Next Article in Journal
Antimicrobial Resistance and Novel Alternative Approaches to Conventional Antibiotics
Previous Article in Journal
Review on Applied Applications of Microbiome on Human Lives
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Bacteria
Volume 3
Issue 3
10.3390/bacteria3030011
bacteria-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Distribution and Molecular Characterization of Clinically Relevant Acinetobacter Species from Selected Freshwater Sources in the Eastern Cape Province, South Africa

by
Mary Ayobami Adewoyin
1,2,3,*,
Adewoyin Martin Ogunmolasuyi
4 and
Anthony Ifeanyi Okoh
2,3
1
Department of Biological Sciences, Faculty of Science, Anchor University, Ayobo-Ipaja, Lagos P. M. B. 001, Nigeria
2
SAMRC Microbial Water Quality Monitoring Centre, University of Fort Hare, Private Bag X1314, Alice 5700, Eastern Cape, South Africa
3
Applied and Environmental Microbiology Research Group (AEMREG), Department of Biochemistry and Microbiology, University of Fort Hare, Private Bag X1314, Alice 5700, Eastern Cape, South Africa
4
Department of Biotechnology, School of Life Sciences, Federal University of Technology, Akure 340110, Nigeria
*
Author to whom correspondence should be addressed.
Bacteria 2024, 3(3), 160-170; https://doi.org/10.3390/bacteria3030011
Submission received: 10 May 2024 / Revised: 12 July 2024 / Accepted: 16 July 2024 / Published: 19 July 2024
Browse Figures
Versions Notes

Abstract

:
Background: Several Acinetobacter species live in different ecosystems, such as soil, freshwater, wastewater, and solid wastes, which has attracted considerable research interests in public health and agriculture. Methods: We assessed the distribution of Acinetobacter baumannii and Acinetobacter nosocomialis in three freshwater resources (Great Fish, Keiskemma, and Tyhume rivers) in South Africa between April 2017–March 2018. Molecular identification of Acinetobacter species was performed using Acinetobacter-specific primers targeting the recA gene, whilst confirmed species were further delineated into A. baumannii and A. nosocomialis. Similarly, virulence genes; afa/draBC, epsA, fimH, OmpA, PAI, sfa/focDE, and traT in the two Acinetobacter species were assessed. Results: Our finding revealed that 410 (48.58%) and 23 (2.7%) of the isolates were confirmed as A. baumannii and A. nosocomalis, respectively. Additionally, three hundred and eight (75.12%) A. baumannii and three (13.04%) A. nosocomialis exhibited one or more of the virulence genes among the seven tested. OmpA was the most prevalent virulence gene in A. baumannii in freshwater sources. Conclusions: The distribution of clinically important Acinetobacter species in the freshwater sources studied suggests possible contamination such as the release of hospital wastewater and other clinical wastes into the environment thereby posing a risk to public health.

1. Introduction

Many Acinetobacter species are free-living and ubiquitous in nature, but the clinically important species, especially the Acinetobacter calcoaceticus-baumannii (ACB) complex, are frequently isolated from hospital environments. Among members of this complex, A. baumannii, A. nosocomialis, and A. pittii are well-reported causative agents of Acinetobacter-related infections in hospitals around the globe [1,2]. However, A. baumannii is known to cause more infections, especially among the immunosuppressed individuals and those in intensive care units (ICUs) [1]. Owing to the importance of this disease-causing species in clinical settings, some scientists have reported that it is a nosocomial pathogen and its occurrence in other environments is rare [2]. However, in recent discoveries, some strains of A. baumannii have been reported to thrive in freshwater, soil, and healthy human skin just like other non-pathogenic species in the genus [3,4]. The occurrence of A. baumannii and other pathogenic species of the genus Acinetobacter in other environmental niches, apart from healthcare institutions, could be associated with the indiscriminate disposal of wastewater and materials from the hospital into the environment [5].
The isolation of A. baumannii from hospitalized patients is often associated with severe infections that are disseminated through exposure to contaminated hospital materials such as ventilators, wastewater, beds, and surrounding curtains, along with bedrails, bedside tables, water used for nasogastric feeding or ventilator rinsing, and gas taps behind the beds, in addition to door handles and sinks [6]. Additionally, A. baumannii has been implicated in a range of disease presentations, such as Acinetobacter pneumonia-bronchiolitis and tracheobronchitis [7,8], bloodstream infection [2], wound infection, urinary tract infection [9], and meningitis [7,10]. Similarly, A. nosocomialis was responsible for bacteraemia [11,12], pneumonia [13], and the induction of epithelial cell death and host inflammatory responses [14].
The pathogenicity of Acinetobacter species like other microorganisms is strongly associated with the virulence factors they harbour, such as porins (OmpA), capsular polysaccharides, lipopolysaccharides (LPS), phospholipase, outer membrane vesicles (OMVs), protein secretion systems, and the metal acquisition system [6,7]. OmpA is a protein located on the outer cell membrane of the bacteria, which is responsible for the selective permeation of materials in and out of the cell. OmpA also binds to the host epithelial cell in order to gain entry into the cell cytoplasmic environment. As such, it may be relevant in leading to programmed cell death (apoptosis) by releasing cytochrome c. OmpA was also noted as one of the factors with which A. nosocomialis initiates its pathogenesis [15]. Pathogenic Gram-negative bacteria are known to secret OMVs [16,17] for interaction between the bacterial pathogens and the host cells [18]. Kim et al. [15] showed that A. nosocomialis uses its OMVs for the secretion of cytotoxic factors with which it elicits an immune response from the host epithelial cell. Phospholipase also contributes to the virulence of the pathogenic Acinetobacter species by hydrolysing phospholipid bilayer of the host cell membrane to destabilize the entire cell [19].
Thus, an investigation of the occurrence and distribution of these clinically important Acinetobacter species in other environments, other than the hospital, is very necessary for the understanding of their nature and diversity [20]. Therefore, the focus of this study was to assess the occurrence, distribution, and the virulence factors of clinically important Acinetobacter species such as A. baumannii and A. nosocomialis in the selected freshwater sources in the Eastern Cape Province, South Africa, to redefine the environmental coverage of these pathogens beyond clinical settings

2. Materials and Methods

2.1. Description of Study Areas

Collection of water samples was carried out from three rivers, namely, Great Fish, Keiskamma and Tyhume, in the Eastern Cape Province, South Africa, between April 2017 and March 2018. The Great Fish River is in the Chris Hani District Municipality in the Eastern Cape Province, and it is one of the major rivers used for irrigation and livestock farming in the area. This river is prone to agricultural and municipal runoffs and serves as the receiving stream of effluents from many wastewater treatment plants (WWTPs), especially those situated in urban communities such as Craddock. The Keiskamma and Tyhume rivers are in the Amathole District Municipality in the Eastern Cape Province and are exposed to different anthropogenic activities from the rural and urban communities along the river courses, such as livestock drinking and irrigation farming. In addition, these rivers receive effluents from wastewater treatment plants (WWTPs) situated close to their banks. Different sampling points on these rivers were selected based on where humans and animals come into direct contact with them, for example, points used for fishing, drinking, and swimming purposes, downstream of the WWTPs, points where irrigation water is released to the water bodies, and proximity to hospital facilities.

2.2. Sampling

Water samples were collected from the Great Fish, Keiskamma and Tyhume rivers respectively, for a period of one year, which covers the four seasonal patterns in South Africa (autumn, winter, spring, and summer). Water samples were collected aseptically in sterile 1 L glass bottles from different sampling points by midstream-dipping of sample bottles at 25–30 cm down the water column, with the mouth tilting against the flow of the river. All water samples were labelled properly and safely taken to the laboratory (in an ice chest) where they were processed within 6 h of collection [21]. Aliquots of water samples were used for the isolation of Acinetobacter species based on standard microbiological procedures [22].

2.3. Isolation and Purification of Presumptive Acinetobacter Species

The isolation of the presumptive density of Acinetobacter species in the water samples was determined by the membrane filtration technique [23]. Cellulose membranes of pore size 0.45 μm were used to filter three volumes of 100 mL of the water samples under vacuum [23]. These membranes were aseptically placed on plates with Acinetobacter species selective medium-CHROMagar Acinetobacter base plus supplement AC092 (CHROMagar, Paris, France), which was prepared according to the manufacturer’s instructions. Each sample plate was subjected to incubation at 37 °C for 24 h after inoculation. Each sample was analysed in triplicate. All bacterial colonies with red colouration on the CHROMagar plates were counted as presumptive Acinetobacter species and were expressed as CFU/100 mL. All isolates were sub-cultured on nutrient agar using a streak plate method (Oxoid, Hampshire, UK) and purified for further species identification. Fifty percent (50%) glycerol stocks of the pure culture was prepared and stored at −80 °C.

2.4. Molecular Identification of Acinetobacter Species by PCR Assays

Extraction of genomic DNA: Presumptive Acinetobacter spp. in glycerol stocks was resuscitated on tryptic soy broth and incubated for 18 to 24 h at 37 °C. DNA extraction from the bacterial isolates was carried out using the direct boiling method according to [24]. The broth culture was centrifuged at 15,000 rpm for 5 min using a Mini Spin Microcentrifuge (Lasec, RSA, Cape Town, South Africa), then the supernatant was dispensed out and the pellet rinsed with sterile normal saline. The pellet was re-suspended in sterile distilled water and boiled in a heating block for 10 min using an AccuBlock (Digital dry bath, Labnet, Edison, NJ, USA).

2.5. Amplification of Unique Acinetobacter Species DNA

The polymerase chain reaction (PCR) assay was used for the amplification of the Acinetobacter species recA gene as previously described [25]. The forward and reverse primers used were P-rA1 (5′-CCTGAATCTTCTGGTAAAAC-3′) and P-rA2 (5′-GTTTCTGGGCTGCCAAACATTAC-3′), respectively. Briefly, an aliquot of 25 μL containing Taq PCR (12.5 μL) Master Mix (Qiagen, Hilden, Germany), each of the primers (1 μL) (Inqaba, SA), nuclease-free water (6.5 μL), and DNA template (5 μL) was used for the PCR amplification assay. The condition for the amplification included the initial denaturation step (94 °C, 5 min), followed by 35 cycles (92 °C, 40 s), annealing (58 °C, 40 s), and the final extension step (72 °C, 10 min) was performed using a thermocycler (Bio-Rad Thermal cycler, Hercules, CA, USA). Five microlitres (5 μL) of the amplicon was subjected to gel (1.5% agarose) electrophoresis at 100 volts for 45 min in Tris Boric EDTA buffer (pH 8.0) (0.089 M Tris, 0.089 M boric acid, and 0.002 M EDTA). Ethidium bromide (5 μL of 0.5 mg/mL) (Sigma-Aldrich, St. Louis, MO, USA) was used for gel staining, and DNA ladder (100 bp) (Thermo Scientific, Vilnius, (EU) Lithuania) was added into the gels as a standard. Finally, the DNA bands were visualized under an Alliance 4.7 ultraviolet transilluminator (Alliance XD-79.WL/26MX, Paris, France).

2.6. Delineation of Genus Acinetobacter into Species

The confirmed Acinetobacter isolates were delineated into species accordingly [25,26,27] using a PCR assay. Firstly, the optimization of conditions for A. baumannii, A. nosocomialis, and A. pittii was carried out using species-specific primers (Table 1), while reference strains DSM 102929, DSM-102856, and DSM-9341 (DSMZ, Braunschweig, Germany) were used as positive controls for A. baumannii, A. nosocomialis, and A. pittii, respectively. The PCR amplification was performed as stated in the previous section.

2.7. Detection of Virulence Genes

Polymerase chain reactions were also carried out for the identification of some Acinetobacter virulence genes, including the afa/draBC, epsA, fimH, OmpA, PAI, sfa/focDE, and traT genes, which have been previously found in clinical samples [28,29,30] (Table 2). The standard strain of A. baumannii DSM-30007 (DSMZ, Germany) was used as a positive control. There was no positive control available for A. nosocomialis. The PCR assay and electrophoresis were conducted as described earlier.

2.8. Statistical Analysis

All statistical analyses were performed using the Statistica software v13.4.0.14 (64-bits). A simple factorial ANOVA was performed for the comparison of normally distributed data. p-Values of less than 0.05 were considered statistically significant for all the statistical tests performed.

3. Results

3.1. Isolation of Presumptive Acinetobacter Species

A total of 1107 presumptive Acinetobacter spp. was recovered from the three rivers studied, of which 370, 309, and 428 isolates belonged to Great Fish, Keiskamma, and Tyhume respectively. The results of the isolates are summarized and presented in Table 3.

3.2. PCR Amplification for Confirmation of Genus Acinetobacter

To further validate the distribution of the bacteria in the genus Acinetobacter in this study, the identification was achieved by using the PCR-based assay to detect internal recA genes that are specific to all Acinetobacter species (Figure 1). The result in Figure S1 represents the PCR product of the gel electrophoresis and staining for the amplification of the 425 bp fragment, which corresponds to the recA gene. Out of the 107 presumptive isolates, 844 was identified and confirmed to belong to the genus Acinetobacter, of which 285 (77%), 219 (70.9%), and 340 (79%) were found in the Great Fish, Keiskamma, and Tyhume rivers respectively (Table 3).

3.3. Delineation of the Acinetobacter spp. into Species

The speciation of the genus Acinetobacter was also performed using PCR assay to amplify the A. baumannii specific primer, Ab-ITS gene, and A. nosocomailis specific primer, gyrB gene, at 208 bp and 294 bp fragments corresponding to the genes, respectively. The result in Figures S2 and S3 shows the PCR product of the gel electrophoresis and staining for the delineation of the genus Acinetobacter into A. baumannii and A. nosocomailis accordingly. From the results, 411 (48.7%) and 23 (2.7%) of the isolates were delineated to be A. baumannii and A. nosocomailis, which were recovered from the Great Fish (154 (54%), 16 (5.6%), Keiskamma (102 (46.6%), and 3 (1.4%), and Tyhume 155 (48.7%), and 4 (1.2%)) rivers, respectively. The results of the delineation into A. baumannii and A. nosocomailis are summarized and presented in Table 3.

3.4. Detection of Virulence Genes

The gel electrophoresis of the virulence genes afa/draBC, epsA, fimH, OmpA, PAI, sfa/focDE, and traT are presented in Figure S4. The virulence genes haboured by A. baumannii and A. nosocomialis in this study are presented in Figure 2 and summarized in Table 4. Additionally, the virulence gene(s) associated with each of the Acinetobacter species, as well as the river source from which they were isolated, is described.
Three hundred and eight (75%) of the 410 A. baumannii and three (13%) of the 23 A. nosocomialis isolated from the rivers exhibited one or more virulence genes out of the seven tested. Respectively, 102 (24.88%) and 20 (86.95%) of the A. baumannii and A. nosocomialis isolates from the three rivers did not harbour any of the virulence genes tested in this study. However, there was a significant difference (p < 0.05) in the prevalence of virulence genes harboured by A. baumannii compared to A. nosocomialis, though the population of the former was significantly higher than the latter in all cases.
As shown in Table 4, the prevalence of the virulence gene afa/draBC was significantly higher in the isolates from the Great Fish river in comparison to the Keiskamma and Tyhume rivers. However, there was a significant difference in prevalence between the afa/draBC genes haboured by the bacteria recovered from the Tyhume river when compared to those from the Keiskamma river. Likewise, the prevalence of the traT gene in the Acinetobacter species from the Great Fish and Tyhume rivers showed no statistical difference, but both were significantly higher than those detected in isolates from the Keiskamma river. Similarly, the prevalence of the fimH gene detected in isolates recovered from the Great Fish river was significantly higher than those detected in isolates from both the Keiskamma and Tyhume rivers. Nonetheless, the proportion of isolates harbouring the gene in Keiskamma was significantly lower than those from Tyhume river. The prevalence of the PAI virulence gene was not significantly different in all the rivers studied. In Great Fish and Keiskamma rivers, there was no significant difference in the prevalence of sfa/focDE in isolates recovered from the rivers, but the proportion of Acinetobacter species in Tyhume harbouring the gene was significantly higher than in those from both the Great Fish and Keiskamma rivers. The number of Acinetobacter species harbouring the epsA virulence gene in the Great Fish river was significantly higher than those recovered from the Keiskamma river but significantly lower than in Acinetobacter species recovered from the Tyhume river. The prevalence of the OmpA virulence gene was significantly higher in A. baumannii isolates than in all other virulence genes in this study. Withal, OmpA was the most prevalent virulence gene in the rivers, which represented 69 (45.10%), 52 (50.98%), and 77 (49.68%) A. baumannii isolates in the Great Fish, Keiskamma, and Tyhume rivers, respectively. The number of Acienotobacter species harbouring OmpA gene in the Great Fish river was significantly higher than isolates from the Keiskamma river, whereas the Tyhume river maintained the highest level of statistical significance (p < 0.05) of the total Acinetobacter species exhibiting the virulence gene.

4. Discussion

Bacteria in the genus Acinetobacter have been known to colonize a wide range of ecological systems, including water, soil, sludge, wastewater, plants’ root, and animals, using virulence factors as well as the formation of biofilms to adapt and survive in harsh environments [31]. This current study has revealed the distribution and virulence traits of A. baumannii and A. nosocomialis in water samples collected from three selected rivers in the Eastern Cape Province, South Africa. However, a few studies have reported similar cases in freshwater sources. In 2016, Maravic et al. [21] carried out a study in Croatia where an assessment of the microbial community in the urban riverine environment revealed 57 bacterial isolates belonging to the genus Acinetobacter [21] Likewise, Krizova et al. [32] showed a widespread distribution of A. bohemicus in the water environment in the Czech Republic, whilst A. baumannii was characterized from a surface water resource in the South Nation River (SNR) drainage basin in Eastern Ontario, Canada [20] and in the freshwater aquaculture environment in China [33]. These reports across different geography indicated that Acinetobacter species, including A. baumannii, can survive in freshwater sources.
Presumptive Acinetobacter species (1107) recovered from three rivers in this study were further validated using molecular biology techniques targeting the specific recA gene (425 bp) of the Acinetobacter genus [25]. PCR amplification assays based on the recA gene-specific primer identified 844 Acinetobacter species, while gyrB gene species-specific primers were employed to delineate them into species, namely, A. baumannii (410 isolates) and A. nosocomialis (23 isolates). Targeting both genes (recA and gyrB) to identify and delineate Acinetobacter species, respectively, was previously certified at 98.2% specificity and 92.4% sensitivity [25] and was commonly employed for the analysis of Acinetobacter species. It has been applied for the analysis of A. baumannii, A. nosocomialis, and A. pittii [34], known for multiple antibiotic resistant infections [2,25] in immune-compromised patients [2] and blood infection in a tertiary-care hospital [35]. However, there are a few reports on the occurrence of A. baumannii and A. nosocomialis in the aquatic environment [3,4], and this is perhaps due to the indiscriminate disposal of biomedical wastes into the environment and likely contamination of freshwater bodies. This portends a great risk to public health and among those living in the area and using water from these rivers for domestic and other purposes.
The delineation of these pathogens into species gave room for additional analysis that is the determination of virulence traits. Therefore, virulence traits (afa/draBC, epsA, fimH, OmpA, PAI, sfa/focDE, and traT) that could be detected in A. baumannii and A. nosocomialis of clinical origin were investigated in the isolates from freshwater sources. Virulence genes are mechanisms by which bacteria initiate pathogenesis [36,37], especially in clinical settings. Pathogenesis and resistance to both antibiotics and harsh environments in nosocomial A. baumannii and A. nosocomialis isolates have been linked to virulence factors [36]. The assessment of these environmental isolates (A. baumannii and A. nosocomialis) for virulence genes using PCR assays revealed that both pathogens possessed certain numbers of the virulence factors (Table 4). Of the virulence factors considered in this study, the OmpA gene was predominantly exhibited by A. baumannii isolates in all the rivers sampled. Likewise, the fimH and epsA genes were detected in many of the isolates, but the afa/draBC, PAI, Sfa/focDE, and traT genes were detected in a few of the isolates. Comparably, the exhibition of virulence genes varies from one isolate to the other across the three rivers, which was also reported among clinical isolates known for nosocomial infections [38]. The OmpA gene is the main outer membrane protein (OMP) located on the A. baumannii membrane [39], which validates the findings of this current study that the virulence profiles of an individual isolate varied greatly and the OmpA gene was mostly detected [36].
Generally, the outer membranes of Gram-negative bacteria are made up of the OMPs, lipopolysaccharides, and phospholipid layers [37]. Studies have shown that A. baumannii uses OmpA for adhesion to the lung epithelial cell by interacting with a cell cytoskeleton such as fibronectin on the cell surface and thereby inducing pneumonia [40]. It also causes cell death through caspase-3 activation [41]. Similarly, A. baumannii could be responsible for apoptosis through the translocation of its OmpA into the mitochondria and nucleus of host cells [42]. The combination of the roles played by OmpA makes it an important virulence factor in the pathogenesis of A. baumannii infection. Moreover, antibiotic resistance in A. baumannii is also associated with OmpA [43]. It was suggested that OmpA was involved in the removal of antibiotics from the periplasmic space membrane efflux systems [43]. The survival and persistence of A. baumannii in the cell are enhanced by OmpA due to the formation of biofilms and surface motility. Therefore, the presence of the OmpA gene in A. baumanni isolates from freshwater sources is of a major concern based on its role in bacterial pathogenesis.

5. Conclusions

Three selected freshwater sources in the Eastern Cape Province, South Africa, were evaluated for the distribution and virulence gene fingerprints of clinically relevant Acinetobacter species, namely, A. baumannii and A. nosocomialis. OmpA was the most prevalent virulence gene detected in the Acinetobacter species in all three rivers studied, followed by the fimH and epsA genes, whereas the PAI and Sfa/focDE genes were the least exhibited, respectively. Furthermore, the number of Acinetobacter species habouring the highest percentage of virulence genes was isolated from the Tyhume River followed by the Great Fish River, while Kieskamma River harboured the least. However, whilst previous reports have details on the virulence genes in A. baumannii of clinical origin, such reports on A. baumannii from freshwater sources are limited. This study suggests that the aquatic environment is an important reservoir for pathogenic Acinetobacter species, similar to the hospital. As such, the identification of these opportunistic pathogens in freshwater sources requires public awareness and recognition as important to public health risks.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/bacteria3030011/s1, Figure S1. PCR analyses resolved by gel electrophoresis showing confirmed Acinetobacter spp. targeting the recA gene at 425 bp. L = DNA Ladder (100 bp); Lane 2 to 9 = Selected Acinetobacter isolates; N = Negative control; P = Positive control (A. baumannii, DSM Number: 102929). Figure S2. PCR analyses resolved by gel electrophoresis showing confirmed A. baumannii targeting the specific primer Ab-ITS gene at 208 bp. L = DNA Ladder (100 bp); N = negative control, P = positive control (A. baumannii, DSM 102929); Lanes 1 to 8 = selected A. baumannii samples. Figure S3. PCR analyses resolved by gel electrophoresis showing confirmed A. nosocomialis targeting the gyrB gene at 294 bp. L = DNA Ladder (100 bp); P = Positive control (A. nosocomialis, DSM 102856); Lanes 1 to 10 = Selected A. nosocomialis samples. Figure S4. PCR analyses resolved by gel electrophoresis showing confirmed virulence genes OmpA, PAI, fimH, sfa/focDE, espA and traT at 531, 930, 506, 410, 451 and 290 base pairs respectively. L = DNA Ladder (100 bp); Lane 1 to 9 (overall) = Selected Acinetobacter isolates; N = Negative control; P = Positive control (A. baumannii, DSM Number: 102929).

Author Contributions

Conceptualization, M.A.A. and A.I.O.; methodology, M.A.A.; validation, M.A.A., A.M.O. and A.I.O.; formal analysis, M.A.A., A.M.O. and A.I.O.; investigation, M.A.A.; resources, M.A.A. and A.I.O.; data curation, M.A.A. and A.M.O.; writing—original draft preparation, M.A.A. and A.M.O.; writing—review and editing, M.A.A., A.M.O. and A.I.O.; visualization, M.A.A., A.M.O. and A.I.O.; supervision, A.I.O.; project administration, A.I.O.; funding acquisition, M.A.A. and A.I.O. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the South African Medical Research Council (UFH/P790), National Research Foundation (NRF), South Africa/The World Academy of Science (TWAS), Italy (Grant Numbers: 99767 and 116387).

Institutional Review Board Statement

The conducted research is not related to either human or animal use.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data used are available on request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. De Vos, D.; Jean-Paul, P.; Florence, B.; Serge, J.; Gilbert, V.; Thomas, R.; Elkana, K.; Petra, B.; Thierry, P.; Mony, H.; et al. Molecular Epidemiology and Clinical Impact of Acinetobacter calcoaceticus-baumannii complex in a Belgian Burn Wound Center. PLoS ONE 2016, 11, e0156237. [Google Scholar] [CrossRef] [PubMed]
  2. Peleg, A.Y.; Seifert, H.; Paterson, D.L. Acinetobacter baumannii: Emergence of a Successful Pathogen. Clin. Microbiol. Rev. 2008, 21, 538–582. [Google Scholar] [CrossRef] [PubMed]
  3. Adewoyin, M.A.; Okoh, A.I. The natural environment as a reservoir of pathogenic and non-pathogenic Acinetobacter species. Rev. Environ. Health 2018, 33, 265–272. [Google Scholar] [CrossRef] [PubMed]
  4. Goswami, R.; Mukherjee, S.; Rana, V.S.; Saha, D.R.; Raman, R.; Padhy, P.K.; Mazumder, S. Isolation and characterization of arsenic-resistant bacteria from contaminated waterbodies in West Bengal, India. Geomicrobiol. J. 2015, 32, 17–26. [Google Scholar] [CrossRef]
  5. Hrenovic, J.; Durn, G.; Goic-Barisic, I.; Kovacic, A. Occurrence of an Environmental Acinetobacter baumannii Strain Similar to a Clinical Isolate in Paleosol from Croatia. Appl. Environ. Microbiol. 2014, 80, 2860–2866. [Google Scholar] [CrossRef] [PubMed]
  6. Kanafani, A.Z.; Kanj, S.S. Ministry of Health, Kingdome of Saudi Arabia. 2014. Available online: http://www.uptodate.com/contents/acinetobacter-infection-treatment-and-prevention (accessed on 19 June 2018).
  7. Doughari, H.J.; Ndakidemi, P.A.; Human, I.S.; Benade, S. The Ecology, Biology and Pathogenesis of Acinetobacter spp.: An Overview. Microbes Environ. 2011, 26, 101–112. [Google Scholar] [CrossRef] [PubMed]
  8. Whitman, T.J.; Qasba, S.S.; Timpone, J.G.; Babel, B.S.; Kasper, M.R.; English, J.F.; Sanders, J.W.; Hujer, K.M.; Hujer, A.M.; Endimiani, A. Occupational transmission of Acinetobacter baumannii from a United States serviceman wounded in Iraq to a health care worker. Infect. Dis. 2008, 47, 439–443. [Google Scholar]
  9. Falagas, M.E.; Vardakas, K.Z.; Kapaskelis, A.; Triarides, N.A.; Roussos, N.S. Tetracyclines for multidrugresistant Acinetobacter baumannii. Int. J. Antimicrob. Agents 2015, 45, 455–460. [Google Scholar] [CrossRef] [PubMed]
  10. Basri, R.; Zueter, A.R.; Mohamed, Z.; Alam, M.K.; Norsa’Adah, B.; Hasan, S.A.; Hasan, H.; Ahmad, F. Burden of bacterial meningitis: A retrospective review on laboratory parameters and factors associated with death in meningitis, Kelantan Malaysia. Nagoya J. Med. Sci. 2015, 77, 59–68. [Google Scholar]
  11. Lai, H.H.; Liou, B.H.; Chang, Y.Y.; Kuo, S.C.; Lee, Y.T.; Chen, T.L.; Fung, C.P. Risk factors and clinical outcome of sulbactam non-susceptibility in monomicrobial Acinetobacter nosocomialis. J. Microbiol. Immunol. Infect. 2016, 49, 371–377. [Google Scholar] [CrossRef]
  12. Liu, Y.-M.; Lee, Y.-T.; Kuo, S.-C.; Chen, T.-L.; Liu, C.-P.; Liu, C.-E. Comparison between bacteremia caused by Acinetobacter pittii and Acinetobacter nosocomialis. J. Microbiol. Immunol. Infect. 2017, 50, 62–67. [Google Scholar] [CrossRef]
  13. Lee, Y.-T.; Kuo, S.-C.; Yang, S.-P.; Lin, Y.-T.; Chiang, D.-H.; Tseng, F.-C.; Chen, T.-L.; Fung, C.-P. Bacteremic nosocomial pneumonia caused by Acinetobacter baumannii and Acinetobacter nosocomialis: A single or two distinct clinical entities. Eur. Soc. Clin. Microbiol. Infect. Dis. CMI 2013, 19, 640–645. [Google Scholar] [CrossRef] [PubMed]
  14. Nho, J.S.; Jun, S.H.; Oh, M.H.; Park, T.I.; Choi, C.W.; Kim, S.I.; Choi, C.H.; Lee, J.C. Acinetobacter nosocomialis secretes outer membrane vesicles that induce epithelial cell death and host inflammatory responses. Microb. Pathog. 2015, 81, 39–45. [Google Scholar] [CrossRef] [PubMed]
  15. Kim, S.W.; Oh, M.H.; Jun, S.H.; Jeon, H.; Kim, S.I.; Kim, K.; Lee, Y.C.; Lee, J.C. Outer membrane Protein A plays a role in pathogenesis of Acinetobacter nosocomialis. Virulence 2016, 7, 413–426. [Google Scholar] [CrossRef]
  16. Ellis, T.N.; Kuehn, M.J. Virulence and Immunomodulatory Roles of Bacterial Outer Membrane Vesicles. Microbiol. Mol. Biol. Rev. 2010, 74, 81–94. [Google Scholar] [CrossRef]
  17. Kwon, S.O.; Gho, Y.S.; Lee, J.C.; Kim, S.I. Proteome analysis of outer membrane vesicles from a clinical Acinetobacter baumannii isolate. FEMS Microbiol. Lett. 2009, 297, 150–156. [Google Scholar] [CrossRef]
  18. Jun, S.H.; Lee, J.H.; Kim, B.R.; Kim, S.I.; Park, T.I.; Lee, J.C.; Lee, Y.C. Acinetobacter baumannii Outer Membrane Vesicles Elicit a Potent Innate Immune Response via Membrane Proteins. PLoS ONE 2013, 8, e71751. [Google Scholar] [CrossRef]
  19. Fiester, S.E.; Arivett, B.A.; Schmidt, R.E.; Beckett, A.C.; Ticak, T.; Carrier, M.V.; Ghosh, R.; Ohneck, E.J.; Metz, M.L.; Jeffries, M.K.S.; et al. Iron-Regulated Phospholipase C Activity Contributes to the Cytolytic Activity and Virulence of Acinetobacter baumannii. PLoS ONE 2016, 11, e0167068. [Google Scholar] [CrossRef] [PubMed]
  20. Diancourt, L.; Passet, V.; Nemec, A.; Dijkshoorn, L.; Brisse, S. The Population Structure of Acinetobacter baumannii: Expanding Multiresistant Clones from an Ancestral Susceptible Genetic Pool. PLoS ONE 2010, 5, e10034. [Google Scholar] [CrossRef]
  21. Maravic, A.; Skocibusic, M.; Fredotovic, Z.; Samanic, I.; Cvjetan, S.; Knezovic, M.; Puizina, J. Urban riverine environment is a source of multidrug-resistant and ESBL-producing clinically important Acinetobacter spp. Environ. Sci. Pollut. Res. 2016, 23, 3525–3535. [Google Scholar] [CrossRef]
  22. Sibanda, T.; Chigor, V.N.; Koba, S.; Obi, C.L.; Okoh, A.I. Characterisation of the physicochemical qualities of a typical rural-based river: Ecological and public health implications. Int. J. Environ. Sci. Technol. 2013, 11, 1771–1780. [Google Scholar] [CrossRef]
  23. American Public Health Association, APHA. Standard Methods for the Examination of Water and Wastewater, 20th ed.; APHA: Washington, DC, USA, 2005. [Google Scholar]
  24. Maugeri, T.L.; Carbone, M.; Fera, M.T.; Gugliandolo, C. Detection and differentiation of Vibrio vulnificus in seawater and plankton f a coastal zone of the Mediterranean Sea. Res. Microbiol. 2006, 157, 194–200. [Google Scholar] [CrossRef] [PubMed]
  25. Chen, T.L.; Lee, Y.T.; Kuo, S.C.; Yang, S.P.; Fung, C.P.; Lee, S.D. Rapid identification of Acinetobacter baumannii, Acinetobacter nosocomialis and Acinetobacter pittii with a multiplex PCR assay. J. Med. Microbiol. 2014, 63, 1154–1159. [Google Scholar] [CrossRef] [PubMed]
  26. Chen, T.L.; Siu, L.K.; Wu, R.C.C.; Shaio, M.F.; Huang, L.Y.; Fung, C.P.; Lee, C.M.; Cho, W.L. Comparison of one-tube multiplex PCR, automated ribotyping and intergenic spacer (ITS) sequencing for rapid identification of Acinetobacter baumannii. Clin. Microbiol. Infect. 2007, 13, 801–806. [Google Scholar] [CrossRef] [PubMed]
  27. Higgins, P.; Wisplinghoff, H.; Krut, O.; Seifert, H. A PCR-based method to differentiate between Acinetobacter baumannii and Acinetobacter genomic species 13TU. Clin. Microbiol. Infect. 2007, 13, 1199–1201. [Google Scholar] [CrossRef] [PubMed]
  28. Thummeepak, R.; Kongthai, P.; Leungtongkam, U.; Sitthisak, S. Distribution of virulence genes involved in biofilm formation in multi-drug resistant Acinetobacter baumannii clinical isolates. Int. Microbiol. 2016, 19, 121–129. [Google Scholar] [CrossRef] [PubMed]
  29. Momtaz, H.; Seifati, S.M.; Tavakol, M. Determining the prevalence and detection of the most prevalent virulence genes in Acinetobacter baumannii isolated from hospital infections. Int. J. Med. Lab. 2015, 2, 87–97. [Google Scholar]
  30. Braun, G.; Vidotto, M.C. Evaluation of adherence, hemagglutination, and presence of genes codifying for virulence factors of Acinetobacter baumannii causing urinary tract infection. Mem. Inst. Oswaldo Cruz 2004, 99, 839–844. [Google Scholar] [CrossRef] [PubMed]
  31. Huang, W.; Yao, Y.; Wang, S.; Xia, Y.; Yang, X.; Long, Q.; Sun, W.; Liu, C.; Li, Y.; Chu, X.; et al. Immunization with a 22-kDa outer membrane protein elicits 116 protective immunity to multidrug-resistant Acinetobacter baumannii. Sci. Rep. 2016, 6, 20724. [Google Scholar] [CrossRef]
  32. Krizova, L.; Maixnerovaa, M.; Sedob, O.; Nemec, A. Acinetobacter bohemicus sp. nov. widespread in natural soil and water ecosystems in the Czech Republic. Syst. Appl. Microbiol. 2014, 37, 467–473. [Google Scholar] [CrossRef]
  33. Xiong, W.; Sun, Y.; Zhang, T.; Ding, X.; Li, Y.; Wang, M.; Zeng, Z. Antibiotics, Antibiotic Resistance Genes, and Bacterial Commu-nity Composition in Fresh Water Aquaculture Environment in China. Microb. Ecol. 2015, 70, 425–432. [Google Scholar] [CrossRef] [PubMed]
  34. Chiang, M.C.; Kuo, S.C.; Chen, Y.C.; Lee, Y.T.; Chen, T.L.; Fung, C.P. Polymerase chain reaction assay for the detection of Acinetobacter baumannii in endotracheal aspirates from patients in the intensive care unit. J. Microbiol. Immunol. Infect. 2011, 44, 106–110. [Google Scholar] [CrossRef]
  35. Park, Y.K.; Jung, S.-I.; Park, K.-H.; Kim, D.H.; Choi, J.Y.; Kim, S.H.; Ko, K.S. Changes in antimicrobial susceptibility and major clones of Acinetobacter calcoaceticus–baumannii complex isolates from a single hospital in Korea over 7 years. J. Med. Microbiol. 2012, 61, 71–79. [Google Scholar] [CrossRef]
  36. Ambrosi, C.; Scribano, D.; Aleandri, M.; Zagaglia, C.; Di Francesco, L.; Putignani, L.; Palamara, A.T. Acinetobacter baumannii Virulence Traits: A Comparative Study of a Novel Sequence Type with Other Italian Endemic International Clones. Front. Microbiol. 2017, 8, 1977. [Google Scholar] [CrossRef] [PubMed]
  37. Sato, Y.; Unno, Y.; Kawakami, S.; Ubagai, T.; Ono, Y. Virulence characteristics of Acinetobacter baumannii clinical isolates vary with the expression levels of omps. J. Med. Microbiol. 2017, 66, 203–212. [Google Scholar] [CrossRef] [PubMed]
  38. Antunes, L.C.S.; Imperi, F.; Carattoli, A.; Visca, P. Deciphering the Multifactorial Nature of Acinetobacter baumannii Pathogeniity. PLoS ONE 2011, 6, e22674. [Google Scholar] [CrossRef]
  39. Smith, M.G.; Gianoulis, T.A.; Pukatzki, S.; Mekalanos, J.J.; Ornston, L.N.; Gerstein, M.; Snyder, M. New insights into Acinetobacter baumannii pathogenesis revealed by high-density pyrosequencing and transposon mutagenesis. Genes Dev. 2007, 21, 601–614. [Google Scholar] [CrossRef]
  40. Smani, Y.; Dominguez-Herrera, J.; Pachón, J. Association of the Outer Membrane Protein Omp33 with Fitness and Virulence of Acinetobacter baumannii. J. Infect. Dis. 2013, 208, 1561–1570. [Google Scholar] [CrossRef]
  41. Smani, Y.; Domínguez-Herrera, J.; Pachón, J. Rifampin Protects Human Lung Epithelial Cells against Cytotoxicity Induced by Clinical Multi and Pandrug-resistant Acinetobacter baumannii. J. Infect. Dis. 2011, 203, 1110–1119. [Google Scholar] [CrossRef]
  42. Lee, J.S.; Choi, C.H.; Kim, J.W.; Lee, J.C. Acinetobacter baumannii outer membrane protein a induces dendritic cell death through mitochondrial targeting. J. Microbiol. 2010, 48, 387–392. [Google Scholar] [CrossRef]
  43. Smani, Y.; Fàbrega, A.; Roca, I.; Sánchez-Encinales, V.; Vila, J.; Pachón, J. Role of OmpA in the Multidrug Resistance Phenotype of Acinetobacter baumannii. Antimicrob. Agents Chemother. 2014, 58, 1806–1808. [Google Scholar] [CrossRef] [PubMed]
Bacteria 03 00011 g001
Figure 1. Illustration of sampling and laboratory experiments. Water samples were collected from three rivers and transferred to the laboratory for analysis. Bacterial culture and extraction of DNA, as well as PCR amplification and gel electrophoresis, were carried out as stated.
Figure 1. Illustration of sampling and laboratory experiments. Water samples were collected from three rivers and transferred to the laboratory for analysis. Bacterial culture and extraction of DNA, as well as PCR amplification and gel electrophoresis, were carried out as stated.
Bacteria 03 00011 g001
Bacteria 03 00011 g002
Figure 2. Confirmed virulence genes in the Acinetobacter species recovered from each of the rivers.
Figure 2. Confirmed virulence genes in the Acinetobacter species recovered from each of the rivers.
Bacteria 03 00011 g002
Table 1. Primers for delineation of Acinetobacter species.
Table 1. Primers for delineation of Acinetobacter species.
Target GenePrimer NamePrimer Sequence (5′-3′)bpAcinetobacter spp.References
gyrBP-Ab-ITSF; P-Ab-ITSRCATTATCACGGTAATTAGTG
AGAGCACTGTGCACTTAAG		208A. baumannii[25]
gyrBsp4F; sp4RCACGCCGTAAGAGTGCATTA
AACGGAGCTTGTCAGGGTTA		294A. nosocomialis[27]
Table 2. PCR primers for the determination of virulence genes in Acinetobacter isolates.
Table 2. PCR primers for the determination of virulence genes in Acinetobacter isolates.
GeneVirulence FactorPrimer SequencesAmplicon SizeTm (°C)Reference
afa/draBCDr fimbriaeGCTGGGCAGCAAACTGATAACTCTC CATCAAGCTGTTTGTTCGTCCGCCG75063[30]
epsAExo-polysaccharideAGCAAGTGGTTATCCAATCG ACCAGACTCACCCATTACAT45150[28]
fimHType 1 fimbriaeTGCAGAACGGATAAGCCGTGG GCAGTCACCTGCCCTCCGGTA50863[30]
OmpAOuter membrane proteinCGCTTCTGCTGGTGCTGAAT CGTGCAGTAGCGTTAGGGTA53150[28]
PAIPathogenicity-associated islandGGACATCCTGTTACAGCGCGCA TCGCCACCAATCACAGCCGAAC93050[30]
Sfa/focDES fimbriaeCTCCGGAGAACTGGGTGCATCTTAC CGGAGGAGTAATTACAAACCTGGCA41063[30]
traTSerum resistanceGGTGTGGTGCGATGAGCACAG CACGGTTCAGCCATCCCTGAG29063[30]
Table 3. Summary of the relative abundance of the Acinetobacter genus and two clinically important species in the freshwater studied.
Table 3. Summary of the relative abundance of the Acinetobacter genus and two clinically important species in the freshwater studied.
Water Sample SourcesTotal Number of Presumptive Acinetobacter IsolatesAcinetobacter GenusA. baumanniiA. nosocomialis
Great Fish370285 (77%)154 (54%)16 (5.6%)
Keiskamma309219 (70.9%)102 (46.6%)3 (1.4%)
Tyhume428340 (79%)155 (45.6%)4 (1.2%)
Total1107844 (76%)411 (48.7%)23 (2.7%)
Table 4. Result of virulence gene factors of A. baumannii and A. nosocomialis isolates in addition to the river they belong to.
Table 4. Result of virulence gene factors of A. baumannii and A. nosocomialis isolates in addition to the river they belong to.
Virulence GeneSampled Rivers
Great FishKieskammaTyhume
A. baumannii
(n = 153)		A. nosocomialis
(n = 16)		A. baumannii
(n = 102)		A. nosocomialis
(n = 3)		A. baumannii
(n = 155)		A. nosocomialis
(n = 4)
Afa/draBC16 (10.46%)-4 (3.92%)-8 (5.81)1 (25.00%)
espA36 (23.53%)-15 (14.71%)-44 (28.39%)1 (25.00%)
fimH44 (28.76%)-26 (25.49%)1 (33.33%)30 (19.36%)1 (25.00%)
OmpA69 (45.10%)-52 (50.98%)-77 (49.68%)-
PAI2 (1.31%)1 (6.26%)3 (2.94%)---
Sfa/focDE3 (1.96%)-4 (3.92%)-7 (4.52%)-
traT19 (12.42%)-4 (3.92%)-22 (14.19%)-
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Adewoyin, M.A.; Ogunmolasuyi, A.M.; Okoh, A.I. Distribution and Molecular Characterization of Clinically Relevant Acinetobacter Species from Selected Freshwater Sources in the Eastern Cape Province, South Africa. Bacteria 2024, 3, 160-170. https://doi.org/10.3390/bacteria3030011

AMA Style

Adewoyin MA, Ogunmolasuyi AM, Okoh AI. Distribution and Molecular Characterization of Clinically Relevant Acinetobacter Species from Selected Freshwater Sources in the Eastern Cape Province, South Africa. Bacteria. 2024; 3(3):160-170. https://doi.org/10.3390/bacteria3030011

Chicago/Turabian Style

Adewoyin, Mary Ayobami, Adewoyin Martin Ogunmolasuyi, and Anthony Ifeanyi Okoh. 2024. "Distribution and Molecular Characterization of Clinically Relevant Acinetobacter Species from Selected Freshwater Sources in the Eastern Cape Province, South Africa" Bacteria 3, no. 3: 160-170. https://doi.org/10.3390/bacteria3030011

APA Style

Adewoyin, M. A., Ogunmolasuyi, A. M., & Okoh, A. I. (2024). Distribution and Molecular Characterization of Clinically Relevant Acinetobacter Species from Selected Freshwater Sources in the Eastern Cape Province, South Africa. Bacteria, 3(3), 160-170. https://doi.org/10.3390/bacteria3030011

Article Metrics

Back to TopTop