Next Article in Journal
Neutral Genetic Diversity of Brazilian Native Flora: Current Approaches and Gaps
Previous Article in Journal
Changes in Photosynthetic Pigment Concentrations Induced by Pinewood Nematode Infection of In Vitro Pine Shoots
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Proceeding Paper

Genetic Diversity of Ishpingo Exploited Trees (Ocotea quixos (Lam.) Kosterm, Lauraceae) †

1
Center for Ecology, Evolution and Environmental Changes & CHANGE—Global Change and Sustainability Institute, University of Lisbon, 1749-016 Lisbon, Portugal
2
Facultad de Ciencias Exactas y Naturales, Universidad Tecnica Particular de Loja (UTPL), 1101608 Loja, Ecuador
3
Forest Research Centre, Associate Laboratory TERRA, School of Agriculture, University of Lisbon, 1349-017 Lisbon, Portugal
*
Authors to whom correspondence should be addressed.
Presented at the 4th International Electronic Conference on Forests Session Forest Biodiversity, Ecosystem Services, and Earth Observations 19 September 2024.
Environ. Earth Sci. Proc. 2024, 31(1), 6; https://doi.org/10.3390/eesp2024031006
Published: 16 December 2024
(This article belongs to the Proceedings of The 4th International Electronic Conference on Forests)

Abstract

Ocotea quixos (Lam.) Kosterm, known as Ishpingo, is a tree endemic to the Amazonian rainforests of Colombia, Ecuador, and Peru. In Ecuador, the Ishpingo tree faces significant threats due to overexploitation for its valuable spices and essential oils, as well as extensive deforestation and land-use changes. Understanding and preserving the genetic diversity of Ishpingo is vital for ensuring the species’ survival and continued contribution to the ecological and cultural richness of the Amazonian rainforest. Nevertheless, we currently lack comprehensive genetic diversity data. Within this scenario, we developed nuclear microsatellites to analyze the genetic diversity in ten known Ecuadorian populations of Ishpingo. Results show low levels of genetic diversity, especially when compared with other Ocotea trees. The mean number of alleles ranged from 2.20 to 4.47, the observed heterozygosity from 0.33 to 0.62, while the expected heterozygosity (He) was notably higher, ranging from 0.61 to 0.79. The inbreeding coefficient (Fis) was consistently positive, with some values close to zero. Despite these results, some populations such as the northern populations of Ishpingo still harbor moderate levels of genetic diversity, key for the preservation of this species.

1. Introduction

Habitat changes and the illegal exploitation of natural resources are among the leading causes of species extinction. Though these factors operate at various scales, both impact genetic diversity and the ability of species to adapt to changing environmental conditions [1]. Populations with limited genetic diversity are more prone to extinction, often due to reduced gene flow, the loss of alleles through genetic drift and erosion, or the harmful effects of inbreeding [2].
The impacts of habitat changes are particularly profound in the tropics, a region known for its exceptionally high biodiversity, yet increasingly vulnerable to land-use changes and deforestation [3]. The fragmentation of tropical forests into isolated patches, largely due to agricultural expansion and land conversion, along with habitat degradation from activities such as selective logging, exerts immense pressure on ecosystems, raising uncertainties about how species will adapt [4,5]. These challenges are particularly complex for tree species, as their long lifespans and ability to disperse pollen and seeds over vast distances may help mitigate the loss of genetic diversity. This makes tree species vital for maintaining gene flow between fragmented forest areas, serving as important conduits for biodiversity resilience [6]. However, the ability of isolated remnant trees to support the long-term survival of populations is a complex issue. In many cases, seeds from trees in fragmented landscapes exhibit reduced vigor and signs of inbreeding depression, which can undermine the genetic health and resilience of future generations [7,8]. This compromised seed quality threatens the long-term viability of populations, raising concerns about their ability to adapt and persist in increasingly fragmented ecosystems.
Species with economic value face additional risks, not only from direct exploitation that hampers population regeneration but also from the removal of individuals from wild populations [9,10,11]. Theoretical studies have predicted a loss of alleles and reduced heterozygosity in overexploited populations [12,13]. This can lead to significant demographic declines and genetic erosion over successive generations [14]. However, not all exploited populations show a consistent decline in genetic diversity, since some reduced populations may still retain sufficient genetic variability to avoid species collapse [15,16].
Ocotea quixos (Lam.) Kosterm = Mespilodaphne quixos (Lam.) Rohwer (Ishpingo), commonly known as Ecuadorian cinnamon or Andean cinnamon, is a plant species belonging to the Lauraceae family. It is an endemic evergreen tree from the Amazonian rainforest of Colombia, Ecuador, and Peru [17]. Due to its aromatic bark and distinctive flavor, Ishpingo has gained recognition as a valuable spice and a cultural emblem in the regions where it grows [17]. The main spice is gathered from the dry cupules, although the bark and leaves are also harvested and processed to produce Ecuadorian cinnamon, which is known for its sweet and warm flavor profile [18,19,20]. While similar in some respects to the more common cinnamon, Ecuadorian cinnamon has its own unique characteristics, often described as more delicate and nuanced [17]. Beyond its applications, Ishpingo holds a very high cultural significance, since local communities often incorporate it in rituals, ceremonies, or in traditional medicine practices [21]. The plant has been known since Inca times, valued for its aromatic and medicinal properties. After Columbus’ voyages, several expeditions were performed in search of spice-rich regions, including the nearly mythical land known as “Tierra de la Canela”. This legendary land was believed to be abundant in valuable spices, and Ishpingo was one of the key plants associated with these explorations [22]. The pursuit of this fabled region drove expeditions deep into the Amazon, further fueling the legends surrounding the area’s rich natural resources [22]. Nowadays, Ishpingo is one of the key ingredients used in preparing “colada morada,” a traditional Ecuadorian drink consumed during the celebration of “Santos Difuntos” (Day of the Dead) [22].
Despite its cultural and economic importance, Ishpingo faces several conservation challenges due to habitat loss and unsustainable harvesting practices. Ishpingo is a slow-growing species [17]. The cupules are only harvested every two years from plants that are 15 to 20 years old [17]. This limited production makes the spice highly expensive [17]. In Ecuador, the intensive exploitation of this tree, together with intensive land-use changes and high deforestation rates in the national territory [23], has led to a severe reduction in the number of wild populations of Ishpingo [24]. In 2017, the situation was so severe that the government banned its commercialization for 6 months [24]. The expansion of roads, land-use changes, deforestation, and the use of clonal cultivars have been identified as the factors affecting populations [24]. The low number of populations and trees in the country suggests that the genetic variability of this species might be declining to values constraining population variability and resilience to changes. In this context, a genetic study based on nucleotide sequences already reported a very low variability among Ishpingo trees [24].
Given the significance of Ishpingo to local Ecuadorian communities, this study aimed to assess if the exploitation of its populations are linked to negative impacts on the species’ genetic variability. To achieve this, we developed nuclear microsatellites to analyze the genetic diversity, population structure, and levels of inbreeding in known Ecuadorian populations of Ishpingo, with the goal of informing both in situ and ex situ conservation strategies. Microsatellites are widely used markers for assessing genetic diversity [25,26]. They are short, repetitive sequences of DNA found throughout the genome, characterized by being co-dominant markers, generally selectively neutral and highly variable (polymorphic) even within populations [27]. Microsatellites are often the best choice for studies on genetic diversity in exploited species due to their high polymorphism, codominance, reproducibility, and versatility [28,29,30]. These qualities provide unmatched resolution for understanding genetic structure and informing conservation strategies, especially in non-model or threatened species.
In this study, our specific objectives were to determine (1) whether overexploitation has led to a depletion of genetic diversity that could have adverse effects; (2) if the spatial genetic structure is influenced by the species’ geographical distribution; and (3) whether there is evidence of inbreeding or reduced gene flow between populations.

2. Material and Methods

2.1. Population Sampling

In this study, 10 populations were sampled in Ecuador, targeting a total of 84 adult Ishpingo trees (Figure 1). Following the criteria in [31], trees with a diameter at breast height (DBH) greater than 5 cm were considered adults; we have not detected any trees with a DBH lower than this. In each population, leaf samples were collected from 6 to 10 adult trees, transported to the laboratory, and stored at −80 °C until DNA extraction.

2.2. DNA Extraction and nSSR Development

Total genomic DNA of Ishpingo samples was extracted using the DNeasy Plant Minikit (Qiagen, Hilden, Germany) following the manufacturer’s instructions and stored at −80 °C. New nuclear SSRs were developed using two small, inserted libraries digested with HaeII and RsaI and enriched with (CT)n sequences. Following [31], DNA fragments of each species were ligated into a p-GEM-T Easy Vector, as these were the plasmids transformed using Escherichia coli cells (Promega, Madison, WI, USA). In total, we obtained 26 clones in Ishpingo (16 from HaeII and 10 from RsaI) from which 22 showed a positive hybridization signal. Afterward, positive clones were sequenced with M13 primers using the following conditions: 3 min at 94 °C, followed by 48 cycles at 94 °C for 1 min, annealing at 53 °C for 1 min, 2 min at 72 °C, and 5 min at 72 °C. DNA sequencing was performed in both directions in a 3730 DNA Analyzer (Applied Biosystems, Foster, CA, USA). At the end, 20 clones of Ishpingo had readable sequences.
Primer 3 [32] was used to develop the new primers, which were tested using two individuals per population. Amplification of SSRs was performed in 15 μL reactions containing 1.25 U MyTaq DNA polymerase and 1 × MyTaq Reaction Buffer (Meridian Bioscience, London, UK), 0.4 μM Primer F-FAM and R, and 100 ng of genomic DNA, and amplified following [31]. PCR products were genotyped on an Applied Biosystems 3130XL Genetic Analyzer with 2 μL of amplified DNA, 12 μL of Hi-Di formamide, and 0.4 μL of GeneScan-600 (LIZ) size standard (Applied Biosystems, Waltham, MA, USA). Microsatellite fragment analysis was conducted on an AB 3500 Genetic Analyzer (Life Technologies Inc., New York, NY, USA). Allele sizes were determined using GeneMarker 3.1. (Softgenetics, State College, PA, USA).
Eight new nSSRs (Table 1) were selected based on their successful amplification, polymorphism, and the absence of null alleles verified using MICRO-CHECKER v.2.2.3 [33]. These markers were employed to genotype the 84 samples included in this study. For each microsatellite locus, we calculated the mean number of alleles (A), the mean expected heterozygosity (He), and the mean observed heterozygosity (Ho) using GenAlEx v6.51 [34]. We also tested deviation from the Hardy–Weinberg equilibrium (HWE) using the same program. In all analyses, significant values were corrected for multiple comparisons by Bonferroni correction [35].

2.3. Genetic Diversity and Differentiation

Genetic diversity in Ishpingo populations was assessed by calculating the total number of alleles (Ta), mean number of alleles per locus (Na), Shannon’s information index (I), mean expected heterozygosity (He), mean observed heterozygosity (Ho), inbreeding coefficient (Fis), and the percentage of polymorphic loci (PPL), using GenAlEx 6.51 [34]. We analyzed significant differences between populations and species through an ANOVA followed by a post hoc Tukey’s test (p < 0.05). Genetic differentiation (Fst) between populations and an analysis of molecular variance (AMOVA) was calculated using ARLEQUIN (version 3.5) [36]. The significance of the AMOVA components was determined through 1000 permutations.

2.4. Genetic Structure of Populations

To visualize the degree of the genetic structure of populations, a principal coordinate analysis (PCoA) based on Nei’s genetic distance was performed using GenAlEx 6.51 [34]. To understand the genetic composition of populations, STRUCTURE v.2.3.4 [37] was run from K = 1 to K = 12 assuming ancestral admixture and correlated allele frequencies. Run lengths of 300,000 steps were used for each K after a burn-in of 50,000, and 10 repetitions per K. The optimum K was determined using Structure Selector [38], which identifies the optimal K based on both the posterior probability of the data for a given K and the ∆K.

3. Results

3.1. Genetic Diversity of Loci

For each locus, the number of alleles ranged from 2 at locus Oqui2 and 5 at locus Oqui7 (Table 1). Heterozygosity values also varied between loci. Observed heterozygosity ranged from 0.16 at Oqui3 to 0.45 at Oqui4, whereas expected heterozygosity varied between 0.37 at Oqui3 and 0.55 at O qui4. No null alleles were detected. However, significant deviations from the Hardy–Weinberg equilibrium (HWE) were detected in all loci.

3.2. Genetic Diversity in Ishpingo Populations

The overall genetic diversity exhibited low average values, although results varied among populations (Table 2). Genetic diversity values were usually significantly higher in the Northern populations of Ishpingo, GUA, EYA, and LIM, followed by the Central populations MAC, PYO and PNA, with the Southern populations PLA, CVN and MAC exhibiting the lowest values (Table 2).
The mean number of alleles (Na) ranged from 2.20 in CVN to 4.47 in GUA (Table 2). Shannon’s information index (I) varied from 1.13 in EYA to 1.45 in CVN. Observed heterozygosity (Ho) ranged from 0.33 in CAN to 0.67 in MBJ, while the expected heterozygosity (He) was much higher, varying between 0.61 in CAN to 0.79 in MBJ (Table 2). Inbreeding coefficient (Fis) values were always positive and ranged from values very close to zero such as 0.02 in GUA to 0.24 in CVN (Table 2).
The analysis of molecular variance (AMOVA) found that 93.1% of the total variation was found within populations, while the remaining was explained among populations.

3.3. Genetic Structure of Populations

The first two axes of the PCoA accounted for 35.4% of the total variance, with 24.1% explained by the first axis and 11.3% by the second (Figure 2). The PCoA revealed distinct groupings (Figure 2). The southern populations CAN, CVN, and PLA clustered together in a single group on the left side of axis 1 and the upper portion of axis 2. All other populations were separated primarily along axis 1. The central and northern populations, PNA, PYO, and MAC, were clearly distinguished from MBJ and GUA, positioned on the right and upper sections of the plot. Lastly, the northern and most eastern populations, LIM and EYA, were located on the right and lower section of axis 1, in two separated clusters (Figure 2).
The STRUCTURE analysis identified the most likely number of genetic clusters across the entire dataset as K = 7 (Figure 3). One of these clusters predominantly characterized the southern populations, specifically PLA, CVN, and CAN. The central and northern populations of MAC, PYO, and PNA were structured into two distinct genetic clusters. While most individuals fit into one of these clusters, some showed evidence of admixture between the clusters, as well as with the southern group. A separate genetic cluster was identified in the MBJ and GUA populations, with some individuals also displaying signs of admixture. In contrast, the EYA population was defined by a single genetic cluster, as was LIM, each forming their own distinct genetic group (Figure 3).

4. Discussion

Our study identified low levels of genetic diversity across several populations of Ishpingo. For example, the averaged observed values of Ho (0.48) were lower than those reported for related Ocotea species occurring in Ecuador, such as O. rotundata (Ho = 0.65) [39], O. loxensis (Ho = 0.67) [31], and O. infrafoveolata (Ho = 0.69) [31]. These values are also lower than the ones reported for heavily harvested Ocotea species, such as O. odorifera (Ho = 0.63), O. porosa (Ho = 0.52), and O. catharinensis (Ho = 0.57), which have experienced significant population declines in Brazil [40].
Here, genetic values decreased from North to South Ecuador, with northern populations (MBJ, GUA, EYA, LIM) exhibiting higher genetic values than southern ones (PLA, CVN, CAN). Our results also show strong inbreeding in some Ishpingo populations (Table 2). This could explain the low level of admixture according to STRUCTURE and PCoA analyses. This was especially evident in the southern populations PLA, CVN, and CAN, and in the northern populations EYA and LIM (Figure 2 and Figure 3). The overexploitation of these trees, together with habitat disturbances and the fragmentation processes of the natural forest, which strongly occur in the south of Ecuador [23,41], could have also contribute to genetic drift, gene flow, and inbreeding [6].
Although further research is needed, with additional genetic markers and a more extensive sampling of O. quixos populations, our findings suggest that some populations are at risk due to very low genetic diversity, potentially compromising their ability to adapt to future environmental changes [42]. This is a concerning pattern seen in several trees worldwide, which, due to overexploitation for timber, medicinal properties, and other resources, have faced drastic population declines, loss of genetic diversity, and, in some cases, extinction. For instance, the overexploitation of Brazilwood (Paubrasilia echinata (Lam.) Gagnon, H. C. Lima & G. P. Lewis) has driven the species to the brink of extinction in some regions of Brazil, with the remaining natural populations now under strict protection to prevent further decline [43,44]. The widespread logging of Mahogany (Swietenia macrophylla King) has also resulted in severe population declines, prompting many countries to impose trade restrictions through mechanisms such as the Convention on International Trade in Endangered Species (CITES) [45]. The overharvesting of Ebony (Diospyros spp.) has drastically reduced populations, particularly in Madagascar and parts of Africa. Many species within the Diospyros genus are now classified as endangered or vulnerable, leading to strict regulations on their trade to protect remaining populations from further decline [46]. In the case of Ishpingo (Ocotea quixos (Lam.) Kosterm), no such restrictions exist.
The values reported here suggest the need for sustainable management and conservation practices. Protection measures, as well as reforestation and controlled harvesting programs, are essential to prevent the extinction of Ishpingo and to maintain biodiversity in their native ecosystems. Owing to the different diversity scattered geographically in the country, ex situ and in situ conservation actions should be implemented. The northern populations, EYA and LIM, still possess a rich genetic reservoir that needs to be conserved. In the other extreme, the southern populations PLA, CVN, and CAN might not have enough genetic variation to overcome future habitat changes. While specific conservation programs exclusively dedicated to Ishpingo may be limited, there are a few general efforts and strategies that help protect this tree and its natural habitat. In local communities relying on Ishpingo for its aromatic leaves and flowers, promoting sustainable harvesting is a key conservation strategy. An agroforestry approach integrating these trees with other native plants would also help to preserve biodiversity while providing a sustainable source of income for local communities. This approach can balance the need for agricultural development with the preservation of forest cover.

5. Conclusions

The genetic analysis of Ishpingo trees revealed low levels of genetic diversity, with metrics such as the mean number of alleles (2.20 to 4.47) and observed heterozygosity (0.33 to 0.67) significantly lower than those typically found in other Ocotea species. In addition, the consistently positive Fis values suggest limited genetic mixing and potential inbreeding, which could further reduce genetic variability over time.
By highlighting the observed patterns of genetic diversity, such as the higher values in northern populations and the lower values in southern ones, we provided insights into potential priority areas for conservation. For instance, northern populations of Ishpingo like those in EYA and LIM exhibit moderate levels of genetic diversity, making them critical to the species’ conservation. These populations may serve as genetic reservoirs for efforts aimed at preserving and restoring the species. In contrast, populations with lower diversity, such as PLA, CVN, and CAN, might require targeted interventions to mitigate genetic bottlenecks or inbreeding effects. Additionally, the data on heterozygosity and inbreeding coefficients can help in designing breeding programs or habitat restoration projects that promote genetic health and connectivity among populations.
By linking genetic metrics to practical conservation strategies, this study underscores the importance of integrating genetic data into management plans to ensure the long-term survival of Ishpingo trees, maintaining its ecological role and cultural significance in Amazonian rainforests. The lack of extensive genetic diversity data remains a significant challenge. This study provides a foundation, but further research is needed to develop effective conservation strategies and ensure the long-term survival of Ocotea quixos in its native habitat.

Author Contributions

Conceptualization, I.M. and D.D.; methodology, D.D.; formal analysis, I.M., D.D., L.R. and C.N.; investigation, I.M., D.D., L.R. and C.N.; project administration: I.M.; funding acquisition: I.M.; writing—original draft preparation, I.M. and D.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research received national funds through the FCT—Fundação para a Ciência e a Tecnologia, I.P., Portugal through the research unit UIDB/00329/2020 (CE3C) and DOI identifier 10.54499/UIDB/00329/2020, by project reference UIDB/00239/2020 of the Forest Research Centre and DOI identifier 10.54499/UIDB/00239/2020, and LA/P/0092/2020 of Associate Laboratory TERRA, DOI 10.54499/LA/P/0092/2020, and under the Scientific Employment Stimulus—Individual Call (CEEC Individual)—2021.01107.CEECIND/CP1689/CT0001 and DOI identifier 10.54499/2021.01107.CEECIND/CP1689/CT0001 (IM).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding authors.

Acknowledgments

We thank Yesenia Vega for her help during some field collections.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Markert, J.A.; Champlin, D.M.; Gutjahr-Gobell, R.; Grear, J.S.; Kuhn, A.; McGreevy, T.J.; Roth, A.; Bagley, M.J.; Nacci, D.E. Population genetic diversity and fitness in multiple environments. BMC Evol. Biol. 2010, 10, 205. [Google Scholar] [CrossRef] [PubMed]
  2. Furlan, E.; Stoklosa, J.; Griffiths, J.; Gust, N.; Ellis, R.; Huggins, R.M.; Weeks, A.R. Small population size and extremely low levels of genetic diversity in island populations of the platypus, Ornithorhynchus anatinus. Ecol. Evol. 2012, 2, 844–857. [Google Scholar] [CrossRef] [PubMed]
  3. Giam, X. Global biodiversity loss from tropical deforestation. Proc. Natl. Acad. Sci. USA 2017, 114, 5775–5777. [Google Scholar] [CrossRef]
  4. Schleuning, M.; Farwig, N.; Peters, M.K.; Bergsdorf, T.; Bleher, B.; Brandl, R.; Dalitz, H.; Fischer, G.; Freund, W.; Gikungu, M.W.; et al. Forest Fragmentation and Selective Logging Have Inconsistent Effects on Multiple Animal-Mediated Ecosystem Processes in a Tropical Forest. PLoS ONE 2011, 6, e27785. [Google Scholar] [CrossRef]
  5. Cudney-Valenzuela, S.J.; Arroyo-Rodríguez, V.; Morante-Filho, J.C.; Toledo-Aceves, T.; Andresen, E. Tropical forest loss impoverishes arboreal mammal assemblages by increasing tree canopy openness. Ecol. Appl. 2023, 33, 2744. [Google Scholar] [CrossRef] [PubMed]
  6. Lowe, A.J.; Boshier, D.; Ward, M.; Bacles, C.F.E.; Navarro, C. Genetic resource impacts of habitat loss and degradation; reconciling empirical evidence and predicted theory for neotropical trees. Heredity 2005, 95, 255–273. [Google Scholar] [CrossRef] [PubMed]
  7. Kramer, A.T.; Ison, J.L.; Ashley, M.V.; Howe, H.F. The Paradox of Forest Fragmentation Genetics La Paradoja de la Genética de la Fragmentación de Bosques. Conserv. Biol. 2008, 22, 878–885. [Google Scholar] [CrossRef]
  8. Eckert, C.G.; Kalisz, S.; Geber, M.A.; Sargent, R.; Elle, E.; Cheptou, P.-O.; Goodwillie, C.; Johnston, M.O.; Kelly, J.K.; Moeller, D.A.; et al. Plant mating systems in a changing world. Trends Ecol. Evol. 2010, 25, 35–43. [Google Scholar] [CrossRef] [PubMed]
  9. Sadovy, Y.; Cheung, W.L. Near extinction of a highly fecund fish: The one that nearly got away. Fish Fish. 2003, 4, 86–99. [Google Scholar] [CrossRef]
  10. Paijmans, A.J.; Stoffel, M.A.; Bester, M.N.; Cleary, A.C.; De Bruyn, P.J.N.; Forcada, J.; Goebel, M.E.; Goldsworthy, S.D.; Guinet, C.; Lydersen, C.; et al. The genetic legacy of extreme exploitation in a polar vertebrate. Sci. Rep. 2020, 10, 5089. [Google Scholar] [CrossRef] [PubMed]
  11. Lotze, H.K. Repetitive history of resource depletion and mismanagement. Mar. Ecol. Prog. Ser. 2004, 274, 282–285. [Google Scholar]
  12. Cruse-Sanders, J.M.; Hamrick, J.; Ahumada, J.A. Consequences of harvesting for genetic diversity in American ginseng (Panax quinquefolius L.): A simulation study. Biodivers. Conserv. 2005, 14, 493–504. [Google Scholar] [CrossRef]
  13. Sebbenn, A.M.; Degen, B.; Azevedo, V.C.; Silva, M.B.; de Lacerda, A.E.; Ciampi, A.Y.; Kanashiro, M.; Carneiro, F.d.S.; Thompson, I.; Loveless, M.D. Modelling the long-term impacts of selective logging on genetic diversity and demographic structure of four tropical tree species in the Amazon forest. For. Ecol. Manag. 2008, 254, 335–349. [Google Scholar] [CrossRef]
  14. González-Fernández, A.; Arroyo-Rodríguez, V.; Ramírez-Corona, F.; Manjarrez, J.; Aguilera-Hernández, A.; Sunny, A. Local and landscape drivers of the number of individuals and genetic diversity of a microendemic and critically endangered salamander. Landsc. Ecol. 2019, 34, 1989–2000. [Google Scholar] [CrossRef]
  15. Hauser, L.; Adcock, G.J.; Smith, P.J.; Ramírez, J.H.B.; Carvalho, G.R. Loss of microsatellite diversity and low effective population size in an overexploited population of New Zealand snapper (Pagrus auratus). Proc. Natl. Acad. Sci. USA 2002, 99, 11742–11747. [Google Scholar] [CrossRef]
  16. Xu, Z.; Dou, S.-Z.; Ding, S.-X.; Liu, J.-X. Temporal Genetic Stability Despite Decades of Overexploitation for Large Yellow Croaker in the East China Sea. Front. Mar. Sci. 2022, 9, 861840. [Google Scholar] [CrossRef]
  17. Gilardoni, G.; Montalván, M.; Vélez, M.; Malagón, O. Chemical and Enantioselective Analysis of the Essential Oils from Different Morphological Structures of Ocotea quixos (Lam.) Kosterm. Plants 2021, 10, 2171. [Google Scholar] [CrossRef]
  18. Bruni, R.; Medici, A.; Andreotti, E.; Fantin, C.; Muzzoli, M.; Dehesa, M.; Romagnoli, C.; Sacchetti, G. Chemical composition and biological activities of Ishpingo essential oil, a traditional Ecuadorian spice from Ocotea quixos (Lam.) Kosterm. (Lauraceae) flower calices. Food Chem. 2004, 85, 415–421. [Google Scholar] [CrossRef]
  19. Noriega, P.; Mosquera, T.; Paredes, E.; Parra, M.; Zappia, M.; Herrera, M.; Villegas, A.; Osorio, E. Antimicrobial and antioxidant bioautography activity of bark essential oil from Ocotea quixos (Lam.) kosterm. J. Planar Chromatogr. Mod. TLC 2018, 31, 163–168. [Google Scholar] [CrossRef]
  20. Sacchetti, G.; Guerrini, A.; Noriega, P.; Bianchi, A.; Bruni, R. Essential oil of wild Ocotea quixos (Lam.) Kosterm. (Lauraceae) leaves from Amazonian Ecuador. Flavour Fragr. J. 2006, 21, 674–676. [Google Scholar] [CrossRef]
  21. Armijos, C.; Ramírez, J.; Salinas, M.; Vidari, G.; Suárez, A.I. Pharmacology and phytochemistry of ecuadorian medicinal plants: An update and perspectives. Pharmaceuticals 2021, 14, 1145. [Google Scholar] [CrossRef] [PubMed]
  22. Noriega, P. Ishpink, Ocotea quixos (Lam.) Kosterm. History, Traditional Uses, Chemical, Pharmacological Properties and the Economic Potential of its Essentials Oils Present within this Amazonian Species. In Essential Oils: Historical Significance, Chemical Composition and Medicinal Uses and Benefits; Nova Science Publishers: Hauppauge, NY, USA, 2016; ISBN 978-1-63484-351-5. [Google Scholar]
  23. Rivas, C.A.; Guerrero-Casado, J.; Navarro-Cerillo, R.M. Deforestation and fragmentation trends of seasonal dry tropical forest in Ecuador: Impact on conservation. For. Ecosyst. 2021, 8, 46. [Google Scholar] [CrossRef]
  24. Salazar, P.; I Rivas, P.; Mátyás, B.; Karolys, G. Comparison of the genetic variability of three regions of chloroplast DNA and nuclear DNA in ishpingo (Ocotea quixos) coming from five provinces of the ecuadorian amazon. Appl. Ecol. Environ. Res. 2019, 17, 4933–4948. [Google Scholar] [CrossRef]
  25. Noh, S.W.; Park, J.-K.; Yu, J.S.; Nam, D.E.; Do, Y.; Chung, K.W. Genetic Diversity and Population Structure of the Spring Orchid Cymbidium goeringii in Korean Distant Islands. Diversity 2020, 12, 486. [Google Scholar] [CrossRef]
  26. Erazo-Garcia, M.P.; Guadalupe, J.J.; Rowntree, J.K.; Borja-Serrano, P.; de los Monteros-Silva, N.E.; De Lourdes Torres, M. Assessing the genetic diversity of Ilex guayusa loes., a medicinal plant from the ecuadorian amazon. Diversity 2021, 13, 182. [Google Scholar] [CrossRef]
  27. Amiteye, S. Basic concepts and methodologies of DNA marker systems in plant molecular breeding. Heliyon 2021, 7, e08093. [Google Scholar] [CrossRef]
  28. Selkoe, K.A.; Toonen, R.J. Microsatellites for ecologists: A practical guide to using and evaluating microsatellite markers. Ecol. Lett. 2006, 9, 615–629. [Google Scholar] [CrossRef]
  29. Monthe, F.S.; Duminil, J.; Tosso, F.; Migliore, J.; Hardy, O.J. Characterization of microsatellite markers in two exploited African trees, Entandrophragma candollei and E. utile (Meliaceae). Appl. Plant Sci. 2017, 5, 1600130. [Google Scholar] [CrossRef]
  30. Nguyen, D.M.; Nguyen, H.L.P.; Nguyen, T.M. Genetic structure of the endemic Dipterocarpus condorensis revealed by microsatellite markers. AoB Plants 2022, 14, plac007. [Google Scholar] [CrossRef]
  31. Draper, D.; Riofrío, L.; Naranjo, C.; Marques, I. The Complex Genetic Legacy of Hybridization and Introgression between the Rare Ocotea loxensis van der Werff and the Widespread O. infrafoveolata van der Werff (Lauraceae). Plants 2024, 13, 1956. [Google Scholar] [CrossRef] [PubMed]
  32. Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [PubMed]
  33. Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. micro-checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar] [CrossRef]
  34. Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [PubMed]
  35. Rice, W.R. Analyzing Tables of Statistical Tests. Evolution 1989, 43, 223. [Google Scholar] [CrossRef]
  36. Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef] [PubMed]
  37. Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of Population Structure Using Multilocus Genotype Data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [PubMed]
  38. Li, Y.; Liu, J. StructureSelector: A web-based software to select and visualize the optimal number of clusters using multiple methods. Mol. Ecol. Resour. 2018, 18, 176–177. [Google Scholar] [CrossRef]
  39. Marques, I.; Draper, D.; Riofrío, L.; Naranjo, C. Early Signs of the Effects of Forest Fragmentation on the Genetic Diversity and Structure of the Threatened Ecuadorian Tree Ocotea rotundata (Lauraceae). Forests 2022, 13, 1940. [Google Scholar] [CrossRef]
  40. Martins, E.M.; Lamont, R.W.; Martinelli, G.; Lira-Medeiros, C.F.; Quinet, A.; Shapcott, A. Genetic diversity and population genetic structure in three threatened Ocotea species (Lauraceae) from Brazil’s Atlantic Rainforest and implications for their conservation. Conserv. Genet. 2015, 16, 1–14. [Google Scholar] [CrossRef]
  41. Curatola Fernández, G.F.; Obermeier, W.A.; Gerique, A.; López Sandoval, M.F.; Lehnert, L.W.; Thies, B.; Bendix, J. Land Cover Change in the Andes of Southern Ecuador—Patterns and Drivers. Remote Sens. 2015, 7, 2509–2542. [Google Scholar] [CrossRef]
  42. Isabel, N.; Holliday, J.A.; Aitken, S.N. Forest genomics: Advancing climate adaptation, forest health, productivity, and conservation. Evol. Appl. 2020, 13, 3–10. [Google Scholar] [CrossRef] [PubMed]
  43. Rees, M.; Neaves, L.E.; Lewis, G.P.; de Lima, H.C.; Gagnon, E. Phylogenomic and morphological data reveal hidden patterns of diversity in the national tree of Brazil, Paubrasilia echinata. Am. J. Bot. 2023, 110, e16241. [Google Scholar] [CrossRef]
  44. Bastos, J.G.; Kury, L.; Hanazaki, N.; Capozzi, R.; Fonseca-Kruel, V.S.D. A Biodiversity Hotspot Losing Its Biocultural Heritage: The Challenge to Biocultural Conservation of Brazilwood (Paubrasilia echinata). Front. For. Glob. Chang. 2022, 5, 696757. [Google Scholar] [CrossRef]
  45. Grogan, J.; Jennings, S.B.; Landis, R.M.; Schulze, M.; Baima, A.M.; Lopes, J.D.C.A.; Norghauer, J.M.; Oliveira, L.R.; Pantoja, F.; Pinto, D.; et al. What loggers leave behind: Impacts on big-leaf mahogany (Swietenia macrophylla) commercial populations and potential for post-logging recovery in the Brazilian Amazon. For. Ecol. Manag. 2008, 255, 269–281. [Google Scholar] [CrossRef]
  46. Deblauwe, V. Life history, uses, trade and management of Diospyros crassiflora Hiern, the ebony tree of the Central African forests: A state of knowledge. For. Ecol. Manag. 2021, 481, 118655. [Google Scholar] [CrossRef]
Figure 1. Details of the Ishpingo (Ocotea quixos (Lam.) Kosterm) populations sampled in Ecuador.
Figure 1. Details of the Ishpingo (Ocotea quixos (Lam.) Kosterm) populations sampled in Ecuador.
Eesp 31 00006 g001
Figure 2. Genetic relationships between Ishpingo (Ocotea quixos (Lam.) Kosterm) populations based on a principal coordinate analysis (PCoA). Population labels refer to Figure 1.
Figure 2. Genetic relationships between Ishpingo (Ocotea quixos (Lam.) Kosterm) populations based on a principal coordinate analysis (PCoA). Population labels refer to Figure 1.
Eesp 31 00006 g002
Figure 3. Genetic structure of Ishpingo (Ocotea quixos (Lam.) Kosterm) based on the best assignment results recovered by STRUCTURE (K = 7). Each sample is represented by a thin vertical line divided into K-colored segments that represent the individual’s estimated membership fractions in K clusters. Population labels refer to Figure 1.
Figure 3. Genetic structure of Ishpingo (Ocotea quixos (Lam.) Kosterm) based on the best assignment results recovered by STRUCTURE (K = 7). Each sample is represented by a thin vertical line divided into K-colored segments that represent the individual’s estimated membership fractions in K clusters. Population labels refer to Figure 1.
Eesp 31 00006 g003
Table 1. Characteristics of the eight microsatellite markers used to amplify 84 samples of Ocotea loxensis and O. infrafoveolata. For each locus, the accession number, the mean number of alleles (A), mean expected heterozygosity (He), and the mean observed heterozygosity (Ho) are shown.
Table 1. Characteristics of the eight microsatellite markers used to amplify 84 samples of Ocotea loxensis and O. infrafoveolata. For each locus, the accession number, the mean number of alleles (A), mean expected heterozygosity (He), and the mean observed heterozygosity (Ho) are shown.
LocusPrimers (5′–3′)Ta (°C)Repeat MotifSize Range (bp)Accession NumberAHoHe
Oqui1TTCCTTCAAAAGTATGCCCCT58(TA)5142–147PQ72412530.210.49
CCCGTAGTTCAGGTAGTCCC
Oqui2GGTGTGAATGGACTCGGGAT59(CCT)3136–142PQ72412640.230.44
CCCGGAGTCAGGACATCAAT
Oqui3TCATGGATTAGGACGAGATAGCT58(CT)9119–131PQ72412720.160.37
TCTCTCTCCCACTCTCCAGT
Oqui4CATATGCCGGAGTTGAGGGT59(TA)13128–135PQ72412840.450.55
CAGTCTCCTAACGATGGGGT
Oqui5GAGTTATGAGTAGGATCGGGGA58(CCAA)4111–118PQ72412930.180.48
TCGGGTAAACTCTCAAGGGG
Oqui6AAATGGAAAATCACTGGGTAGGG59(ATA)4103–119PQ72413040.220.44
TCTCTAACTCTCTAAACTCCGCC
Oqui7CCTTAATGTGGAGTTTACCGAGA58(GA)5113–123PQ72413150.260.46
TGGTTAACTCTAAACGTGTGGG
Oqui8TTATCCTATGTGCGCGCTTG58(GCT)5115–119PQ72413230.170.37
GCCAACACAAACCACAACTC
Table 2. Genetic variation in Ishpingo populations. N: number of sampled plants; Na: number of different alleles; I: Shannon’s information index, Ho: observed heterozygosity; He: expected heterozygosity; Fis: inbreeding coefficient among individuals within populations. Different superscript letters indicate significant differences between populations based on ANOVA followed by the post hoc Tukey’s test (p < 0.05).
Table 2. Genetic variation in Ishpingo populations. N: number of sampled plants; Na: number of different alleles; I: Shannon’s information index, Ho: observed heterozygosity; He: expected heterozygosity; Fis: inbreeding coefficient among individuals within populations. Different superscript letters indicate significant differences between populations based on ANOVA followed by the post hoc Tukey’s test (p < 0.05).
PopulationsNNaIHoHeFis
PLA62.21 ± 0.11 a1.43 ± 0.15 a0.39 ± 0.04 a0.72 ± 0.09 a0.22 ± 0.10 a
CVN82.20 ± 0.12 a1.45 ± 0.14 a0.37 ± 0.07 a0.70 ± 0.10 a0.24 ± 0.09 a
CAN62.24 ± 0.10 a 1.41 ± 0.10 a0.33 ± 0.06 a0.61 ± 0.08 a0.21 ± 0.08 a
MAC103.21 ± 0.26 b1.19 ± 0.11 b0.41 ± 0.05 b0.73 ± 0.11 b0.14 ± 0.06 b
PYO103.21 ± 0.14 b1.21 ± 0.08 b0.41 ± 0.03 b0.61 ± 0.14 b0.08 ± 0.07 b
PNA83.21 ± 0.21 b1.17 ± 0.07 b0.46 ± 0.05 b0.63 ± 0.11 b0.09 ± 0.05 b
MBJ104.21 ± 0.12 c1.14 ± 0.08 b0.67 ± 0.04 b0.79 ± 0.08 c0.11 ± 0.08 c
GUA84.47 ± 0.29 c1.19 ± 0.10 b0.56 ± 0.09 c0.74 ± 0.06 c0.02 ± 0.02 c
EYA84.21 ± 0.33 c1.13 ± 0.07 b0.62 ± 0.08 c0.77 ± 0.11 c0.04 ± 0.01 c
LIM104.19 ± 0.26 c1.15 ± 0.09 b0.61 ± 0.07 c0.73 ± 0.08 c0.05 ± 0.01 c
average 3.341.250.480.700.12
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Draper, D.; Riofrío, L.; Naranjo, C.; Marques, I. Genetic Diversity of Ishpingo Exploited Trees (Ocotea quixos (Lam.) Kosterm, Lauraceae). Environ. Earth Sci. Proc. 2024, 31, 6. https://doi.org/10.3390/eesp2024031006

AMA Style

Draper D, Riofrío L, Naranjo C, Marques I. Genetic Diversity of Ishpingo Exploited Trees (Ocotea quixos (Lam.) Kosterm, Lauraceae). Environmental and Earth Sciences Proceedings. 2024; 31(1):6. https://doi.org/10.3390/eesp2024031006

Chicago/Turabian Style

Draper, David, Lorena Riofrío, Carlos Naranjo, and Isabel Marques. 2024. "Genetic Diversity of Ishpingo Exploited Trees (Ocotea quixos (Lam.) Kosterm, Lauraceae)" Environmental and Earth Sciences Proceedings 31, no. 1: 6. https://doi.org/10.3390/eesp2024031006

APA Style

Draper, D., Riofrío, L., Naranjo, C., & Marques, I. (2024). Genetic Diversity of Ishpingo Exploited Trees (Ocotea quixos (Lam.) Kosterm, Lauraceae). Environmental and Earth Sciences Proceedings, 31(1), 6. https://doi.org/10.3390/eesp2024031006

Article Metrics

Back to TopTop