Next Article in Journal
Evaluation of Dietary Organic and Inorganic Mercury Threshold Levels on Induced Mercury Toxicity in a Marine Fish Model
Previous Article in Journal
A Simple and Efficient Semen Cryopreservation Method to Increase the Genetic Variability of Endangered Mediterranean Brown Trout Inhabiting Molise Rivers
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 10
Issue 3
10.3390/ani10030404
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Glutamine on Antioxidant Capacity and Lipid Peroxidation in the Breast Muscle of Heat-stressed Broilers via Antioxidant Genes and HSP70 Pathway

by
Hong Hu
1,†,
Liang Chen
2,†,
Sifa Dai
3,
Jiaqi Li
1 and
Xi Bai
1,*
1
College of Animal Science, Anhui Science and Technology University, Chuzhou 233100, China
2
State Key Laboratory of Animal Nutrition, Institute of Animal Sciences, Chinese Academy of Agriculture Science, Beijing 100193, China
3
Department of Pharmaceutical and Life Sciences, Jiujiang University, Jiujiang 332005, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to the experimentations.
Animals 2020, 10(3), 404; https://doi.org/10.3390/ani10030404
Submission received: 22 January 2020 / Accepted: 13 February 2020 / Published: 29 February 2020
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Broilers are heat stress sensitive animals. Heat stress can reduce the meat quality and increase the oxidative stress of broilers. The aim of this study was to investigate the effect of dietary supplementation with Glutamine (Gln) on meat quality, antioxidant capacity, lipid peroxidation, antioxidant genes, and the HSP70 gene and protein expression in broilers exposed to cyclic heat stress. Results showed that Gln improved the meat quality in heat-stressed broilers. In conclusion, our study suggested that dietary Gln supplementation alleviated antioxidant capacity and lipid peroxidation in the breast muscle of heat-stressed broilers by antioxidant genes and the HSP70 pathway.

Abstract

This study investigated whether Glutamine (Gln) could be used as an additive to improve antioxidant capacity in the breast muscle of heat-stressed broilers. Two hundred and forty 22-day-old Arbor Acres broilers in the G1, G2, G3, and G4 groups (n = 60 each) were housed in a cyclic hot environment and fed the basal diet with 0%, 0.5%, 1.0%, and 1.5% Gln, respectively. Compared with the G1 group, dietary 1.5% Gln increased (p < 0.05) pH and b* values, but decreased (p < 0.05) L* cooking loss, drip loss, and water loss rate in breast meat of heat-stressed broilers. Malondialdehyde levels in the breast muscle were lower (p < 0.05) in 1.0% and 1.5% Gln groups than that of the heat-stress group. Compared with the G1 group, dietary 1.5% Gln increased (p < 0.05) catalase (CAT), glutathione, glutathione peroxidase (GSH-Px,) and total antioxidant capacity in the breast muscle of heat-stressed broilers. Furthermore, the CAT, GSH-Px, HSP70 mRNA expression levels, and HSP70 protein expression levels were increased (p < 0.05) in the G3 and G4 groups compared with the G1 group. In sum, Gln alleviated antioxidant capacity and lipid peroxidation in the breast muscle of heat-stressed broilers through antioxidant genes and HSP70 pathways.

1. Introduction

Broilers are heat stress sensitive animals [1]. When the ambient air temperature increases to an extent that the broilers’ body cannot adjust, the body cannot expel heat in time, resulting in a heat stress reaction. Heat stress can increase body metabolism, produce large amounts of free radicals, cause lipid peroxidation, damage proteins and DNA, and lead to oxidative stress, which decreases the meat quality [2,3,4]. Due to intensive, industrial feeding and global warming, the degree of heat stress on poultry is increasing, especially in the hot and humid south in summer, which seriously restricts the development of the poultry industry [5,6,7]. Therefore, it is of great significance to find feasible methods to enhance the heat resistance of the body.
Heat shock protein 70 (HSP70) is one of the most important proteins in the heat shock protein (HSP) family [8,9]. The level of HSP70 is very low under non-stress condition, and the heat stress transcription factor (HSF) exists in the cytoplasm in the form of monomers. Under heat and other stress conditions, HSF combines with the heat shock promoter element (HSE) to activate the transcriptional synthesis of HSP70 and increase the expression of HSP70. The level of HSP70 is positively correlated with temperature under high-temperature stress [10,11,12,13]. HSP70 is considered to be an important protective molecule that measures the functional state and anti-stress ability of cells under stress [14].
Glutamine (Gln), a precursor of glutamate, is involved in many metabolic pathways [15]. When the body is stressed, the level of Gln decreases, which suppresses the function of the body. The addition of Gln enhances the body’s resistance to stress [16,17]. Our previous studies revealed that Gln can improve meat quality and effectively alleviate the adverse reactions caused by heat stress in broilers [18,19]. In addition, some studies have shown that Gln can increase the expression of HSP70 in the body and reduce cellular and oxidative damage [20,21,22]. It is speculated that Gln can induce and enhance the expression of HSP70, thus increasing the ability to resist heat stress.
Although it has been shown that Gln has a positive effect in alleviating heat stress, there is little research on the relationship between Gln and HSP70 expression in broilers under high temperature conditions [23]. Therefore, in this study, we determined whether Gln can enhance the anti-oxidative stress ability of the breast muscle by increasing the expression of antioxidant genes and HSP70 in broilers exposed to cyclic heat stress.

2. Materials and Methods

2.1. Birds, Experimental Design and Sample Collection

The experiment was performed according to the guidelines for the care and use of experimental animals of the Ministry of Science and Technology of the People’s Republic of China (Approval Number 2006-398) and approved by the Animal Care and Use Committee of Anhui Science and Technology University. Two hundred and forty 22-day-old Arbor Acres broilers were obtained from the farm in the Anhui Science and Technology University. Six replicates (10 broilers per replicate) of four heat-stressed groups including G1, G2, G3, and G4 were employed. The birds in the G1, G2, G3, and G4 groups were housed in a hot environment and fed the basal diet with 0%, 0.5%, 1.0%, and 1.5% Gln, respectively. The hot environment was 34 °C (humidity: 60–70%) for 8 h (09:00–17:00) and 24 °C (humidity: 45–55%) during rest time (17:00-09:00). The basal diet (Table 1) was designed based on the NRC [24], Bai et al. [19] and Hu et al. [25]. The duration of the heat exposure was 21 days. At 42 days of age, 18 broilers/group (3 broilers/replicate) were selected and sacrificed to collect the breast muscle samples for further analysis.

2.2. Meat Quality Analysis

The pH of breast meat was detected using a pH device (Mettler-Toledo, Greisensee, Switzerland) 45 min after slaughter, as described by Hu et al. [25]. The meat color of the breast was detected using a Minolta colorimeter (Konica-Minolta, Tokyo, Japan) according to lightness (L*), redness (a*), and yellowness (b*). The cooking loss (CL), drip loss (DL) and water loss rate (WLR) were measured as described by Hu et al. [25]. The breast meat was weighed (WInitial), steamed in a pot for 30 min, and then reweighted (WFinal). The equation of CL is: CL (%) = (WInitial − WFinal)/WInitial × 100. To measure DL, the breast meat was weighed (WInitial) and placed in a plastic bag at 4 °C. After 24 h, the meat sample was reweighted (WFinal). The equation of DL is: DL (%) = (WInitial − WFinal)/WInitial × 100. To measure WLR, the breast was weighed (WInitial) and placed in 18 layers of filter paper. Then, the sample was pressed at 2000 psi for 60 s. The meat sample was reweighed immediately (WFinal). The equation of WLR is: WLR (%) = (WInitial − WFinal)/WInitial × 100.

2.3. Measurement of Redox State in the Breast Muscle

The 10% homogenate of breast muscle was prepared under cold conditions. The superoxide dismutase (SOD), catalase (CAT), glutathione (GSH), glutathione peroxidase (GSH-Px), total antioxidant capacity (T-AOC), and malondialdehyde (MDA) were detected by commercial kits (Jiancheng Institute of Bioengineering, Nanjing, China) with a spectrophotometer (Jingke company, Shanghai, China).

2.4. Measurement of HSP70 Levels in Breast Muscle

The HSP70 level in the breast muscle was detected using a chicken HSP70 enzyme-linked immunosorbent assay (ELISA) kit which was purchased from Jiancheng Institute of Bioengineering (Nanjing, China) with a Thermo Scientific Multiskan GO (Massachusetts, USA).

2.5. Quantitative Real-Time PCR (qRT-PCR)

Total RNA was extracted from breast muscle according to the manufacturer’s instructions of the TianGen RNAprep pure tissue kit (Beijing, China). The isolated total RNA was measured by a spectrophotometer (Eppendorf, Hamburg, Germany) and reverse transcribed with the PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, Dalian, China).
Relative mRNA expression levels of HSP70, GSH-Px, CAT, SOD, and β-actin (housekeeping gene) were quantified by qRT-PCR with primers (Table 2) in accordance with Hu et al. [25]. The qRT-PCR was performed on the Roche LightCycler 480 II (Basel, Switzerland) using TB Green® Premix Ex Taq™ (Takara, Dalian, China) according to the manufacturer’s protocol. The reaction system and program were similar to the method of Zhang et al. [26]. Relative mRNA expression of the target gene was quantified by the 2−ΔΔCT method [27].

2.6. Statistical Analysis

The statistical analyses were performed using the SPSS statistical package (version 18.0) with a one-way analysis of variation (ANOVA). Duncan’s test was used to evaluate the difference among the groups. The data were expressed as mean ± SEM and p < 0.05 was regarded as significant. Linear and quadratic trends were used to detect the influences of different levels of Gln in the diet.

3. Results

3.1. Meat Quality

Table 3 shows the meat quality of breast in broilers exposed to heat stress. Compared with the G1 group, the b* increased (p < 0.05), but the DL (p < 0.05) decreased in the G2 group; the b* and pH were increased (p < 0.05), but the L* and DL were decreased (p < 0.05) in the G3 group; the b* and pH were increased (p < 0.05), but the L*, DL, WLR, and CL were decreased (p < 0.05) in the G4 group. Furthermore, the b*, L*, pH, DL, WLR and CL of the breast meat in the Gln-supplemented groups showed a liner dose response (p < 0.05).

3.2. MDA in the Breast Muscle

As shown in Figure 1, the MDA decreased (p < 0.05) in the G3 and G4 groups compared with the G1 group. The MDA of the breast muscle in the Gln-supplemented groups showed a liner dose response (p < 0.05).

3.3. SOD, CAT, GSH, GSH-Px, and T-AOC Levels in the Breast Muscle

Table 4 shows the redox status of breast in broilers exposed to heat stress. Compared with the G1 group, the T-AOC increased (p < 0.05) in the G2 group, the GSH and T-AOC increased (p < 0.05) in the G3 group, and the CAT, GSH, GSH-Px and T-AOC increased (p < 0.05) in the G4 group. The CAT, GSH GSH-Px and T-AOC of the breast muscle in the Gln-supplemented groups showed a liner dose response (p < 0.05). Furthermore, the CAT of the breast muscle in the Gln-supplemented groups showed a quadratic dose response (p < 0.05).

3.4. Gene Expression of Antioxidant Enzymes in the Breast Muscle

As shown in Figure 2, the GSH-Px mRNA expression level increased (p < 0.05) in the G2 group, and the CAT and GSH-Px mRNA expression levels increased (p < 0.05) in the G3 and G4 groups when compared with the G1 group. The CAT and GSH-Px mRNA expression levels showed a linear increase (p < 0.05) following the Gln supplementation.

3.5. Gene and Protein Expression Levels of HSP70 in the Breast Muscle

As shown in Figure 3, the HSP70 mRNA and protein expression levers increased (p < 0.05) in the G2, G3, and G4 group when compared with the G1 group. The HSP70 mRNA and protein expression levers showed a linear increase (p < 0.05) following the Gln supplementation.

4. Discussion

With the improvement in people’s quality of life, there is an increasing demand for high-quality meat [4,25]. The main indexes of meat quality include muscle tenderness, water retention, color, and pH [28]. Several studies have showed that heat stress could reduce the meat quality of livestock and poultry [28,29]. Supplementation of exogenous Gln, during heat stress, can meet the requirements of tissue for Gln, improve the metabolism of the body, and effectively increase the pH of the muscle [18,30]. The present results also showed that dietary Gln significantly increased the pH value of breast muscle in stressed broilers. The meat pH not only directly reacted to muscle acidity, but also affected meat color, drip loss and other indicators [31]. In this experiment, the DL, WLR, CL and meat color of breast muscle were improved after the addition of Gln. Similar results were also found in Dai et al., which showed that dietary supplementation of 20 g/kg glutamine could significantly increase pH value and water content of chicken, and significantly decrease CL and L*of chicken [18]. These findings suggested that the addition of Gln could improve the negative effect of high temperature stress on meat quality.
Chicken meat is rich in unsaturated fatty acids, which is prone to lipid peroxide and produces pale soft exudative (PSE) meat [31]. MDA, a marker of lipid peroxidation, is a stable end product of lipid oxidation in broiler muscle [12,32,33]. Cheng et al. suggested that the decreased MDA reflect the reduction of oxidative stress damage caused by heat stress in the broiler muscle [34]. In the present study, dietary Gln could effectively reduce the level of MDA in the breast muscle, indicating that the lipid peroxidation was alleviated in heat-stressed broilers.
It is easy to induce heat stress on broiler chicks in an environment of high temperature and high humidity [35,36]. Hot environments could stimulate the production of a large number of reactive oxygen species and free radicals in broiler breast muscle, which could become an important factor affecting meat quality [18,37,38]. SOD, GSH-Px, CAT, and GSH are the main antioxidants in the cells of the body, and their activity and content indirectly reflect the ability of the body to scavenge free radicals [12]. This study showed that the GSH-Px, CAT, GSH, T-AOC and T-AOC in the broiler breast muscle were significantly increased in the high temperature group after adding Gln. Furthermore, the supplementation of Gln raised the gene expression levels of GSH-Px and CAT in the breast muscle of heat-stressed broilers. Similarly, Hu et al. reported that dietary Gln improved antioxidant capacity and lipid peroxidation by activating the antioxidant gene expression in the thigh muscle of broiler exposed to cyclic heat stress [25].
HSP70 is distributed in various cell types, and its expression increases significantly under stress conditions [14,39]. It can enhance the tolerance of cells to stimulants, protect tissues, and reduce lipid peroxidation and DNA breakage induced by reactive oxygen species, thereby making the body adapt to heat and improve body tolerance [40]. Because of its physiological and pathological functions, HSP70 has become a hot spot in broiler science research. Several research articles indicated that there was an empirical relationship between oxidative stress and HSP70 expression [40,41]. Zhang et al. pointed out a raised HSP70 transcriptional level when broilers were exposed to hot environments [12]. Parallel to the research of Gu et al., our results showed that the HSP70 mRNA and protein level in the breast muscle of heat-stressed broiler chickens increased significantly after the addition of Gln [42]. These results suggested that Gln could protect the cells by increasing the HSP70 level in the breast muscle and thus reducing the oxidative damage caused by heat stress.

5. Conclusions

The present study suggested that dietary Gln supplementation alleviated antioxidant capacity and lipid peroxidation in the breast muscle of heat-stressed broilers by antioxidant genes and the HSP70 pathway.

Author Contributions

Conceptualization, H.H., L.C., S.D. and X.B.; data curation, H.H. and J.L.; formal analysis, H.H., L.C. and X.B.; funding acquisition, H.H., L.C. and X.B.; investigation, H.H.; methodology, H.H. and J.L.; software, S.D.; visualization, J.L.; writing—original draft, H.H. and X.B.; writing—review and editing, H.H., L.C. and X.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by National Natural Science Foundation of China (No. 31601983), Open Fund of State Key Laboratory of Animal Nutrition (No. 2004DA125184F1910), Initial Scientific Research Foundation for Talents of Anhui Science and Technology University (DKYJ201802), and the key discipline fund of Animal Science in Anhui Science and Technology University (AKZDXK2015B03).

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Goo, D.; Kim, J.H.; Park, G.H.; Delos Reyes, J.B.; Kil, D.Y. Effect of heat stress and stocking density on growth performance, breast meat quality, and intestinal barrier function in broiler chickens. Animals 2019, 9, 107. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Belhadj Slimen, I.; Najar, T.; Ghram, A.; Abdrrabba, M. Heat stress effects on livestock: Molecular, cellular and metabolic aspects, a review. J. Anim. Physiol. An. N 2016, 100, 401–412. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Habibian, M.; Ghazi, S.; Moeini, M.M. Effects of dietary selenium and vitamin E on growth performance, meat yield, and selenium content and lipid oxidation of breast meat of broilers reared under heat stress. Biol. Trace. Elem. Res. 2016, 169, 142–152. [Google Scholar] [CrossRef] [PubMed]
  4. Lu, Z.; He, X.; Ma, B.; Zhang, L.; Li, J.; Jiang, Y.; Zhou, G.H.; Gao, F. Dietary taurine supplementation improves breast meat quality in chronic heat-stressed broilers via activating the Nrf2 pathway and protecting mitochondria from oxidative attack. J. Sci. Food Agr. 2019, 99, 1066–1072. [Google Scholar] [CrossRef]
  5. Tsiouris, V.; Georgopoulou, I.; Batzios, C.; Pappaioannou, N.; Ducatelle, R.; Fortomaris, P. Heat stress as a predisposing factor for necrotic enteritis in broiler chicks. Avian. Pathol. 2018, 47, 616–624. [Google Scholar] [CrossRef]
  6. Erol, H.S.; Imik, H.; Gumus, R.; Halici, M. The effects of different amount of protein and vitamin E supplementation in rations on lipid and antioxidant metabolism of broilers exposed to heat stress. Braz. J. Poultry Sci. 2017, 19, 289–296. [Google Scholar] [CrossRef] [Green Version]
  7. Mohammed, A.A.; Jacobs, J.A.; Murugesan, G.R.; Cheng, H.W. Effect of dietary synbiotic supplement on behavioral patterns and growth performance of broiler chickens reared under heat stress. Poult. Sci. 2018, 97, 1101–1108. [Google Scholar] [CrossRef]
  8. Sarkar, S.; Roy, S. A mini review on heat shock proteins (HSPs): Special emphasis on heat shock protein70 (HSP70). BN Seal J. Sci. 2017, 9, 129–138. [Google Scholar]
  9. Kattaia, A.A.; El-Baset, S.A.A.; Mohamed, E.M. Heat Shock Proteins in Oxidative and Nitrosative Stress; Heat Shock Proteins and Stress; Springer: Cham, Switzerland, 2018; pp. 127–138. [Google Scholar]
  10. Wan, X.; Ahmad, H.; Zhang, L.; Wang, Z.; Wang, T. Dietary enzymatically treated Artemisia annua L. improves meat quality, antioxidant capacity and energy status of breast muscle in heat-stressed broilers. J. Sci. Food Agr. 2018, 98, 3715–3721. [Google Scholar] [CrossRef]
  11. Greene, E.S.; Rajaei-Sharifabadi, H.; Dridi, S. Feather HSP70: A novel non-invasive molecular marker for monitoring stress induced by heat exposure in broilers. Poult. Sci. 2019, 98, 3400–3404. [Google Scholar] [CrossRef]
  12. Zhang, J.; Hu, Z.; Lu, C.; Bai, K.; Zhang, L.; Wang, T. Effect of various levels of dietary curcumin on meat quality and antioxidant profile of breast muscle in broilers. J. Agr. Food Chem. 2015, 63, 3880–3886. [Google Scholar] [CrossRef] [PubMed]
  13. Givisiez, P.E.N.; Ferro, J.A.; Ferro, M.I.T.; Kronka, S.N.; Decuypere, M. Hepatic concentration of heat shock protein 70 kD (Hsp70) in broilers subjected to different thermal treatments. Brit. Poultry Sci. 1999, 40, 292–296. [Google Scholar] [CrossRef] [PubMed]
  14. Jiang, S.; Mohammed, A.A.; Jacobs, J.A.; Cramer, T.A.; Cheng, H.W. Effect of synbiotics on thyroid hormones, intestinal histomorphology, and heat shock protein 70 expression in broiler chickens reared under cyclic heat stress. Poult. Sci. 2020, 99, 142–150. [Google Scholar] [CrossRef] [PubMed]
  15. Curi, R.; Newsholme, P.; Procopio, J.; Lagranha, C.; Gorjão, R.; Pithon-Curi, T.C. Glutamine, gene expression, and cell function. Front. Biosci. 2007, 12, 344–357. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Zhao, Y.; Wang, Q.; Wang, Y.; Li, J.; Lu, G.; Liu, Z. Glutamine protects against oxidative stress injury through inhibiting the activation of PI3K/Akt signaling pathway in parkinsonian cell model. Environ. Health Prev. 2019, 24, 4. [Google Scholar] [CrossRef] [PubMed]
  17. Shanware, N.P.; Mullen, A.R.; De Berardinis, R.J.; Abraham, R.T. Glutamine: Pleiotropic roles in tumor growth and stress resistance. J. Mol. Med. 2011, 89, 229–236. [Google Scholar] [CrossRef]
  18. Dai, S.F.; Bai, X.; Zhang, D.; Hu, H.; Wu, X.; Wen, A.; He, S.J.; Zhao, L. Dietary glutamine improves meat quality, skeletal muscle antioxidant capacity and glutamine metabolism in broilers under acute heat stress. J. Appl. Anim. Res. 2018, 46, 1412–1417. [Google Scholar]
  19. Bai, X.; Dai, S.; Li, J.; Xiao, S.; Wen, A.; Hu, H. Glutamine improves the growth performance, serum biochemical profile and antioxidant status in broilers under medium-term chronic heat stress. J. Appl. Poult. Res. 2019, 28, 1248–1254. [Google Scholar] [CrossRef]
  20. Akagi, R.; Ohno, M.; Matsubara, K.; Fujimoto, M.; Nakai, A.; Inouye, S. Glutamine protects intestinal barrier function of colon epithelial cells from ethanol by modulating Hsp70 expression. Pharmacology 2013, 91, 104–111. [Google Scholar] [CrossRef]
  21. Gong, J.; Jing, L. Glutamine induces heat shock protein 70 expression via O-GlcNAc modification and subsequent increased expression and transcriptional activity of heat shock factor-1. Minerva Anestesiol. 2011, 77, 488–495. [Google Scholar]
  22. Wang, H.; Tang, C.; Jiang, Z.; Zhou, X.; Chen, J.; Na, M.; Shen, H.; Lin, Z. Glutamine promotes Hsp70 and inhibits α-Synuclein accumulation in pheochromocytoma PC12 cells. Exp. Ther. Med. 2017, 14, 1253–1259. [Google Scholar] [CrossRef] [PubMed]
  23. Olubodun, J.O.; Zulkifli, I.; Farjam, A.S.; Hair-Bejo, M.; Kasim, A. Glutamine and glutamic acid supplementation enhances performance of broiler chickens under the hot and humid tropical condition. Ital. J. Anim. Sci. 2015, 14, 3263. [Google Scholar] [CrossRef]
  24. NRC. Nutrient Requirements of Poultry; National Academy Press: Washington, DC, USA, 1994. [Google Scholar]
  25. Hu, H.; Dai, S.; Li, J.; Wen, A.; Bai, X. Glutamine improves heat stress–induced oxidative damage in the broiler thigh muscle by activating the nuclear factor erythroid 2–related 2/Kelch-like ECH-associated protein 1 signaling pathway. Poult. Sci. 2019. [Google Scholar] [CrossRef]
  26. Zhang, C.; Wang, C.; Chen, K.; Zhao, X.; Geng, Z. Effect of l-theanine on growth performance, intestinal development and health, and peptide and amino acid transporters expression of broilers. J. Sci. Food Agr. 2019. [Google Scholar] [CrossRef] [PubMed]
  27. Livak, K.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  28. Gregory, N.G. How climatic changes could affect meat quality. Food Res. Int. 2010, 43, 1866–1873. [Google Scholar] [CrossRef]
  29. Tang, S.; Yu, J.; Zhang, M.; Bao, E. Effects of different heat stress periods on various blood and meat quality parameters in young Arbor Acer broiler chickens. Can. J. Anim. Sci. 2013, 93, 453–460. [Google Scholar] [CrossRef] [Green Version]
  30. Dai, S.F.; Gao, F.; Xu, X.L.; Zhang, W.H.; Song, S.X.; Zhou, G.H. Effects of dietary glutamine and gamma-aminobutyric acid on meat colour, pH, composition, and water-holding characteristic in broilers under cyclic heat stress. Brit. Poultry. Sci. 2012, 53, 471–481. [Google Scholar] [CrossRef]
  31. Attia, Y.A.; Al-Harthi, M.A.; Korish, M.A.; Shiboob, M.M. Fatty acid and cholesterol profiles, hypocholesterolemic, atherogenic, and thrombogenic indices of broiler meat in the retail market. Lipids Health Dis. 2017, 16, 40. [Google Scholar] [CrossRef] [Green Version]
  32. Zhang, C.; Geng, Z.Y.; Chen, K.K.; Zhao, X.H.; Wang, C. L-theanine attenuates transport stress-induced impairment of meat quality of broilers through improving muscle antioxidant status. Poult. Sci. 2019, 98, 4648–4655. [Google Scholar] [CrossRef]
  33. Balogh, K.; Kövesi, B.; Zándoki, E.; Kulcsár, S.; Ancsin, Z.; Erdélyi, M.; Dobolyi, C.; Bata-Vidács, I.; Notai, K.; Szekeres, A.; et al. Effect of sterigmatocystin or aflatoxin contaminated feed on lipid peroxidation and glutathione redox system and expression of glutathione redox system regulatory genes in broiler chicken. Antioxidants 2019, 8, 201. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Cheng, Y.; Du, M.; Xu, Q.; Chen, Y.; Wen, C.; Zhou, Y. Dietary mannan oligosaccharide improves growth performance, muscle oxidative status, and meat quality in broilers under cyclic heat stress. J. Therm. Biol. 2018, 75, 106–111. [Google Scholar] [CrossRef] [PubMed]
  35. Tavaniello, S.; Slawinska, A.; Prioriello, D.; Petrecca, V.; Bertocchi, M.; Zampiga, M.; Salvatori, G.; Maiorano, G. Effect of galactooligosaccharides delivered in ovo on meat quality traits of broiler chickens exposed to heat stress. Poult. Sci. 2020, 99, 612–619. [Google Scholar] [CrossRef] [PubMed]
  36. Quinteiro-Filho, W.M.; Ribeiro, A.; Ferraz-de-Paula, V.; Pinheiro, M.L.; Sakai, M.; Sá, L.R.M.D.; Ferreira, A.J.P.; Palermo-Neto, J. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. Poult. Sci. 2010, 89, 1905–1914. [Google Scholar] [CrossRef]
  37. Zhang, J.F.; Hu, Z.P.; Lu, C.H.; Yang, M.X.; Zhang, L.L.; Wang, T. Dietary curcumin supplementation protects against heat-stress-impaired growth performance of broilers possibly through a mitochondrial pathway. J. Anim. Sci. 2015, 93, 1656–1665. [Google Scholar] [CrossRef]
  38. Azad, M.A.K.; Kikusato, M.; Maekawa, T.; Shirakawa, H.; Toyomizu, M. Metabolic characteristics and oxidative damage to skeletal muscle in broiler chickens exposed to chronic heat stress. Comp. Biochem. Phys. A 2010, 155, 401–406. [Google Scholar] [CrossRef]
  39. Xing, T.; Wang, M.F.; Han, M.Y.; Zhu, X.S.; Xu, X.L.; Zhou, G.H. Expression of heat shock protein 70 in transport-stressed broiler pectoralis major muscle and its relationship with meat quality. Animal 2017, 11, 1599–1607. [Google Scholar] [CrossRef]
  40. Tang, S.; Yin, B.; Xu, J.; Bao, E. Rosemary reduces heat stress by inducing CRYAB and HSP70 expression in broiler chickens. Oxid. Med. Cell Longev. 2018, 2018, 7014126. [Google Scholar] [CrossRef] [Green Version]
  41. Xia, B.; Chen, K.; Lv, Y.; Huang, D.; Liu, J.; Liang, G.; Zhang, L.; Wang, F.F.; Su, C.; Zou, Y.; et al. Increased oxidative stress and plasma Hsp70 levels among gasoline filling station attendants. Toxicol. Ind. Health 2017, 33, 171–181. [Google Scholar] [CrossRef]
  42. Gu, X.; Hao, Y.; Wang, X.L. Overexpression of heat shock protein 70 and its relationship to intestine under acute heat stress in broilers: 2. Intestinal oxidative stress. Poult. Sci. 2012, 91, 790–799. [Google Scholar] [CrossRef]
Animals 10 00404 g001 550
Figure 1. Effect of Gln on MDA of the breast muscle in heat-stressed broilers. a, b: Values in columns with different letters differ significantly (p < 0.05). Broilers in the G1, G2, G3, and G4 groups were housed in the hot environment and fed the basal diet with 0, 0.5%, 1.0%, and 1.5% Gln, respectively.
Figure 1. Effect of Gln on MDA of the breast muscle in heat-stressed broilers. a, b: Values in columns with different letters differ significantly (p < 0.05). Broilers in the G1, G2, G3, and G4 groups were housed in the hot environment and fed the basal diet with 0, 0.5%, 1.0%, and 1.5% Gln, respectively.
Animals 10 00404 g001
Animals 10 00404 g002 550
Figure 2. Effect of Gln on CAT (A), GSH-Px (B), and SOD (C) gene expression of the breast muscle in heat-stressed broilers. a, b: Values in columns with different letters differ significantly (p < 0.05). Broilers in the G1, G2, G3, and G4 groups were housed in the hot environment and fed the basal diet with 0%, 0.5%, 1.0%, and 1.5% Gln, respectively.
Figure 2. Effect of Gln on CAT (A), GSH-Px (B), and SOD (C) gene expression of the breast muscle in heat-stressed broilers. a, b: Values in columns with different letters differ significantly (p < 0.05). Broilers in the G1, G2, G3, and G4 groups were housed in the hot environment and fed the basal diet with 0%, 0.5%, 1.0%, and 1.5% Gln, respectively.
Animals 10 00404 g002
Animals 10 00404 g003 550
Figure 3. Effect of Gln on HSP70 gene (A) and protein (B) expression of the breast muscle in heat-stressed broilers. a, b: Values in columns with different letters differ significantly (p < 0.05). Broilers in the G1, G2, G3, and G4 groups were housed in the hot environment and fed the basal diet with 0%, 0.5%, 1.0%, and 1.5% Gln, respectively.
Figure 3. Effect of Gln on HSP70 gene (A) and protein (B) expression of the breast muscle in heat-stressed broilers. a, b: Values in columns with different letters differ significantly (p < 0.05). Broilers in the G1, G2, G3, and G4 groups were housed in the hot environment and fed the basal diet with 0%, 0.5%, 1.0%, and 1.5% Gln, respectively.
Animals 10 00404 g003
Table
Table 1. Composition of the basal diet 1.
Table 1. Composition of the basal diet 1.
Ingredients% as Fed BasisChemical Composition% as Fed Basis
Corn58.5ME (MJ/kg)12.73
Soybean meal32.0Crude protein20.30
Fish meal2.0Lysine 1.08
Starch1.0Methionine + cysteine 0.76
Soybean oil3.5Ca0.89
CaHPO4·2H2O1.5Available P0.42
Limestone0.9
Salt0.3
DL-Met0.1
Vitamin and trace mineral premix 20.2
Total100
1 The basic diet was formulated according to the National Research Council (NRC) [24], Bai et al. [19] and Hu et al. [25]. 2 Provided per kilogram of diet: vitamin K: 2.0 mg; vitamin A: 10,000 IU; Fe (from Fe2(SO4)3): 80 mg; Zn (from ZnSO4), 40 mg; Cu (from CuSO4): 8 mg; Se (from Na2SeO3): 0.15 mg; vitamin B6: 3.0 mg; vitamin B12: 0.014 mg; vitamin E: 20 IU; cholecalciferol: 2600 IU; thiamin: 1.6 mg; riboflavin, 6.0 mg; folic acid: 0.8 mg; calcium pantothenate: 20 mg; biotin 0.12 mg; niacin: 30 mg; I (from IK): 0.35 mg; choline (as choline chloride), 500 mg.
Table
Table 2. Specific sequences primers used in the qRT-PCR 1.
Table 2. Specific sequences primers used in the qRT-PCR 1.
GenePrimer (5′→3′)Genbank Number
β-actinF: TGCTGTGTTCCCATCTATCG
R: TTGGTGACAATACCGTGTTCA		NM 205518
SODF: GGAGGAGTGGCAGAAGT
R: TAAACGAGGTCCAGCAT		NM 205064
CATF: TATCCTTCCTGGTCTTTCTACAT
R: CGCCATCTGTTCTACCTCC		NM 001031215.2
GSH-PxF: AAGTGCGAGGTGAACGG
R: CGGCGACCAGATGATGTAC		NM 001277853.1
HSP70F: GGAGGACTTTGACAACCG
R: CAAGCTGTACGCAGACG		NM_001006685.1
1 SOD: superoxide dismutase; GSH-Px: glutathione peroxidase; CAT: catalase; HSP70: Heat shock protein 70.
Table
Table 3. Effect of Gln on meat quality of the breast meat in heat-stressed broilers.
Table 3. Effect of Gln on meat quality of the breast meat in heat-stressed broilers.
ItemTreatmentSEM 1p-Value
G1G2G3G4LinearQuadratic
pH5.905 a5.942 a6.063 b6.072 b0.019<0.0010.579
L*46.007 a44.394 a b43.463 b43.246 b0.3460.0020.228
a*4.1044.3944.4944.5480.0870.0740.496
b*4.904 a5.677 b5.893 b5.913 b0.1210.0010.055
DL (%)4.9 a4.7 b4.7 b4.5 b0.04<0.0010.561
WLR (%)32.3 a31.0 a30.8 a28.8 b0. 40.0010.621
CL (%)35.9 a35.3 a b34.5 a b34.0 b0. 30.0170.958
a, b: Values in rows with different letters differ significantly (p < 0.05). 1 SEM: standard error of the mean. Broilers in the G1, G2, G3, and G4 groups were housed in the hot environment and fed the basal diet with 0, 0.5%, 1.0%, and 1.5% Gln, respectively.
Table
Table 4. Effect of Gln on antioxidant of the breast muscle in heat-stressed broilers.
Table 4. Effect of Gln on antioxidant of the breast muscle in heat-stressed broilers.
ItemTreatmentSEM 1p-Value
G1G2G3G4Linear Quadratic
SOD (U/mg protein)79.75384.85292.35791.2323.3960.190.658
CAT (U/mg protein)2.115 a2.340 a b2.874 a b3.105 b0.1460.0070.991
GSH (mg/g protein)3.174 a4.083 a b5.392 b c6.324 c0.357<0.0010.983
GSH-Px (U/mg protein)11.783 a16.187 a b15.963 a b18.456 b0.8410.0060.517
T-AOC (U/mg protein)1.722 a3.084 b3.233 b2.930 b0.2140.0350.037
a, b, c: Values in rows with different letters differ significantly (p < 0.05). 1 SEM: standard error of the mean. Broilers in the G1, G2, G3, and G4 groups were housed in the hot environment and fed the basal diet with 0%, 0.5%, 1.0%, and 1.5% Gln, respectively.

Share and Cite

MDPI and ACS Style

Hu, H.; Chen, L.; Dai, S.; Li, J.; Bai, X. Effect of Glutamine on Antioxidant Capacity and Lipid Peroxidation in the Breast Muscle of Heat-stressed Broilers via Antioxidant Genes and HSP70 Pathway. Animals 2020, 10, 404. https://doi.org/10.3390/ani10030404

AMA Style

Hu H, Chen L, Dai S, Li J, Bai X. Effect of Glutamine on Antioxidant Capacity and Lipid Peroxidation in the Breast Muscle of Heat-stressed Broilers via Antioxidant Genes and HSP70 Pathway. Animals. 2020; 10(3):404. https://doi.org/10.3390/ani10030404

Chicago/Turabian Style

Hu, Hong, Liang Chen, Sifa Dai, Jiaqi Li, and Xi Bai. 2020. "Effect of Glutamine on Antioxidant Capacity and Lipid Peroxidation in the Breast Muscle of Heat-stressed Broilers via Antioxidant Genes and HSP70 Pathway" Animals 10, no. 3: 404. https://doi.org/10.3390/ani10030404

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop