Novel Eel Skin Fibroblast Cell Line: Bridging Adherent and Suspension Growth for Aquatic Applications Including Virus Susceptibility
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Line Development and Authentication
2.1.1. Primary Culture and Subculture
2.1.2. 18S rRNA Sequence Analysis
2.1.3. Chromosome Analysis
2.1.4. Immuno-Cytochemical Identification
2.2. Growth Characterization
2.3. Cell Transfection
2.4. Susceptibility Test
2.5. Data Analysis
2.6. Electron Microscopy
3. Results
3.1. Cell Line Establishment and Authentication
3.1.1. Primary Cell Culture and Cell Line Establishment
3.1.2. 18S rRNA Sequence Analysis
3.1.3. Chromosome Analysis
3.1.4. Immuno-Cytochemical Identification
3.2. Growth Characterization
3.2.1. Batch Culture Process and Simulated Semi-Continuous Culture Process
3.2.2. Growth Characteristics
3.3. Cell Transfection
3.4. Susceptibility Tests
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gregersen, J.P.; Schmitt, H.J.; Trusheim, H.; Broker, M. Safety of MDCK Cell Culture-Based Influenza Vaccines. Future Microbiol. 2011, 6, 143–152. [Google Scholar] [CrossRef]
- Ryu, N.; Lee, S.; Park, H. Spheroid Culture System Methods and Applications for Mesenchymal Stem Cells. Cells 2019, 8, 1620. [Google Scholar] [CrossRef] [PubMed]
- Vlecken, D.H.; Pelgrim, R.P.; Ruminski, S.; Bakker, W.A.; van der Pol, L.A. Comparison of Initial Feasibility of Host Cell Lines for Viral Vaccine Production. J. Virol. Methods 2013, 193, 28–41. [Google Scholar] [CrossRef] [PubMed]
- Waltz, E. No Bones, No Scales, No Eyeballs: Appetite Grows for Cell-Based Seafood. Nat. Biotechnol. 2021, 39, 1483–1485. [Google Scholar] [CrossRef]
- Kretzmer, G. Industrial Processes with Animal Cells. Appl. Microbiol. Biotechnol. 2002, 59, 135–142. [Google Scholar] [CrossRef] [PubMed]
- Kildegaard, H.F.; Baycin-Hizal, D.; Lewis, N.E.; Betenbaugh, M.J. The Emerging CHO Systems Biology Era: Harnessing the ‘Omics Revolution for Biotechnology. Curr. Opin. Biotechnol. 2013, 24, 1102–1107. [Google Scholar] [CrossRef]
- Grieger, J.C.; Soltys, S.M.; Samulski, R.J. Production of Recombinant Adeno-Associated Virus Vectors Using Suspension HEK293 Cells and Continuous Harvest of Vector from the Culture Media for GMP FIX and FLT1 Clinical Vector. Mol. Ther. 2016, 24, 287–297. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Qiu, Z.; Wang, S.; Liu, Z.; Qiao, Z.; Wang, J.; Duan, K.; Nian, X.; Ma, Z.; Yang, X. Suspended Cell Lines for Inactivated Virus Vaccine Production. Expert. Rev. Vaccines 2023, 22, 468–480. [Google Scholar] [CrossRef]
- Capstick, P.B.; Telling, R.C.; Chapman, W.G.; Stewart, D.L. Growth of a Cloned Strain of Hamster Kidney Cells in Suspended Cultures and their Susceptibility to the Virus of Foot-and-Mouth Disease. Nature 1962, 195, 1163–1164. [Google Scholar] [CrossRef]
- Chu, C.; Lugovtsev, V.; Golding, H.; Betenbaugh, M.; Shiloach, J. Conversion of MDCK Cell Line to Suspension Culture by Transfecting with Human Siat7e Gene and its Application for Influenza Virus Production. Proc. Natl. Acad. Sci. USA 2009, 106, 14802–14807. [Google Scholar] [CrossRef] [PubMed]
- Lee, N.; Shin, J.; Park, J.H.; Lee, G.M.; Cho, S.; Cho, B.K. Targeted Gene Deletion Using DNA-Free RNA-Guided Cas9 Nuclease Accelerates Adaptation of CHO Cells to Suspension Culture. ACS Synth. Biol. 2016, 5, 1211–1219. [Google Scholar] [CrossRef]
- van Wielink, R.; Kant-Eenbergen, H.C.; Harmsen, M.M.; Martens, D.E.; Wijffels, R.H.; Coco-Martin, J.M. Adaptation of a Madin-Darby Canine Kidney Cell Line to Suspension Growth in Serum-Free Media and Comparison of its Ability to Produce Avian Influenza Virus to Vero and BHK21 Cell Lines. J. Virol. Methods 2011, 171, 53–60. [Google Scholar] [CrossRef] [PubMed]
- Moran, M.J.; Chen, J.; Piret, J.M.; Balcarcel, R.R. Super7 Passaging Method to Improve Chinese Hamster Ovary Cell Fed-Batch Performance. Biotechnol. Bioeng. 2024, 121, 3068–3075. [Google Scholar] [CrossRef] [PubMed]
- Ozaki, H.; Govorkova, E.A.; Li, C.; Xiong, X.; Webster, R.G.; Webby, R.J. Generation of High-Yielding Influenza a Viruses in African Green Monkey Kidney (Vero) Cells by Reverse Genetics. J. Virol. 2004, 78, 1851–1857. [Google Scholar] [CrossRef]
- Tihanyi, B.; Nyitray, L. Recent Advances in CHO Cell Line Development for Recombinant Protein Production. Drug Discov. Today Technol. 2020, 38, 25–34. [Google Scholar] [CrossRef]
- Sanchez-Martinez, Z.V.; Alpuche-Lazcano, S.P.; Stuible, M.; Durocher, Y. CHO Cells for Virus-Like Particle and Subunit Vaccine Manufacturing. Vaccine 2024, 42, 2530–2542. [Google Scholar] [CrossRef]
- Kumar, M.S.; Singh, V.K.; Mishra, A.K.; Kushwaha, B.; Kumar, R.; Lal, K.K. Fish Cell Line: Depositories, Web Resources and Future Applications. Cytotechnology 2024, 76, 1–25. [Google Scholar] [CrossRef] [PubMed]
- Embregts, C.; Rigaudeau, D.; Tacchi, L.; Pijlman, G.P.; Kampers, L.; Vesely, T.; Pokorova, D.; Boudinot, P.; Wiegertjes, G.F.; Forlenza, M. Vaccination of Carp Against SVCV with an Oral DNA Vaccine or an Insect Cells-Based Subunit Vaccine. Fish. Shellfish. Immunol. 2019, 85, 66–77. [Google Scholar] [CrossRef]
- Guo, S. Construction and Evaluation on Immune Effect of Biomimetic Cell-Derived Vaccine Delivery System against Spring Viremia of Carp. Master’s Thesis, Northwest A&F University, Xianyang, China, 2022. [Google Scholar]
- Fu, Y.; Li, Y.; Zhang, W.; Fu, W.; Li, W.; Zhu, Z.; Weng, S.; He, J.; Dong, C. Effectively Protecting Asian Seabass Lates calcarifer from ISKNV-I, ISKNV-II, RSIV-II and SDDV by an Inactivated ISKNV-I and SDDV Bivalent Vaccine. Aquaculture 2023, 566, 739218. [Google Scholar] [CrossRef]
- Kaifu, K.; Stein, F.; Dekker, W.; Walker, N.; Dolloff, C.A.; Steele, K.; Aguirre, A.A.; Nijman, V.; Siriwat, P.; Sasal, P. Global Exploitation of Freshwater Eels (Genus Anguilla): Fisheries, Stock Status and Illegal Trade. In Eels Biology, Monitoring, Management, Culture and Exploitation, Proceedings of the First International Eel Science Symposium, Sheffield, UK, 31 October 2019, 1st ed.; Don, A., Coulson, P., Eds.; 5m Publishing: Sheffield, UK, 2019; Volume 6, Chapter 23; pp. 377–422. [Google Scholar] [CrossRef]
- Haenen, O.; van Ginneken, V.; Engelsma, M.; van den Thillart, G. Impact of Eel Viruses on Recruitment of European Eel. In Spawning Migration of the European Eel; van den Thillart, G., Dufour, S., Rankin, J.C., Eds.; Springer: Dordrecht, The Netherlands, 2009; pp. 387–400. [Google Scholar] [CrossRef]
- Ueno, Y.; Kitao, T.; Aoki, T.; Chen, S.N.; Kou, G.H. Characterization of a Herpes-like Virus Isolated from Cultured Japanese Eels in Taiwan. Gyobyo Kenkyu 1992, 27, 7–17. [Google Scholar] [CrossRef]
- Zheng, Z.; Yang, J.; Ge, J.; Chi, H.; Chen, B.; Fang, Q.; Gong, H. Development and Characterization of a Continuous Cell Line (EL) from the Liver of European Eel Anguilla anguilla. Cell Biol. Int. 2020, 44, 808–820. [Google Scholar] [CrossRef]
- Mao, N.; Zheng, Z.Y.; Lin, T.L. The Growth Advantage of the Pectoral Fin Cells of Angailla anguilla Under Different Culture Conditions. Fujian J. Agric. Sci. 2012, 27, 222–226. [Google Scholar] [CrossRef]
- Mao, N.; Zheng, Z.Y.; Chen, S.Y. Growth Factors, bFGF and IFG-1, in Pectoral Fin Passage Cells of Anguilla anguilla. Fujian J. Agric. Sci. 2012, 27, 578–582. [Google Scholar] [CrossRef]
- Chen, B.; Zheng, Z.; Yang, J.; Chi, H.; Huang, H.; Gong, H. Development and Characterization of a New Cell Line Derived from European Eel Anguilla anguilla Kidney. Biol. Open 2019, 8, bio037507. [Google Scholar] [CrossRef] [PubMed]
- Bryson, S.P.; Joyce, E.M.; Martell, D.J.; Lee, L.E.; Holt, S.E.; Kales, S.C.; Fujiki, K.; Dixon, B.; Bols, N.C. A Cell Line (HEW) from Embryos of Haddock (Melanogrammus aeglefinius) and its Capacity to Tolerate Environmental Extremes. Mar. Biotechnol. 2006, 8, 641–653. [Google Scholar] [CrossRef]
- Ott, T. Tissue Culture of Fish Cell Lines. In NWFHS Laboratory Procedures Manual, 2nd ed.; True, K., Ed.; U.S. Fish and Wildlife Service: Onalaska, TX, USA, 2004; Chapter 10; pp. 1–16. Available online: https://fws.gov/media/national-wild-fish-health-survey-laboratory-procedures-manual (accessed on 7 September 2011).
- Frankowski, J.; Bastrop, R. Identification of Anguilla anguilla (L.) and Anguilla rostrata (Le Sueur) and their Hybrids Based on a Diagnostic Single Nucleotide Polymorphism in Nuclear 18S rDNA. Mol. Ecol. Resour. 2010, 10, 173–176. [Google Scholar] [CrossRef]
- Gong, J.; Huang, Y.; Huang, X.; Ouyang, Z.; Guo, M.; Qin, Q. Establishment and Characterization of a New Cell Line Derived from Kidney of Grouper, Epinephelus akaara (Temminck & Schlegel), Susceptible to Singapore Grouper Iridovirus (SGIV). J. Fish. Dis. 2011, 34, 677–686. [Google Scholar] [CrossRef] [PubMed]
- Levan, A.; Fredga, K.; Sandberg, A.A. Nomenclatrue for Centromeric Position on Chromosomes. Hereditas 1964, 52, 201–220. [Google Scholar] [CrossRef]
- Davis, J.M. Basic Cell Culture: A Practical Approach, 2nd ed.; Oxford University Press: New York, NY, USA, 2002; pp. 200–226. [Google Scholar]
- Bandin, I.; Souto, S. Betanodavirus and VER Disease: A 30-Year Research Review. Pathogens 2020, 9, 106. [Google Scholar] [CrossRef] [PubMed]
- Chen, A.P.; Zhang, L.F.; Wang, S.; Gao, L.Y.; Jiang, Y.L.; Chen, X.Z.; Zhu, Z.W.; Jing, H.L. PRC Aquatic Industry Standard: Diagnostic Protocol for Fish Viral Nervous Necrosis, SC/T 7216-2012; Ministry of Agriculture of the People’s Republic of China: Beijing, China, 2012; pp. 2–4.
- Shih, H.H. A Polymerase Chain Reaction for Detecting Herpesvirus anguillae in Asymptomatic Eels. Taiwania 2004, 49, 1–6. [Google Scholar]
- Ge, J.Q.; Yang, J.X.; Gong, H.; Lin, T.L. Isolation and Identification of a Herpesvirus from Cultured European Eels Anguilla anguilla in China. J. Fish. China 2014, 38, 1579–1583. [Google Scholar] [CrossRef]
- Zhao, Z.; Li, F.; Ning, J.; Peng, R.; Shang, J.; Liu, H.; Shang, M.; Bao, X.Q.; Zhang, D. Novel Compound FLZ Alleviates Rotenone-Induced PD Mouse Model by Suppressing TLR4/MyD88/NF-kappaB Pathway through Microbiota-Gut-Brain Axis. Acta Pharm. Sin. B 2021, 11, 2859–2879. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.; Kuang, X.M.; Wang, J.; Xu, Y.M.; Guo, S. Comparison of Karyotypes of Anguilla anguilla and Anguilla japonica. J. South China Agric. Univ. 1999, 20, 47–50. [Google Scholar]
- Vo, N.; Katzenback, B.A.; Kellendonk, C.; Duong, T.; Curtis, T.M.; Dixon, B.; Bols, N.C. Characterization of the Continuous Skin Fibroblastoid Cell Line, WE-skin11f, from Walleye (Sander vitreus). J. Fish. Dis. 2019, 42, 1587–1599. [Google Scholar] [CrossRef]
- Zhang, Q.Y.; Gui, J.F. Atlas of Aquatic Viruses and Viral Diseases, 1st ed.; Science Press: Beijing, China, 2012; pp. 192–208. [Google Scholar]
- van Beurden, S.J.; Bossers, A.; Voorbergen-Laarman, M.H.; Haenen, O.L.; Peters, S.; Abma-Henkens, M.H.; Peeters, B.P.; Rottier, P.J.; Engelsma, M.Y. Complete Genome Sequence and Taxonomic Position of Anguillid Herpesvirus 1. J. Gen. Virol. 2010, 91, 880–887. [Google Scholar] [CrossRef] [PubMed]
- Lakra, W.S.; Swaminathan, T.R.; Joy, K.P. Development, Characterization, Conservation and Storage of Fish Cell Lines: A Review. Fish. Physiol. Biochem. 2011, 37, 1–20. [Google Scholar] [CrossRef] [PubMed]
- Swaminathan, T.R.; Narendrakumar, L.; Prasannan Geetha, P.; Shanmuganathan, A.R.; Dharmaratnam, A.; Nithianantham, S.R. Comprehensive Update on Inventory of Finfish Cell Lines Developed during the Last Decade (2010–2020). Rev. Aquacult 2021, 13, 2248–2288. [Google Scholar] [CrossRef]
- Altmaier, S.; Meiser, I.; Lemesre, E.; Chanrion, B.; Steeg, R.; Leonte, L.E.; Holst, B.; Nielsen, B.S.; Clausen, C.; Schmidt, K.; et al. Human iPSC-derived Hepatocytes in 2D and 3D Suspension Culture for Cryopreservation and In Vitro Toxicity Studies. Reprod. Toxicol. 2022, 111, 68–80. [Google Scholar] [CrossRef]
- Magalhaes, R.; Nugraha, B.; Pervaiz, S.; Yu, H.; Kuleshova, L.L. Influence of Cell Culture Configuration on the Post-Cryopreservation Viability of Primary Rat Hepatocytes. Biomaterials 2012, 33, 829–836. [Google Scholar] [CrossRef]
- Taylor, M.J.; Weegman, B.P.; Baicu, S.C.; Giwa, S.E. New Approaches to Cryopreservation of Cells, Tissues, and Organs. Transfus. Med. Hemotherapy 2019, 46, 197–215. [Google Scholar] [CrossRef] [PubMed]
- Merten, O.W. Introduction to Animal Cell Culture Technology-Past, Present and Future. Cytotechnology 2006, 50, 1–7. [Google Scholar] [CrossRef]
- Politis, S.N.; Mazurais, D.; Servili, A.; Zambonino-Infante, J.L.; Miest, J.J.; Sorensen, S.R.; Tomkiewicz, J.; Butts, I. Temperature Effects on Gene Expression and Morphological Development of European Eel, Anguilla anguilla Larvae. PLoS ONE 2017, 12, e182726. [Google Scholar] [CrossRef] [PubMed]
- Chang, P.H.; Pan, Y.H.; Wu, C.M.; Kuo, S.T.; Chung, H.Y. Isolation and molecular characterization of herpesvirus from cultured European eels Anguilla anguilla in Taiwan. Dis. Aquat. Organ. 2002, 50, 111–118. [Google Scholar] [CrossRef]
- Li, Y.Y.; Yang, J.X.; Chen, X.; Chen, Q.; Song, T.Y.; Ge, J.Q. Proteomic Profiling Skin Mucus of European Eel Anguilla anguilla Infected with Anguillid Herpesvirus. Int. J. Mol. Sci. 2022, 23, 11283. [Google Scholar] [CrossRef]
- Motoaki, S.; Haruhiko, F.; Tokuo, S. Isolation and Characterization of a New Herpesvirus from Eel. In Pathology in Marine Science; Perkins, T.O., Cheng, T.C., Eds.; Academic Press: New York, NY, USA, 1990. [Google Scholar]
- Ueno, Y.; Shi, J.W.; Yoshida, T.; Kitao, T.; Sakai, M.; Chen, S.N.; Kou, G.H. Biological and Serological Comparisons of Eel Herpesvirus in Formosa (EHVF) and Herpesvirus anguillae (HVA). J. Appl. Ichthyol. 1996, 12, 49–51. [Google Scholar] [CrossRef]
- Kibenge, F.S.; Garate, O.N.; Johnson, G.; Arriagada, R.; Kibenge, M.J.; Wadowska, D. Isolation and Identification of Infectious Salmon Anaemia Virus (ISAV) from Coho Salmon in Chile. Dis. Aquat. Organ. 2001, 45, 9–18. [Google Scholar] [CrossRef]
- van Nieuwstadt, A.P.; Dijkstra, S.G.; Haenen, O.L. Persistence of Herpesvirus of Eel Herpesvirus anguillae in Farmed European Eel Anguilla anguilla. Dis. Aquat. Organ. 2001, 45, 103–107. [Google Scholar] [CrossRef] [PubMed]
- Lehmann, J.; Stürenberg, F.J.; Kullmann, Y.; Kilwinski, J. Umwelt-Und Krankheitsbelsatungen Der Aale in Nordrhein-Westfalen. LÖBF-Mitteilungen 2005, 2, 35–40. [Google Scholar]
- Davidse, A.; Haenen, O.; Dijkstra, S.G.; Nieuwstadt, A.; Vorst, T.D.; Wagenaar, F.W.; Wellenberg, G.J. First Isolation of Herpesvirus of Eel (Herpesvirus anguillae) in Diseased European Eel (Anguilla anguilla L.) in Europe. B Eur. Assoc. Fish. Pat. 1999, 19, 137–141. [Google Scholar] [CrossRef]
- Chi, S.C.; Shieh, J.R.; Lin, S.J. Genetic and Antigenic Analysis of Betanodaviruses Isolated from Aquatic Organisms in Taiwan. Dis. Aquat. Organ. 2003, 55, 221–228. [Google Scholar] [CrossRef]
- Bandin, I.; Souto, S.; Cutrin, J.M.; Lopez-Vazquez, C.; Olveira, J.G.; Esteve, C.; Alcaide, E.; Dopazo, C.P. Presence of Viruses in Wild Eels Anguilla anguilla L., from the Albufera Lake (Spain). J. Fish. Dis. 2014, 37, 597–607. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Gao, H.Q.; Song, D.D.; Wu, F.X.; Li, Y.S.; Zhang, Y.X. China Fishery Statistical Yearbook: 2024, 1st ed.; Agriculture Press: Beijing, China, 2024; pp. 26–33. [Google Scholar]
- Schmidt, J. Breeding Places and Migrations of the Eel. Nature 1923, 111, 51–54. [Google Scholar] [CrossRef]
- Arai, T. Do we Protect Freshwater Eels or Do we Drive them to Extinction? Springerplus 2014, 3, 534. [Google Scholar] [CrossRef]
- Goswami, M.; Belathur, S.Y.; Sathiyanarayanan, A.; Pinto, N.; Duscher, A.; Ovissipour, R.; Lakra, W.S.; Chandragiri, N.R. Cellular Aquaculture: Prospects and Challenges. Micromachines 2022, 13, 828. [Google Scholar] [CrossRef] [PubMed]
- Ikeda, D.; Otsuka, Y.; Kan-No, N. Development of a Novel Japanese Eel Myoblast Cell Line for Application in Cultured Meat Production. Biochem. Biophys. Res. Commun. 2024, 734, 150784. [Google Scholar] [CrossRef] [PubMed]
- Ovissipour, R.; Yang, X.; Saldana, Y.T.; Kaplan, D.L.; Nitin, N.; Shirazi, A.; Chirdon, B.; White, W.; Rasco, B. Cell-Based Fish Production Case Study for Developing a Food Safety Plan. Heliyon 2024, 10, e33509. [Google Scholar] [CrossRef]
Cell State [A/S] | Cell Passage [d] | Digestion Time [s] | Centrifuge Speed [rpm] | Centrifuge Time [min] | FBS [%] | Interval [h] |
---|---|---|---|---|---|---|
Adherent | 2–20 | 60 | 1500 | 3 | 15 | 24–48 |
Adherent | 21–50 | 30–45 | 1800 | 5 | 10 | 24 |
Adherent | >50 | 30–45 | 1800 | 5 | 8 | 24 |
Suspension | >50 | 300 | 1800 | 5 | 8 | 96–168 |
Primer Name | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) |
---|---|---|
18s-F/R | TATGCTTGTCTCAAAGATTAAGCCATGC | CACCTACGGAAACCTTGTTACGA |
HVA F/R | TTGAGGTTGTTGTCGTGCC | CTCTCATGTCATCCAGACGG |
HVA pol F/R | GTGTCGGGCCTTTGTGGTGA | GTGTCGGGCCTTTGTGGTGA |
VNN F2/R3 | CGTGTCAGTCATGTGTCGCT | CGAGTCAACACGGGTGAAGA |
Antibody | Type | Source |
---|---|---|
Acidic cytokeratin | Monoclonal mouse | Servicebio, Wuhan, China |
Basic cytokeratin | Monoclonal mouse | Servicebio, Wuhan, China |
Collagen-1 | Monoclonal mouse | Servicebio, Wuhan, China |
Desmin | Monoclonal mouse | Servicebio, Wuhan, China |
Fibronectin | Monoclonal mouse | Servicebio, Wuhan, China |
Vimentin | Monoclonal mouse | Servicebio, Wuhan, China |
Fluorescein isothiocyanate (FITC) conjugated | Goat anti-mouse IgG | Servicebio, Wuhan, China |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zheng, Z.; Chen, B.; Liu, X.; Guo, R.; Chi, H.; Chen, X.; Pan, Y.; Gong, H. Novel Eel Skin Fibroblast Cell Line: Bridging Adherent and Suspension Growth for Aquatic Applications Including Virus Susceptibility. Biology 2024, 13, 1068. https://doi.org/10.3390/biology13121068
Zheng Z, Chen B, Liu X, Guo R, Chi H, Chen X, Pan Y, Gong H. Novel Eel Skin Fibroblast Cell Line: Bridging Adherent and Suspension Growth for Aquatic Applications Including Virus Susceptibility. Biology. 2024; 13(12):1068. https://doi.org/10.3390/biology13121068
Chicago/Turabian StyleZheng, Zaiyu, Bin Chen, Xiaodong Liu, Rui Guo, Hongshu Chi, Xiuxia Chen, Ying Pan, and Hui Gong. 2024. "Novel Eel Skin Fibroblast Cell Line: Bridging Adherent and Suspension Growth for Aquatic Applications Including Virus Susceptibility" Biology 13, no. 12: 1068. https://doi.org/10.3390/biology13121068
APA StyleZheng, Z., Chen, B., Liu, X., Guo, R., Chi, H., Chen, X., Pan, Y., & Gong, H. (2024). Novel Eel Skin Fibroblast Cell Line: Bridging Adherent and Suspension Growth for Aquatic Applications Including Virus Susceptibility. Biology, 13(12), 1068. https://doi.org/10.3390/biology13121068