck Circovirus. Avian Dis. 2011, 55, 311–318. [Google Scholar] [CrossRef]
- Zhang, Z.L.; Jia, R.Y.; Lu, Y.Y.; Wang, M.S.; Zhu, D.K.; Chen, S.; Yin, Z.Q.; Chen, X.Y.; Cheng, A.C. Identification, genotyping, and molecular evolution analysis of duck circovirus. Gene 2013, 529, 288–295. [Google Scholar] [CrossRef]
- Soike, D.; Albrecht, K.; Hattermann, K.; Schmitt, C.; Mankertz, A. Novel circovirus in mulard ducks with developmental and feathering disorders. Vet. Rec. 2004, 154, 792–793. [Google Scholar] [CrossRef]
- Fringuelli, E.; Scott, A.N.J.; Beckett, A.; McKillen, J.; Smyth, J.A.; Palya, V.; Glavits, R.; Ivanics, E.; Mankertz, A.; Franciosini, M.P.; et al. Diagnosis of duck circovirus infections by conventional and real-time polymerase chain reaction tests. Avian Pathol. 2005, 34, 495–500. [Google Scholar] [CrossRef]
- Chen, C.L.; Wang, P.X.; Lee, M.S.; Shien, J.H.; Shieh, H.K.; Ou, S.J.; Chen, C.H.; Chang, P.C. Development of a polymerase chain reaction procedure for detection and differentiation of duck and goose circovirus. Avian Dis. 2006, 50, 92–95. [Google Scholar] [CrossRef]
- Wang, D.; Xie, X.Y.; Zhang, D.D.; Ma, G.M.; Wang, X.Y.; Zhang, D.B. Detection of duck circovirus in China: A proposal on genotype classification. Vet. Microbiol. 2011, 147, 410–415. [Google Scholar] [CrossRef] [PubMed]
- Yuan, S.; Yao, X.Y.; Yang, H.H.; Zhang, Y.Q.; Liu, H.; Sun, J.; Lv, Z.H.; Huang, S.J.; Zhang, X.L. Research note: Genetic diversity of duck circoviruses circulating in partial areas of Guangdong province, southern China. Poult. Sci. 2022, 101, 102032. [Google Scholar] [CrossRef]
- Tran, G.T.H.; Mai, N.T.; Bui, V.N.; Dao, T.D.; Trinh, D.Q.; Vu, T.T.T.; Le, V.P.; Dong, H.V. Duck circovirus in northern Vietnam: Genetic characterization and epidemiological analysis. Arch. Virol. 2022, 167, 1871–1877. [Google Scholar] [CrossRef]
- Neale, S.; Welchman, D.; Garcia-Rueda, C.; Grierson, S.; Pearson, A. Detection of duck circovirus in Great Britain. Vet. Rec. 2022, 191, 424. [Google Scholar] [CrossRef]
- Cha, S.Y.; Kang, M.; Cho, J.G.; Jang, H.K. Genetic analysis of duck circovirus in Pekin ducks from South Korea. Poult. Sci. 2013, 92, 2886–2891. [Google Scholar] [CrossRef]
- Cha, S.Y.; Song, E.T.; Kang, M.; Wei, B.; Seo, H.S.; Roh, J.H.; Yoon, R.H.; Moon, O.K.; Jang, H.K. Prevalence of Duck Circovirus Infection of Subclinical Pekin Ducks in South Korea. J. Vet. Med. Sci. 2014, 76, 597–599. [Google Scholar] [CrossRef]
- Wan, C.H.; Fu, G.H.; Shi, S.H.; Cheng, L.F.; Chen, H.M.; Peng, C.X.; Lin, S.; Huang, Y. Epidemiological investigation and genome analysis of duck circovirus in Southern China. Virol. Sin. 2011, 26, 289–296. [Google Scholar] [CrossRef]
- Niu, X.; Liu, L.; Han, C.; Li, J.; Zeng, X. First findings of duck circovirus in migrating wild ducks in China. Vet. Microbiol. 2018, 216, 67–71. [Google Scholar] [CrossRef]
- Liu, H.; Li, L.X.; Sun, W.C.; Shi, N.; Sun, X.T.; Jin, N.Y.; Si, X.K. Molecular survey of duck circovirus infection in poultry in southern and southwestern China during 2018 and 2019. BMC Vet. Res. 2020, 16, 80. [Google Scholar] [CrossRef]
- Banda, A.; Galloway-Haskins, R.I.; Sandhu, T.S.; Schat, K.A. Genetic analysis of a duck circovirus detected in commercial Pekin ducks in New York. Avian Dis. 2007, 51, 90–95. [Google Scholar] [CrossRef]
- Zhang, X.; Jiang, S.; Wu, J.; Zhao, Q.; Sun, Y.; Kong, Y.; Li, X.; Yao, M.; Chai, T. An investigation of duck circovirus and co-infection in Cherry Valley ducks in Shandong Province, China. Vet. Microbiol. 2009, 133, 252–256. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Li, J.; Zhang, R.; Chen, J.; Wang, W.; Lan, J.; Xie, Z.; Jiang, S. Duck “beak atrophy and dwarfism syndrome” disease complex: Interplay of novel goose parvovirus-related virus and duck circovirus? Transbound. Emerg. Dis. 2018, 65, 345–351. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.P.; Sui, N.N.; Zhang, R.H.; Lan, J.J.; Li, P.F.; Lian, C.Y.; Li, H.Q.; Xie, Z.J.; Jiang, S.J. Coinfection of novel goose parvovirus-associated virus and duck circovirus in feather sacs of Cherry Valley ducks with feather shedding syndrome. Poult. Sci. 2020, 99, 4227–4234. [Google Scholar] [CrossRef] [PubMed]
- Hong, Y.T.; Kang, M.; Jang, H.K. Pathogenesis of duck circovirus genotype 1 in experimentally infected Pekin ducks. Poult. Sci. 2018, 97, 3050–3057. [Google Scholar] [CrossRef]
- Cui, X.Z.; Zhu, Y.D.; Wu, Q.; He, D.L.; Mao, M.T.; Wei, F.; Wu, B.R.; Zhu, S.M.; Cui, Y.T.; Han, Q.H.; et al. Pathogenicity of duck circovirus 1 in experimentally infected specific pathogen-free ducks. Poult. Sci. 2024, 103, 7. [Google Scholar] [CrossRef]
- Zhang, T.T.; Liu, N.; Zhang, L.; Jiang, W.S.; Fan, X.L.; Wang, X.Y.; Miao, R.C.; Zhai, X.Y.; Wei, L.M.; Jiang, S.J.; et al. Research Note: Complete genome cloning and genetic evolution analysis of four Cherry Valley duck circovirus strains in China in 2022. Poult. Sci. 2023, 102, 102920. [Google Scholar] [CrossRef]
- Martin, D.P.; Murrell, B.; Golden, M.; Khoosal, A.; Muhire, B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015, 1, vev003. [Google Scholar] [CrossRef]
- Wang, X.K.; Li, L.Z.; Shang, H.Q.; Zhou, F.; Wang, C.; Zhang, S.Y.; Gao, P.P.; Guo, P.; Zhu, R.L.; Sun, Z.H.; et al. Effects of duck circovirus on immune function and secondary infection of Avian Pathogenic Escherichia coli. Poult. Sci. 2022, 101, 101799. [Google Scholar] [CrossRef]
- Li, Z.L.; Fu, G.H.; Feng, Z.H.; Chen, J.H.; Shi, S.H.; Liu, R.C.; Cheng, L.F.; Chen, H.M.; Wan, C.H.; Huang, Y. Evaluation of a novel inactivated vaccine against duck circovirus in muscovy ducks. Vet. Microbiol. 2020, 241, 108574. [Google Scholar] [CrossRef]
- Wang, X.K.; Zhang, S.Y.; Shang, H.Q.; Wang, C.; Zhou, F.; Liu, Y.; Jiang, Y.X.; Gao, P.P.; Li, N.; Liu, D.F.; et al. Evaluation of the antiviral effect of four plant polysaccharides against duck circovirus. Res. Vet. Sci. 2022, 152, 446–457. [Google Scholar] [CrossRef]
- Mo, I.P.; Bae, Y.J.; Lee, S.B.; Mo, J.S.; Oh, K.H.; Shin, J.H.; Kang, H.M.; Lee, Y.J. Review of Avian Influenza Outbreaks in South Korea from 1996 to 2014. Avian Dis. 2016, 60, 172–177. [Google Scholar] [CrossRef]
- Liu, S.S.; Higgins, D.A. Yolk-sac transmission and post-hatching ontogeny of serum immunoglobulins in the duck (Anas platyrhynchos). Comp. Biochem. Physiol. B 1990, 97, 637–644. [Google Scholar] [CrossRef]
- Rollier, C.; Charollois, C.; Jamard, C.; Trepo, C.; Cova, L. Maternally transferred antibodies from DNA-immunized avians protect offspring against hepadnavirus infection. J. Virol. 2000, 74, 4908–4911. [Google Scholar] [CrossRef][Green Version]
- Maas, R.; Rosema, S.; van Zoelen, D.; Venema, S. Maternal immunity against avian influenza H5N1 in chickens: Limited protection and interference with vaccine efficacy. Avian Pathol. 2011, 40, 87–92. [Google Scholar] [CrossRef]
- Li, Z.G.; Wang, X.; Zhang, R.H.; Chen, J.H.; Xia, L.L.; Lin, S.L.; Xie, Z.J.; Jiang, S.J. Evidence of possible vertical transmission of duck circovirus. Vet. Microbiol. 2014, 174, 229–232. [Google Scholar] [CrossRef]
- Kulprasertsri, S.; Songserm, T.; Phatthanakunanan, S.; Saengnual, P.; Sinwat, N.; Khamtae, R.; Lertwatcharasarakul, P. Molecular genotyping and subgenotyping of duck circovirus at duck farms in Thailand. Vet. World 2024, 17, 1990–1999. [Google Scholar] [CrossRef]
- Reed, K.D.; Meece, J.K.; Henkel, J.S.; Shukla, S.K. Birds, migration and emerging zoonoses: West nile virus, lyme disease, influenza A and enteropathogens. Clin. Med. Res. 2003, 1, 5–12. [Google Scholar] [CrossRef]
- Gaudet, M.; Fara, A.-G.; Beritognolo, I.; Sabatti, M. Allele-specific PCR in SNP genotyping. Methods Mol. Biol. 2009, 578, 415–424. [Google Scholar] [CrossRef]
- Constans, M.; Ssemadaali, M.; Kolyvushko, O.; Ramamoorthy, S. Antigenic Determinants of Possible Vaccine Escape by Porcine Circovirus Subtype 2b Viruses. Bioinform. Biol. Insights 2015, 9, 1–12. [Google Scholar] [CrossRef]
- Retel, C.; Märkle, H.; Becks, L.; Feulner, P.G.D. Ecological and Evolutionary Processes Shaping Viral Genetic Diversity. Viruses 2019, 11, 220. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhang, D.; Bai, C.X.; Guo, X.; Gao, W.H.; Li, M.L.; Wang, J.; Li, Y.D. Molecular characteristics of a novel duck circovirus subtype 1d emerging in Anhui, China. Virus Res. 2021, 295, 198216. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequences (5′–3′) | Location * | Size (bp) | Reference |
---|---|---|---|---|
DuCVaF | MGAGCTGCCGCCCTTGAG | 238–255 | 408 | [21] |
DuCVaR | TCCCGAGTAACCGTCCCACCAC | 624–645 | ||
DuCV-FLA1-F | ACTGCAATGGCGAAGAG | 43–59 | 418 | In this study |
DuCV-FLA1-R | CATAAGTCGTGGGGAACT | 443–460 | ||
DuCV-P1-F | TTGAAGAGTCGCTGGGAGGAA | 251–271 | 518 | [27] |
DuCV-P1-R | CTTAGCAACAAACTGGGTCA | 749–768 | ||
DuCV-FLA2-F | ATGCATTTGAATTTCCCGCC | 575–594 | 818 | In this study |
DuCV-FLA2-R | GTACTTCGTACCTAAGCC | 1375–1392 | ||
DuCV-FLA3-F | CTCATGCCCATGCCGTAATG | 1258–1277 | 724 | In this study |
DuCV-FLA3-R | CGCTTGTGCGGTCTTTTAT | 1963–1981 | ||
DuCV-P3-F | GTAGCCTTCGTCTTCTGAGT | 1847–1866 | 468 | [27] |
DuCV-P3-R | TATTCTTCATTATCTTCGTCA | 300–320 |
Region | |||||||||
---|---|---|---|---|---|---|---|---|---|
GW * | GG * | GB * | JN * | JB * | CN * | CB * | Unknown | Total | |
Detection samples | 2 | 12 | 9 | 40 | 9 | 11 | 82 | 19 | 184 |
Infection samples | 0 | 4 | 1 | 15 | 3 | 3 | 24 | 4 | 54 |
Infection rate | 0% | 33.3% | 11.1% | 37.5% | 30.0% | 27.3% | 29.3% | 21.1% | 29.4% |
Complete Genome | ORF1 | ORF2 | |||
---|---|---|---|---|---|
nt | nt | aa | nt | aa | |
Genotype 1b (South Korea) | 96.0~100% | 97.4~100% | 98.3~100% | 93.8~100% | 95.0~100% |
Genotype 1b (other countries) | 91.3~99.4% | 96.3~99.5% | 97.3~100% | 89.6~99.4% | 91.1~100% |
Genotype 1a | 92.9~96.9% | 95.9~99.3% | 97.6~100% | 88.2~94.1% | 94.2~99.2% |
Genotype 1c | 93.3~95.3% | 96.7~98.8% | 98.3~100% | 87.7~90.3% | 93.4~97.3% |
Genotype 1d | 91.0~92.2% | 95.9~97.3% | 98.3~99.7% | 88.1~90.2% | 92.6~95.0% |
Genotype 2a | 83.7~85.6% | 88.4~92.6% | 92.2~97.6% | 78.7~82.6% | 87.2~92.2% |
Genotype 2b | 82.7~84.0% | 87.3~88.3% | 92.8~95.6% | 78.2~81.3% | 85.7~89.5% |
Genotype 2c | 82.3~84.0% | 87.0~89.8% | 92.2~95.6% | 77.9~80.1% | 84.9~88.4% |
Complete Genome | ORF1 | ORF2 | |||
---|---|---|---|---|---|
nt | nt | aa | nt | aa | |
Genotype 1a | 95.8~99.6% | 96.9~99.7% | 98.3~100% | 93.5~99.7% | 96.5~100% |
Genotype 1b (South Korea) | 94.1~95.4% | 96.8~97.6% | 99.0~100% | 90.6~92.6% | 95.0~97.7% |
Genotype 1b (other countries) | 90.7~95.2% | 95.9~98.1% | 98.3~100% | 86.4~92.9% | 91.5~98.1% |
Genotype 1c | 94.4~95.0% | 97.1~98.1% | 99.3~100% | 90.6~91.6% | 95.0~96.9% |
Genotype 1d | 92.6~93.5% | 96.5~97.1% | 99.3~99.7% | 92.0~92.5% | 94.2~95.0% |
Genotype 2a | 84.2~85.1% | 88.3~92.9% | 93.2~97.6% | 78.7~82.9% | 88.4~91.1% |
Genotype 2b | 82.2~82.7% | 87.3~87.9% | 93.9~94.9% | 77.6~78.9% | 87.6~88.8% |
Genotype 2c | 82.0~82.8% | 87.0~88.9% | 93.2~94.9% | 77.9~78.7% | 86.4~88.0% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, C.-D.; Kim, S.-W.; Liu, C.-X.; Gao, Y.-H.; Li, Y.-F.; Park, J.-Y.; Cha, S.-Y.; Jang, H.-K.; Kang, M.; Wei, B. Epidemiological Investigation and Genetic Analysis of Duck Circovirus in Korea from 2013 to 2022. Animals 2024, 14, 3630. https://doi.org/10.3390/ani14243630
Yu C-D, Kim S-W, Liu C-X, Gao Y-H, Li Y-F, Park J-Y, Cha S-Y, Jang H-K, Kang M, Wei B. Epidemiological Investigation and Genetic Analysis of Duck Circovirus in Korea from 2013 to 2022. Animals. 2024; 14(24):3630. https://doi.org/10.3390/ani14243630
Chicago/Turabian StyleYu, Cheng-Dong, Sang-Won Kim, Cun-Xia Liu, Yue-Hua Gao, Yu-Feng Li, Jong-Yeol Park, Se-Yeoun Cha, Hyung-Kwan Jang, Min Kang, and Bai Wei. 2024. "Epidemiological Investigation and Genetic Analysis of Duck Circovirus in Korea from 2013 to 2022" Animals 14, no. 24: 3630. https://doi.org/10.3390/ani14243630
APA StyleYu, C.-D., Kim, S.-W., Liu, C.-X., Gao, Y.-H., Li, Y.-F., Park, J.-Y., Cha, S.-Y., Jang, H.-K., Kang, M., & Wei, B. (2024). Epidemiological Investigation and Genetic Analysis of Duck Circovirus in Korea from 2013 to 2022. Animals, 14(24), 3630. https://doi.org/10.3390/ani14243630