In Vitro Assessment of the Antimicrobial and Antibiofilm Activities of Commercial Toothpastes Against Streptococcus mutans
Abstract
1. Introduction
2. Materials and Methods
2.1. Selection of Toothpastes and Bacterial Strain
2.2. Disk Diffusion Assay
2.3. Determination of Minimum Inhibitory Concentration and Minimum Bactericidal Concentration
2.4. Quantitative Comparison of Biofilm Formation
2.5. Growth Assay
2.6. Quantitative Real-Time PCR
2.7. Statistical Analysis
3. Results and Discussion
3.1. Selecting Toothpastes for Evaluating Antimicrobial Activity Against S. mutans
3.2. Toothpastes with Antimicrobial Activity Against S. mutans
3.3. Antibiofilm Activity of Toothpastes
3.4. S. mutans Growth Curves as a Function of Toothpaste Treatment Concentration
3.5. Altered Biofilm-Related Gene Expression of S. mutans Due to Toothpaste Application
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Loveren, C.V. Toothpastes; Monographs in Oral Science; Karger: Basel, Switzerland, 2013; pp. 9–19. [Google Scholar]
- Fischman, S.L. The history of oral hygiene products: How far have we come in 6000 years? Periodontology 2000 1997, 15, 7–14. [Google Scholar] [CrossRef]
- Unterbrink, P.; Schulze Zur Wiesche, E.; Meyer, F.; Fandrich, P.; Amaechi, B.T.; Enax, J. Prevention of Dental Caries: A Review on the Improvements of Toothpaste Formulations from 1900 to 2023. Dent. J. 2024, 12, 64. [Google Scholar] [CrossRef] [PubMed]
- Barbosa, L.M.M.; de Souza Carneiro, T.; Favoreto, M.W.; Borges, C.P.F.; Reis, A.; Meireles, S.S.; Loguercio, A.D. Whitening toothpastes with hydrogen peroxide concentrations vs. at-home bleaching. Clin. Oral Investig. 2024, 28, 436. [Google Scholar] [CrossRef]
- Tomas, D.B.M.; Pecci-Lloret, M.P.; Guerrero-Girones, J. Effectiveness and abrasiveness of activated charcoal as a whitening agent: A systematic review of in vitro studies. Ann. Anat. 2023, 245, 151998. [Google Scholar] [CrossRef]
- Petrovic, B.; Kojic, S.; Milic, L.; Luzio, A.; Peric, T.; Markovic, E.; Stojanovic, G.M. Toothpaste ingestion-evaluating the problem and ensuring safety: Systematic review and meta-analysis. Front. Public Health 2023, 11, 1279915. [Google Scholar] [CrossRef]
- Jardim, J.J.; Alves, L.S.; Maltz, M. The history and global market of oral home-care products. Braz. Oral Res. 2009, 23 (Suppl. S1), 17–22. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Sabri, H.; Derakhshan Barjoei, M.M.; Azarm, A.; Sadighnia, N.; Shakiba, R.; Aghebati, G.; Hadilou, N.; Kheiri, P.; Ghanbari, F.; Deravi, N.; et al. The Yin and Yang of Sodium Lauryl Sulfate Use for Oral and Periodontal Health: A Literature Review. J. Dent. 2023, 24, 262–276. Available online: https://dentjods.sums.ac.ir/article_48882.html (accessed on 15 May 2025).
- Liao, Y.; Brandt, B.W.; Li, J.; Crielaard, W.; Van Loveren, C.; Deng, D.M. Fluoride resistance in Streptococcus mutans: A mini review. J. Oral Microbiol. 2017, 9, 1344509. [Google Scholar] [CrossRef]
- Jones, S.; Burt, B.A.; Petersen, P.E.; Lennon, M.A. The effective use of fluorides in public health. Bull. World Health Organ. 2005, 83, 670–676. [Google Scholar]
- Daruich, P.M.; Brizuela, M. Remineralization of Initial Carious Lesions. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2025. [Google Scholar]
- Ucuncu, M.K.; Guven, K.; Yazicioglu, O. Investigation of the constituents of commercially available toothpastes. Int. J. Dent. Hyg. 2024, 22, 913–932. [Google Scholar] [CrossRef]
- Scharnow, A.M.; Solinski, A.E.; Wuest, W.M. Targeting S. mutans biofilms: A perspective on preventing dental caries. MedChemComm 2019, 10, 1057–1067. [Google Scholar] [CrossRef]
- Manzer, H.S.; Nobbs, A.H.; Doran, K.S. The Multifaceted Nature of Streptococcal Antigen I/II Proteins in Colonization and Disease Pathogenesis. Front. Microbiol. 2020, 11, 602305. [Google Scholar] [CrossRef]
- Bowen, W.H.; Koo, H. Biology of Streptococcus mutans-derived glucosyltransferases: Role in extracellular matrix formation of cariogenic biofilms. Caries Res. 2011, 45, 69–86. [Google Scholar] [CrossRef]
- Marquis, R.E. Antimicrobial actions of fluoride for oral bacteria. Can. J. Microbiol. 1995, 41, 955–964. [Google Scholar] [CrossRef] [PubMed]
- Belli, W.A.; Buckley, D.H.; Marquis, R.E. Weak acid effects and fluoride inhibition of glycolysis by Streptococcus mutans GS-5. Can. J. Microbiol. 1995, 41, 785–791. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Qi, C.; Yang, S.; Li, Z.; Ren, B.; Li, J.; Zhou, X.; Cai, H.; Xu, X.; Peng, X. F0F1-ATPase Contributes to the Fluoride Tolerance and Cariogenicity of Streptococcus mutans. Front. Microbiol. 2021, 12, 777504. [Google Scholar] [CrossRef]
- Lee, Y.C.; Cho, S.G.; Kim, S.W.; Kim, J.N. Anticariogenic Potential of Korean Native Plant Extracts against Streptococcus mutans. Planta Medica 2019, 85, 1242–1252. [Google Scholar] [CrossRef]
- Pulfer, A.M.; Attin, T.; Wegehaupt, F.J. Salivary Flow Rate During Toothbrushing. Oral Health Prev. Dent. 2022, 20, 465–474. [Google Scholar] [CrossRef] [PubMed]
- Ahn, S.J.; Lemos, J.A.; Burne, R.A. Role of HtrA in growth and competence of Streptococcus mutans UA159. J. Bacteriol. 2005, 187, 3028–3038. [Google Scholar] [CrossRef]
- Kim, J.N.; Stanhope, M.J.; Burne, R.A. Core-gene-encoded peptide regulating virulence-associated traits in Streptococcus mutans. J. Bacteriol. 2013, 195, 2912–2920. [Google Scholar] [CrossRef]
- Loo, C.Y.; Corliss, D.A.; Ganeshkumar, N. Streptococcus gordonii biofilm formation: Identification of genes that code for biofilm phenotypes. J. Bacteriol. 2000, 182, 1374–1382. [Google Scholar] [CrossRef]
- Piszko, P.J.; Piszko, A.; Kiryk, S.; Kiryk, J.; Kensy, J.; Michalak, M.; Matys, J.; Dobrzynski, M. Fluoride Release from Two Commercially Available Dental Fluoride Gels-In Vitro Study. Gels 2025, 11, 135. [Google Scholar] [CrossRef]
- Silhacek, K.J.; Taake, K.R. Sodium bicarbonate and hydrogen peroxide: The effect on the growth of Streptococcus mutans. J. Dent. Hyg. 2005, 79, 7. [Google Scholar]
- Cheng, X.; Xu, X.; Zhou, X.; Ning, J. Oxidative stress response: A critical factor affecting the ecological competitiveness of Streptococcus mutans. J. Oral Microbiol. 2024, 16, 2292539. [Google Scholar] [CrossRef]
- Biria, M.; Rezvani, Y.; Roodgarian, R.; Rabbani, A.; Iranparvar, P. Antibacterial effect of an herbal toothpaste containing Bamboo salt: A randomized double-blinded controlled clinical trial. BMC Oral Health 2022, 22, 193. [Google Scholar] [CrossRef]
- Kumar, P.S.; Vidhya, S.; Sekar, M. Depth of Penetration and Antimicrobial Activity of 5% and 10% Bamboo Salt, 2% Chlorhexidine Gel and Calcium Hydroxide Against Enterococcus faecalis—An In Vitro Study. Eur. Endod. J. 2021, 6, 205–210. [Google Scholar] [CrossRef]
- Randall, J.P.; Seow, W.K.; Walsh, L.J. Antibacterial activity of fluoride compounds and herbal toothpastes on Streptococcus mutans: An in vitro study. Aust. Dent. J. 2015, 60, 368–374. [Google Scholar] [CrossRef] [PubMed]
- Klaophimai, A.; Tosrisawatkasem, O.; Horsophonphong, S. Antibacterial effects of children’s and adults’ toothpastes containing different amounts of fluoride: An in vitro study. J. Dent. Res. Dent. Clin. Dent. Prospect. 2024, 18, 23–28. [Google Scholar] [CrossRef]
- Han, Y. Effects of brief sodium fluoride treatments on the growth of early and mature cariogenic biofilms. Sci. Rep. 2021, 11, 18290. [Google Scholar] [CrossRef] [PubMed]
- Raval, Y.S.; Flurin, L.; Mohamed, A.; Greenwood-Quaintance, K.E.; Beyenal, H.; Patel, R. Antibacterial Activity of Hydrogen Peroxide and Hypochlorous Acid, Including That Generated by Electrochemical Scaffolds. Antimicrob. Agents Chemother. 2021, 65, e01966-20. [Google Scholar] [CrossRef] [PubMed]
- Yu, W.; Hallinen, K.M.; Wood, K.B. Interplay between Antibiotic Efficacy and Drug-Induced Lysis Underlies Enhanced Biofilm Formation at Subinhibitory Drug Concentrations. Antimicrob. Agents Chemother. 2018, 62, e01603-17. [Google Scholar] [CrossRef]
- Petersen, F.C.; Assev, S.; Scheie, A.A. Combined effects of NaF and SLS on acid- and polysaccharide-formation of biofilm and planktonic cells. Arch. Oral Biol. 2006, 51, 665–671. [Google Scholar] [CrossRef]
- Shi, Q.; Sun, L.; Gao, J.; Li, F.; Chen, D.; Shi, T.; Tan, Y.; Chang, H.; Liu, X.; Kang, J.; et al. Effects of sodium lauryl sulfate and postbiotic toothpaste on oral microecology. J. Oral Microbiol. 2024, 16, 2372224. [Google Scholar] [CrossRef] [PubMed]
- Aydin, N.; Suloglu, A.K.; Idil, N.; Ozturk, S.; Karaoglanoglu, S. Examination of cytotoxic and antimicrobial effect of whitening toothpastes: An in vitro study. Acta Odontol. Scand. 2024, 83, 327–333. [Google Scholar] [CrossRef]
- Brady, L.J.; Maddocks, S.E.; Larson, M.R.; Forsgren, N.; Persson, K.; Deivanayagam, C.C.; Jenkinson, H.F. The changing faces of Streptococcus antigen I/II polypeptide family adhesins. Mol. Microbiol. 2010, 77, 276–286. [Google Scholar] [CrossRef] [PubMed]
- Koo, H.; Falsetta, M.L.; Klein, M.I. The exopolysaccharide matrix: A virulence determinant of cariogenic biofilm. J. Dent. Res. 2013, 92, 1065–1073. [Google Scholar] [CrossRef]
- Zheng, T.; Jing, M.; Gong, T.; Yan, J.; Wang, X.; Xu, M.; Zhou, X.; Zeng, J.; Li, Y. Regulatory mechanisms of exopolysaccharide synthesis and biofilm formation in Streptococcus mutans. J. Oral Microbiol. 2023, 15, 2225257. [Google Scholar] [CrossRef]
- Lemos, J.A.; Burne, R.A. A model of efficiency: Stress tolerance by Streptococcus mutans. Microbiology 2008, 154 Pt 11, 3247–3255. [Google Scholar] [CrossRef]
- Senadheera, D.; Cvitkovitch, D.G. Quorum sensing and biofilm formation by Streptococcus mutans. Adv. Exp. Med. Biol. 2008, 631, 178–188. [Google Scholar] [CrossRef] [PubMed]





| Toothpaste | Composition | pH |
|---|---|---|
| 2080 Classic Toothpaste (T1) | Dental-type silica, Tocopheryl acetate, Sodium Fluoride (1000 μg/mL), Sodium lauryl sulfate, Amorphous sorbitol solution, Sodium saccharin hydrate, titanium dioxide, Xylitol, Sodium carboxymethyl cellulose, Polyethylene glycol | 7.51 ± 0.05 |
| Pororo Low-Fluoride Toothpaste (T2) | Silicon dioxide, Sodium monofluorophosphate (528 μg/mL), Sodium lauryl sulfate, Rosemary extract, Sodium saccharin, Amorphous sorbitol solution, Xylitol, Sodium carboxymethyl cellulose, Polyethylene glycol, Hydrated silica | 7.10 ± 0.05 |
| VUCA Classic Whitening Toothpaste (T3) | Hydrogen peroxide solution 35%, Tocopheryl acetate, Colloidal silicon dioxide, Glycerin, Polyethylene Glycol, Sodium Carboxymethylcellulose, Sodium Cocoyl Glutamate, Sodium Lauryl Sulfate, Polysorbate, Sodium EDTA, Sodium Acid Pyrophosphate, Hydroxyapatite, Ascorbic acid, Xylitol, Enzyme-treated Stevia, Sodium Chloride, Green Tea Extract, Matricaria Extract, Aloe Extract, Eucalyptus Extract, Calendula Extract, Olive Leaf Extract, Tea Tree Oil, Eucalyptus Oil, L-Menthol, Peppermint Oil | 5.57 ± 0.01 |
| 2080 Dr. Clinic Gum Toothpaste 2 (T4) | Dental-type Silica, Centella asiatica Extract, Aminocaproic acid, Sodium Fluoride (1000 μg/mL) Sodium pyrophosphate, Sodium Lauryl Sulfate, Amorphous Sorbitol Solution, Sodium Saccharin Hydrate, titanium dioxide, xylitol, Xanthan gum, Sodium Carboxymethylcellulose, Polyoxyethylene Hydrogenated Castor Oil, Hydroxyethylcellulose | 8.42 ± 0.18 |
| Sirinmed F Toothpaste (T5) | Tricalcium Phosphate, Colloidal silicon dioxide, glycerin, Sodium Lauryl Sulfate, Sodium Saccharin Hydrate, Sodium Carboxymethylcellulose, Sodium Cocoyl Isethionate | 8.00 ± 0.21 |
| Halitosis Science Toothpaste (T6) | Camellia sinensis Leaf Extract, Dental-type Silica, Sodium monofluorophosphate (1000 μg/mL), Sodium Pyrophosphate, Glycerin, Sodium Lauryl Sulfate, Sodium Saccharin, Cellulose Gum, Amorphous Sorbitol Solution, Sucralose, Silica, Medicinal Charcoal, Erythritol, Lactic Acid Bacteria Fermentation Solution/Butylene Glycol Mixture | 9.04 ± 0.14 |
| Bamboo Salt Gum Care Toothpaste (T7) | Potassium Glycyrrhizinate, Dental-type Silica, Centella asiatica Extract, Bamboo Salt, Sodium Fluoride (1000 μg/mL), sodium copper chlorophyllin, Sodium Lauryl Sulfate, Amorphous Sorbitol Solution, Sodium Saccharin Hydrate, Titanium Dioxide, Xanthan Gum, Sodium Carboxymethylcellulose, Polyethylene Glycol | 6.92 ± 0.02 |
| Perio Total7 Intense Repair Toothpaste (T8) | Dental-type Silica, Tocopheryl Acetate, Sodium Fluoride (1450 μg/mL), Sodium Pyrophosphate, Sodium Lauryl Sulfate, Amorphous Sorbitol Solution, Sodium Saccharin Hydrate, Zinc Stearate, Xanthan Gum, Sodium Carboxymethylcellulose, Calcium Phosphate Hydroxide, Titanated Mica, Polyethylene Glycol | 8.30 ± 0.05 |
| Clinx Tartar Care Toothpaste (T9) | Calcium Carbonate, Tocopheryl Acetate, Sodium Monofluorophosphate (1000 μg/mL), Sodium Pyrophosphate, Amorphous Sorbitol Solution, Glycerin, Sodium Carboxymethylcellulose, Xanthan Gum, Hydrated Silica, Sodium Lauryl Sulfate, Sorbitan Monooleate, Sodium Saccharin Hydrate, Xylitol, Zinc Acetate | 9.43 ± 0.19 |
| Colgate Cavity Protection Toothpaste (T10) | Sodium Fluoride, Sodium Monofluorophosphate (1450 μg/mL), Calcium Hydrogen Phosphate, Sorbitol, Sodium Lauryl Sulfate, Croscarmellose Sodium, Sodium Pyrophosphate, Sodium Saccharin | 7.64 ± 0.03 |
| Dentiste New Plus White Toothpaste (T11) | Silicon Dioxide, Glycyrrhiza uralensis Root Extract, Cinnamon Extract, Sodium Lauryl Sulfate, Krameria triandra Root, Mannitol, Menthol, Myrrh, Salvia officinalis Leaf Extract, Sorbitol, Ascorbic Acid, Eucalyptus Oil, Xylitol, Clove Oil, Chamomile Extract, Peppermint Oil, Fennel Extract | 7.01 ± 0.02 |
| Laulu Nature Original Toothpaste (T12) | Aminocaproic Acid, Aluminum Chlorohydroxy Allantoinate, Silicon Dioxide, Propolis Extract, L-Menthol, Sophora Extract, Glycerin, Honeysuckle Flower Extract, Camellia sinensis Leaf Extract, Rosemary Extract, Mastic Oil, Centella asiatica Extract, Cellulose Gum, Sorbitol Solution, Spearmint Oil, Sodium Chloride, Xylitol, Calendula Extract, Chamomile Extract, Sodium Cocoyl Glutamate, Peppermint Oil, Scutellaria baicalensis Root Extract, Enzymatically Modified Stevia, Hydroxyapatite | 7.28 ± 0.05 |
| Primer Name | Sequences (5′ to 3′) |
|---|---|
| 16 s rRNA-FP | TGTCGTGAGATGTTGGGTTAAG |
| 16 s rRNA-RP | CCACCTTCCCTCCGGTTTATTAC |
| spaP-FP | GAAGCTGCACTCAAGCAATATG |
| spaP-RP | GAGCGAGCTCTGTTTGATAGG |
| gtfB-FP | GTGTCTTCAACAGATGGTTCTTTC |
| gtfB-RP | CATCGGCTGTCCCGTATTTAT |
| gtfC-FP | GGTTACGTCTTTCCTTGCTTTATT |
| gtfC-RP | GCGGCAGTTTCAGCATTATC |
| gtfD-FP | GCTTTACAGCAACAGCGATAAG |
| gtfD-RP | GAAGTCATAGCCACCAGAAGAA |
| Toothpaste | a Inhibition Zones (mm) | Standard Deviation |
|---|---|---|
| T1 | 16.17 | 1.25 |
| T2 | 13.44 | 0.78 |
| T3 | 15.22 | 0.94 |
| T4 | 13.56 | 1.29 |
| T5 | 8.25 | 0.60 |
| T6 | 15.39 | 0.83 |
| T7 | 15.75 | 0.88 |
| T8 | 11.11 | 0.47 |
| T9 | 13.94 | 1.00 |
| T10 | 14.28 | 0.89 |
| T11 | 14.19 | 0.62 |
| T12 | N.D. | N.D. |
| C | N.D. | N.D. |
| Toothpaste | MIC (mg/mL) | MBC (mg/mL) | Standard Deviation |
|---|---|---|---|
| T1 | 0.75 | 0.83 | ±0.144 |
| T2 | 1.25 | 1.38 | ±0.144 |
| T3 | 0.75 | 0.94 | ±0.125 |
| T4 | 1 | 1 | - |
| T5 | N.D. | 1.5 | - |
| T6 | 1 | 1 | - |
| T7 | 0.75 | 0.94 | ±0.125 |
| T8 | 1 | 1.25 | ±0.144 |
| T9 | 1 | 1.06 | ±0.125 |
| T10 | 1 | 1.25 | ±0.144 |
| T11 | 1.25 | 1.35 | ±0.144 |
| T12 | N.D. | >30 | - |
| C | 0.4 | >1.5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, Y.J.; Kim, J.N. In Vitro Assessment of the Antimicrobial and Antibiofilm Activities of Commercial Toothpastes Against Streptococcus mutans. Appl. Biosci. 2025, 4, 38. https://doi.org/10.3390/applbiosci4030038
Lee YJ, Kim JN. In Vitro Assessment of the Antimicrobial and Antibiofilm Activities of Commercial Toothpastes Against Streptococcus mutans. Applied Biosciences. 2025; 4(3):38. https://doi.org/10.3390/applbiosci4030038
Chicago/Turabian StyleLee, Yun Ju, and Jeong Nam Kim. 2025. "In Vitro Assessment of the Antimicrobial and Antibiofilm Activities of Commercial Toothpastes Against Streptococcus mutans" Applied Biosciences 4, no. 3: 38. https://doi.org/10.3390/applbiosci4030038
APA StyleLee, Y. J., & Kim, J. N. (2025). In Vitro Assessment of the Antimicrobial and Antibiofilm Activities of Commercial Toothpastes Against Streptococcus mutans. Applied Biosciences, 4(3), 38. https://doi.org/10.3390/applbiosci4030038

