Genetic Diversity of Ishpingo Exploited Trees (Ocotea quixos (Lam.) Kosterm, Lauraceae) †
Abstract
1. Introduction
2. Material and Methods
2.1. Population Sampling
2.2. DNA Extraction and nSSR Development
2.3. Genetic Diversity and Differentiation
2.4. Genetic Structure of Populations
3. Results
3.1. Genetic Diversity of Loci
3.2. Genetic Diversity in Ishpingo Populations
3.3. Genetic Structure of Populations
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Markert, J.A.; Champlin, D.M.; Gutjahr-Gobell, R.; Grear, J.S.; Kuhn, A.; McGreevy, T.J.; Roth, A.; Bagley, M.J.; Nacci, D.E. Population genetic diversity and fitness in multiple environments. BMC Evol. Biol. 2010, 10, 205. [Google Scholar] [CrossRef] [PubMed]
- Furlan, E.; Stoklosa, J.; Griffiths, J.; Gust, N.; Ellis, R.; Huggins, R.M.; Weeks, A.R. Small population size and extremely low levels of genetic diversity in island populations of the platypus, Ornithorhynchus anatinus. Ecol. Evol. 2012, 2, 844–857. [Google Scholar] [CrossRef] [PubMed]
- Giam, X. Global biodiversity loss from tropical deforestation. Proc. Natl. Acad. Sci. USA 2017, 114, 5775–5777. [Google Scholar] [CrossRef]
- Schleuning, M.; Farwig, N.; Peters, M.K.; Bergsdorf, T.; Bleher, B.; Brandl, R.; Dalitz, H.; Fischer, G.; Freund, W.; Gikungu, M.W.; et al. Forest Fragmentation and Selective Logging Have Inconsistent Effects on Multiple Animal-Mediated Ecosystem Processes in a Tropical Forest. PLoS ONE 2011, 6, e27785. [Google Scholar] [CrossRef]
- Cudney-Valenzuela, S.J.; Arroyo-Rodríguez, V.; Morante-Filho, J.C.; Toledo-Aceves, T.; Andresen, E. Tropical forest loss impoverishes arboreal mammal assemblages by increasing tree canopy openness. Ecol. Appl. 2023, 33, 2744. [Google Scholar] [CrossRef] [PubMed]
- Lowe, A.J.; Boshier, D.; Ward, M.; Bacles, C.F.E.; Navarro, C. Genetic resource impacts of habitat loss and degradation; reconciling empirical evidence and predicted theory for neotropical trees. Heredity 2005, 95, 255–273. [Google Scholar] [CrossRef] [PubMed]
- Kramer, A.T.; Ison, J.L.; Ashley, M.V.; Howe, H.F. The Paradox of Forest Fragmentation Genetics La Paradoja de la Genética de la Fragmentación de Bosques. Conserv. Biol. 2008, 22, 878–885. [Google Scholar] [CrossRef]
- Eckert, C.G.; Kalisz, S.; Geber, M.A.; Sargent, R.; Elle, E.; Cheptou, P.-O.; Goodwillie, C.; Johnston, M.O.; Kelly, J.K.; Moeller, D.A.; et al. Plant mating systems in a changing world. Trends Ecol. Evol. 2010, 25, 35–43. [Google Scholar] [CrossRef] [PubMed]
- Sadovy, Y.; Cheung, W.L. Near extinction of a highly fecund fish: The one that nearly got away. Fish Fish. 2003, 4, 86–99. [Google Scholar] [CrossRef]
- Paijmans, A.J.; Stoffel, M.A.; Bester, M.N.; Cleary, A.C.; De Bruyn, P.J.N.; Forcada, J.; Goebel, M.E.; Goldsworthy, S.D.; Guinet, C.; Lydersen, C.; et al. The genetic legacy of extreme exploitation in a polar vertebrate. Sci. Rep. 2020, 10, 5089. [Google Scholar] [CrossRef] [PubMed]
- Lotze, H.K. Repetitive history of resource depletion and mismanagement. Mar. Ecol. Prog. Ser. 2004, 274, 282–285. [Google Scholar]
- Cruse-Sanders, J.M.; Hamrick, J.; Ahumada, J.A. Consequences of harvesting for genetic diversity in American ginseng (Panax quinquefolius L.): A simulation study. Biodivers. Conserv. 2005, 14, 493–504. [Google Scholar] [CrossRef]
- Sebbenn, A.M.; Degen, B.; Azevedo, V.C.; Silva, M.B.; de Lacerda, A.E.; Ciampi, A.Y.; Kanashiro, M.; Carneiro, F.d.S.; Thompson, I.; Loveless, M.D. Modelling the long-term impacts of selective logging on genetic diversity and demographic structure of four tropical tree species in the Amazon forest. For. Ecol. Manag. 2008, 254, 335–349. [Google Scholar] [CrossRef]
- González-Fernández, A.; Arroyo-Rodríguez, V.; Ramírez-Corona, F.; Manjarrez, J.; Aguilera-Hernández, A.; Sunny, A. Local and landscape drivers of the number of individuals and genetic diversity of a microendemic and critically endangered salamander. Landsc. Ecol. 2019, 34, 1989–2000. [Google Scholar] [CrossRef]
- Hauser, L.; Adcock, G.J.; Smith, P.J.; Ramírez, J.H.B.; Carvalho, G.R. Loss of microsatellite diversity and low effective population size in an overexploited population of New Zealand snapper (Pagrus auratus). Proc. Natl. Acad. Sci. USA 2002, 99, 11742–11747. [Google Scholar] [CrossRef]
- Xu, Z.; Dou, S.-Z.; Ding, S.-X.; Liu, J.-X. Temporal Genetic Stability Despite Decades of Overexploitation for Large Yellow Croaker in the East China Sea. Front. Mar. Sci. 2022, 9, 861840. [Google Scholar] [CrossRef]
- Gilardoni, G.; Montalván, M.; Vélez, M.; Malagón, O. Chemical and Enantioselective Analysis of the Essential Oils from Different Morphological Structures of Ocotea quixos (Lam.) Kosterm. Plants 2021, 10, 2171. [Google Scholar] [CrossRef]
- Bruni, R.; Medici, A.; Andreotti, E.; Fantin, C.; Muzzoli, M.; Dehesa, M.; Romagnoli, C.; Sacchetti, G. Chemical composition and biological activities of Ishpingo essential oil, a traditional Ecuadorian spice from Ocotea quixos (Lam.) Kosterm. (Lauraceae) flower calices. Food Chem. 2004, 85, 415–421. [Google Scholar] [CrossRef]
- Noriega, P.; Mosquera, T.; Paredes, E.; Parra, M.; Zappia, M.; Herrera, M.; Villegas, A.; Osorio, E. Antimicrobial and antioxidant bioautography activity of bark essential oil from Ocotea quixos (Lam.) kosterm. J. Planar Chromatogr. Mod. TLC 2018, 31, 163–168. [Google Scholar] [CrossRef]
- Sacchetti, G.; Guerrini, A.; Noriega, P.; Bianchi, A.; Bruni, R. Essential oil of wild Ocotea quixos (Lam.) Kosterm. (Lauraceae) leaves from Amazonian Ecuador. Flavour Fragr. J. 2006, 21, 674–676. [Google Scholar] [CrossRef]
- Armijos, C.; Ramírez, J.; Salinas, M.; Vidari, G.; Suárez, A.I. Pharmacology and phytochemistry of ecuadorian medicinal plants: An update and perspectives. Pharmaceuticals 2021, 14, 1145. [Google Scholar] [CrossRef] [PubMed]
- Noriega, P. Ishpink, Ocotea quixos (Lam.) Kosterm. History, Traditional Uses, Chemical, Pharmacological Properties and the Economic Potential of its Essentials Oils Present within this Amazonian Species. In Essential Oils: Historical Significance, Chemical Composition and Medicinal Uses and Benefits; Nova Science Publishers: Hauppauge, NY, USA, 2016; ISBN 978-1-63484-351-5. [Google Scholar]
- Rivas, C.A.; Guerrero-Casado, J.; Navarro-Cerillo, R.M. Deforestation and fragmentation trends of seasonal dry tropical forest in Ecuador: Impact on conservation. For. Ecosyst. 2021, 8, 46. [Google Scholar] [CrossRef]
- Salazar, P.; I Rivas, P.; Mátyás, B.; Karolys, G. Comparison of the genetic variability of three regions of chloroplast DNA and nuclear DNA in ishpingo (Ocotea quixos) coming from five provinces of the ecuadorian amazon. Appl. Ecol. Environ. Res. 2019, 17, 4933–4948. [Google Scholar] [CrossRef]
- Noh, S.W.; Park, J.-K.; Yu, J.S.; Nam, D.E.; Do, Y.; Chung, K.W. Genetic Diversity and Population Structure of the Spring Orchid Cymbidium goeringii in Korean Distant Islands. Diversity 2020, 12, 486. [Google Scholar] [CrossRef]
- Erazo-Garcia, M.P.; Guadalupe, J.J.; Rowntree, J.K.; Borja-Serrano, P.; de los Monteros-Silva, N.E.; De Lourdes Torres, M. Assessing the genetic diversity of Ilex guayusa loes., a medicinal plant from the ecuadorian amazon. Diversity 2021, 13, 182. [Google Scholar] [CrossRef]
- Amiteye, S. Basic concepts and methodologies of DNA marker systems in plant molecular breeding. Heliyon 2021, 7, e08093. [Google Scholar] [CrossRef]
- Selkoe, K.A.; Toonen, R.J. Microsatellites for ecologists: A practical guide to using and evaluating microsatellite markers. Ecol. Lett. 2006, 9, 615–629. [Google Scholar] [CrossRef]
- Monthe, F.S.; Duminil, J.; Tosso, F.; Migliore, J.; Hardy, O.J. Characterization of microsatellite markers in two exploited African trees, Entandrophragma candollei and E. utile (Meliaceae). Appl. Plant Sci. 2017, 5, 1600130. [Google Scholar] [CrossRef]
- Nguyen, D.M.; Nguyen, H.L.P.; Nguyen, T.M. Genetic structure of the endemic Dipterocarpus condorensis revealed by microsatellite markers. AoB Plants 2022, 14, plac007. [Google Scholar] [CrossRef]
- Draper, D.; Riofrío, L.; Naranjo, C.; Marques, I. The Complex Genetic Legacy of Hybridization and Introgression between the Rare Ocotea loxensis van der Werff and the Widespread O. infrafoveolata van der Werff (Lauraceae). Plants 2024, 13, 1956. [Google Scholar] [CrossRef] [PubMed]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [PubMed]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. micro-checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar] [CrossRef]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [PubMed]
- Rice, W.R. Analyzing Tables of Statistical Tests. Evolution 1989, 43, 223. [Google Scholar] [CrossRef]
- Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef] [PubMed]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of Population Structure Using Multilocus Genotype Data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Liu, J. StructureSelector: A web-based software to select and visualize the optimal number of clusters using multiple methods. Mol. Ecol. Resour. 2018, 18, 176–177. [Google Scholar] [CrossRef]
- Marques, I.; Draper, D.; Riofrío, L.; Naranjo, C. Early Signs of the Effects of Forest Fragmentation on the Genetic Diversity and Structure of the Threatened Ecuadorian Tree Ocotea rotundata (Lauraceae). Forests 2022, 13, 1940. [Google Scholar] [CrossRef]
- Martins, E.M.; Lamont, R.W.; Martinelli, G.; Lira-Medeiros, C.F.; Quinet, A.; Shapcott, A. Genetic diversity and population genetic structure in three threatened Ocotea species (Lauraceae) from Brazil’s Atlantic Rainforest and implications for their conservation. Conserv. Genet. 2015, 16, 1–14. [Google Scholar] [CrossRef]
- Curatola Fernández, G.F.; Obermeier, W.A.; Gerique, A.; López Sandoval, M.F.; Lehnert, L.W.; Thies, B.; Bendix, J. Land Cover Change in the Andes of Southern Ecuador—Patterns and Drivers. Remote Sens. 2015, 7, 2509–2542. [Google Scholar] [CrossRef]
- Isabel, N.; Holliday, J.A.; Aitken, S.N. Forest genomics: Advancing climate adaptation, forest health, productivity, and conservation. Evol. Appl. 2020, 13, 3–10. [Google Scholar] [CrossRef] [PubMed]
- Rees, M.; Neaves, L.E.; Lewis, G.P.; de Lima, H.C.; Gagnon, E. Phylogenomic and morphological data reveal hidden patterns of diversity in the national tree of Brazil, Paubrasilia echinata. Am. J. Bot. 2023, 110, e16241. [Google Scholar] [CrossRef]
- Bastos, J.G.; Kury, L.; Hanazaki, N.; Capozzi, R.; Fonseca-Kruel, V.S.D. A Biodiversity Hotspot Losing Its Biocultural Heritage: The Challenge to Biocultural Conservation of Brazilwood (Paubrasilia echinata). Front. For. Glob. Chang. 2022, 5, 696757. [Google Scholar] [CrossRef]
- Grogan, J.; Jennings, S.B.; Landis, R.M.; Schulze, M.; Baima, A.M.; Lopes, J.D.C.A.; Norghauer, J.M.; Oliveira, L.R.; Pantoja, F.; Pinto, D.; et al. What loggers leave behind: Impacts on big-leaf mahogany (Swietenia macrophylla) commercial populations and potential for post-logging recovery in the Brazilian Amazon. For. Ecol. Manag. 2008, 255, 269–281. [Google Scholar] [CrossRef]
- Deblauwe, V. Life history, uses, trade and management of Diospyros crassiflora Hiern, the ebony tree of the Central African forests: A state of knowledge. For. Ecol. Manag. 2021, 481, 118655. [Google Scholar] [CrossRef]
Locus | Primers (5′–3′) | Ta (°C) | Repeat Motif | Size Range (bp) | Accession Number | A | Ho | He |
---|---|---|---|---|---|---|---|---|
Oqui1 | TTCCTTCAAAAGTATGCCCCT | 58 | (TA)5 | 142–147 | PQ724125 | 3 | 0.21 | 0.49 |
CCCGTAGTTCAGGTAGTCCC | ||||||||
Oqui2 | GGTGTGAATGGACTCGGGAT | 59 | (CCT)3 | 136–142 | PQ724126 | 4 | 0.23 | 0.44 |
CCCGGAGTCAGGACATCAAT | ||||||||
Oqui3 | TCATGGATTAGGACGAGATAGCT | 58 | (CT)9 | 119–131 | PQ724127 | 2 | 0.16 | 0.37 |
TCTCTCTCCCACTCTCCAGT | ||||||||
Oqui4 | CATATGCCGGAGTTGAGGGT | 59 | (TA)13 | 128–135 | PQ724128 | 4 | 0.45 | 0.55 |
CAGTCTCCTAACGATGGGGT | ||||||||
Oqui5 | GAGTTATGAGTAGGATCGGGGA | 58 | (CCAA)4 | 111–118 | PQ724129 | 3 | 0.18 | 0.48 |
TCGGGTAAACTCTCAAGGGG | ||||||||
Oqui6 | AAATGGAAAATCACTGGGTAGGG | 59 | (ATA)4 | 103–119 | PQ724130 | 4 | 0.22 | 0.44 |
TCTCTAACTCTCTAAACTCCGCC | ||||||||
Oqui7 | CCTTAATGTGGAGTTTACCGAGA | 58 | (GA)5 | 113–123 | PQ724131 | 5 | 0.26 | 0.46 |
TGGTTAACTCTAAACGTGTGGG | ||||||||
Oqui8 | TTATCCTATGTGCGCGCTTG | 58 | (GCT)5 | 115–119 | PQ724132 | 3 | 0.17 | 0.37 |
GCCAACACAAACCACAACTC |
Populations | N | Na | I | Ho | He | Fis |
---|---|---|---|---|---|---|
PLA | 6 | 2.21 ± 0.11 a | 1.43 ± 0.15 a | 0.39 ± 0.04 a | 0.72 ± 0.09 a | 0.22 ± 0.10 a |
CVN | 8 | 2.20 ± 0.12 a | 1.45 ± 0.14 a | 0.37 ± 0.07 a | 0.70 ± 0.10 a | 0.24 ± 0.09 a |
CAN | 6 | 2.24 ± 0.10 a | 1.41 ± 0.10 a | 0.33 ± 0.06 a | 0.61 ± 0.08 a | 0.21 ± 0.08 a |
MAC | 10 | 3.21 ± 0.26 b | 1.19 ± 0.11 b | 0.41 ± 0.05 b | 0.73 ± 0.11 b | 0.14 ± 0.06 b |
PYO | 10 | 3.21 ± 0.14 b | 1.21 ± 0.08 b | 0.41 ± 0.03 b | 0.61 ± 0.14 b | 0.08 ± 0.07 b |
PNA | 8 | 3.21 ± 0.21 b | 1.17 ± 0.07 b | 0.46 ± 0.05 b | 0.63 ± 0.11 b | 0.09 ± 0.05 b |
MBJ | 10 | 4.21 ± 0.12 c | 1.14 ± 0.08 b | 0.67 ± 0.04 b | 0.79 ± 0.08 c | 0.11 ± 0.08 c |
GUA | 8 | 4.47 ± 0.29 c | 1.19 ± 0.10 b | 0.56 ± 0.09 c | 0.74 ± 0.06 c | 0.02 ± 0.02 c |
EYA | 8 | 4.21 ± 0.33 c | 1.13 ± 0.07 b | 0.62 ± 0.08 c | 0.77 ± 0.11 c | 0.04 ± 0.01 c |
LIM | 10 | 4.19 ± 0.26 c | 1.15 ± 0.09 b | 0.61 ± 0.07 c | 0.73 ± 0.08 c | 0.05 ± 0.01 c |
average | 3.34 | 1.25 | 0.48 | 0.70 | 0.12 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Draper, D.; Riofrío, L.; Naranjo, C.; Marques, I. Genetic Diversity of Ishpingo Exploited Trees (Ocotea quixos (Lam.) Kosterm, Lauraceae). Environ. Earth Sci. Proc. 2024, 31, 6. https://doi.org/10.3390/eesp2024031006
Draper D, Riofrío L, Naranjo C, Marques I. Genetic Diversity of Ishpingo Exploited Trees (Ocotea quixos (Lam.) Kosterm, Lauraceae). Environmental and Earth Sciences Proceedings. 2024; 31(1):6. https://doi.org/10.3390/eesp2024031006
Chicago/Turabian StyleDraper, David, Lorena Riofrío, Carlos Naranjo, and Isabel Marques. 2024. "Genetic Diversity of Ishpingo Exploited Trees (Ocotea quixos (Lam.) Kosterm, Lauraceae)" Environmental and Earth Sciences Proceedings 31, no. 1: 6. https://doi.org/10.3390/eesp2024031006
APA StyleDraper, D., Riofrío, L., Naranjo, C., & Marques, I. (2024). Genetic Diversity of Ishpingo Exploited Trees (Ocotea quixos (Lam.) Kosterm, Lauraceae). Environmental and Earth Sciences Proceedings, 31(1), 6. https://doi.org/10.3390/eesp2024031006