A Library of Microsatellite Markers for Efficiently Characterizing the Aquatic Macrophyte Myriophyllum heterophyllum

Abstract

Myriophyllum heterophyllum is an aquatic macrophyte that is invasive to the northeastern United States and several western European countries. Spreading by vegetative clonal propagation, especially fragmentation, extensive resources are devoted to limiting its growth and spread; however, genetic assessments are not typically included in management strategies. Reduction in genetic (clonal) diversity should accompany biomass reduction, yet without genetic assessment, the efficacy of plant removal remains unclear. This paper is the first to describe a microsatellite marker library and its use in the characterization of Myriophyllum heterophyllum. Eighty-seven tissue samples were collected across the invasive distribution of Myriophyllum heterophyllum in Maine, USA. DNA was extracted, and PCR amplification was employed to screen 13 published microsatellites. Sequencing of the amplified loci was performed to characterize repeat motifs and confirm primer binding sites. Fragment sizing of PCR amplicons was employed to determine microsatellite lengths across the 87 samples. A total of 7 of the 13 tested markers were amplified, with six of those seven found to be variable. Polyploidy was evident from allelic diversity within individuals, although precise ploidy could not be determined. Observed heterozygosity ranged from 0.16 to 1.00 across variable markers. This seven-marker library was effective in characterizing the genetic diversity of both newly discovered (<5 years) and older (>50 years) infestations and is expected to be suitable for assessment of genetic diversity in populations within the native range of M. heterophyllum. The marker library also shows potential for use in several other Myriophyllum species.

1. Introduction

A considerable amount of time and money has been spent to manage Myriophyllum heterophyllum (variable watermilfoil) within its invasive range [1], yet, to date, control measures have not included genetic diversity analyses. Typically, M. heterophyllum management involves the reduction in biomass through suction harvesting, benthic matting, or hand pulling. These efforts are effective in limiting M. heterophyllum growth within a water body [1] and should reduce the likelihood of M. heterophyllum spread by fragmentation; however, upon post-control surveys identifying regrowth, it is unknown whether managed patches regenerate or if new plants recolonize suitable patches. By detecting the genetic identity (multi-locus genotype, i.e., clone) of each patch of invasive milfoil, it is possible to determine (1) the number of distinct clones within a body of water, (2) whether biomass control is also reducing genetic diversity over time, and (3) if the population is employing sexual reproduction.

Subsequently, the identification of new clones in a water body, after an initial assessment, may be indicative of novel introductions. In this case, increased management efforts might be best applied to limiting dispersal among water bodies, in addition to biomass reduction.

1.1. Plant Life History

Myriophyllum heterophyllum is a submerged aquatic perennial macrophyte which is capable of propagating clonally by fragmentation as well as sexually through emergent flowering and seed dispersal within its native range. The primary mode of propagation is influenced by the physical conditions in the growth environment, although a high degree of clonal reproduction via fragmentation appears to be typical for freshwater aquatic plants in general, including species in the genus Myriophyllum [2,3,4].

Myriophyllum heterophyllum is native to the southeastern United States but is invasive in the northeastern United States [5]. It was characterized as being among the worst invasive species in Europe [6] due to its common occurrence as a monoculture spanning navigation channels. Similar invasive growth patterns are observed in northern New England states such as Maine, USA.

Within Maine, M. heterophyllum propagation is thought to be only asexual, through patch expansion by stolon action and/or by fragmentation, as no seeds have been found in infested waterbodies. The growing season in such northern climes appears too brief for the full sexual reproductive cycle. For example, in a floristic survey of more than 2000 lakes in Minnesota, only 5 lakes contained M. heterophyllum; no M. heterophyllum seeds were found during the survey [7]. In addition to localized dispersal by vegetative expansion of rooted patches, fragments may be dispersed moderate distances by hitchhiking on waterfowl or through recreational boating [8,9]. Two regions in Maine with concentrations of lakes and ponds in close proximity, and with direct highway access connecting nearby infested states, are the Sebago Lakes region (Cumberland County) and the Belgrade Lakes region (Kennebec County).

As of the end of the 2023 growing season, 47 water bodies were listed as infested with M. heterophyllum in Maine, USA, with the majority of recorded infestations occurring within the two aforementioned lake regions [10]. The first record of M. heterophyllum infestation in Maine is from Sebago Lake (1970). The Belgrade Lakes region had its first recorded infestation (1999) in Messalonskee Lake [11]. The newest recorded infestation (2019) by M. heterophyllum in Maine is in Big Lake, Washington County, the Downeast region.

The initial introduction of M. heterophyllum to Maine likely came via recreational boating activity. Since 1970, subsequent introductions of novel M. heterophyllum clones to Sebago Lake as well as to other waters of the state were likely introduced from other parts of its range [12]. Furthermore, within-state dispersal among water bodies has also been demonstrated [13] and may be another source of initial and ensuing M. heterophyllum introductions.

1.2. Goals and Rationale of Study

The purpose of this article is to present a microsatellite (short tandem repeat; STR) marker library and methodology that can be used to investigate the genetic diversity of Myriophyllum heterophyllum across its range, as well as to enhance control efforts where it is invasive.

2. Materials and Methods

2.1. Sample Collection and Species Identification

Tissue samples of 87 Myriophyllum heterophyllum plants were collected from 11 water bodies in Maine, USA across the Sebago Lakes (n = 25) and Belgrade Lakes (n = 30) regions, where the highest density of known infestations in the state occur, as well as the Downeast region (n = 32), due to a recently discovered large infestation. These samples were provided by the Maine Department of Environmental Protection (Maine DEP) in cooperation with lake protection non-government organizations. Morphological identification of M. heterophyllum was used during collection, but because the morphology of immature M. heterophyllum overlaps with several milfoil species native to Maine, species identification was verified using ITS restriction enzyme patterns [14].

2.2. Amplification, Sequencing, and Fragment Analysis

Thirteen published [15] microsatellite markers for Myriophyllum spicatum (Eurasian watermilfoil) were screened for amplification, then STR (short tandem repeat) presence, in Myriophyllum heterophyllum. DNA was extracted from whole watermilfoil tissue using the Puregene Tissue Kit (QIAGEN, Düsseldorf, Germany) procedure in preparation for DNA amplification. PCR amplification was performed in 25 uL reactions consisting of 50–100 ng of template DNA, 0.33 μM of each primer, a PuReTaq Ready-To-Go PCR Bead (Cytiva, Tokyo, Japan), and sterile deionized water. Thermal cycling conditions consisted of an initial denaturation period of five minutes at 94 °C followed by 35 cycles of melting at 94 °C for 30 s, annealing for 30 s at temperatures ranging from 50 to 59 °C depending on the marker (see

Table 1. Microsatellite repeat motif characterization in Myriophyllum heterophyllum using primers developed for amplification of microsatellites in Myriophyllum spicatum by Wu et al. [15]. Lowercase notation of the 3′ end of Myrsp 12 indicates a mismatch between M. spicatum and M. heterophyllum sequences.

Marker	Primer Sequences (5′-3′)	Repeat Motif(s)	TA °C	Allele Size Range
Myrsp4	F: ACTGGCTAATGATATGCTGA R: TCTTTCCACGCCTCTTC	(TA)3 (CA)11	52	244–272
Myrsp6	F: TAACAAACCGTACATTACAAGC R: TTTCTCTGGGAGCCATAAC	(TC)6	59	146–154
Myrsp8	F: GCACCATTAGGAGGAGAAC R: CTGCCGAAGATGAAACG	(TC)3 (CAAG)2	59	274
Myrsp12	F: CGCTTCACAAGTATtctg	(TA)3 (TC)9 (CA)5	51.4	358–385
	R: TTCATGGTAGCCGTCA
Myrsp14	F: TTCCCATCCTTCTCCTG	(TA)2 (TG)4 (AG)4	50	293–307
	R: CCAAGTAAGTGTCCCAAAC
Myrsp15	F: TCTTTCCACGCCTCTTC	(TG)5 (AG)7	50	244–285
	R: ACTGGCTAATGATATGCTGA
Myrsp16	F: GGCTGCCCTATGCTAA	(TG)3 (TATG)2 (TA)3	54	182–192
	R: ATCCCACTGAAGTCAAACT

T_A °C = Annealing temperature in degrees Celsius.

), and extension at 72 °C for one minute, with a final extension of 72 °C for 10 min.

The 87 M. heterophyllum plants were analyzed to determine ranges of STR allele size. PCR conditions for amplification as described above were used; reverse primers were tagged with either 6FAM or HEX fluorophores. These amplicons were measured by capillary electrophoresis at Mount Desert Island Biological Laboratory (MDIBL), Bar Harbor, Maine, USA, and microsatellite peaks were scored using Peak Scanner Software version 1.0.

Additionally, markers which amplified were sequenced from a representative sample in both directions (2× coverage) to characterize the repeat motif(s). Sequencing was performed at MDIBL and analyzed with Chromas version 2.6.6. A consensus sequence of the full amplified region, including the primers, was constructed. These sequences were analyzed for the presence of one or more short tandem repeats; the identity and repetition of each motif were recorded per marker.

2.3. Data Analysis

The maximum number of alleles per individual (A_m) across Maine, as well as the total number of alleles (A) and the observed heterozygosity (H_o) per locus within each region, were calculated. Observed heterozygosity (H_o) was calculated by dividing the number of heterozygous individuals by the total number of individuals per region per locus.

3. Results

Seven of the thirteen markers tested were found to amplify and contain short tandem repeats (STRs). Six of these markers were variable across invasive M. heterophyllum populations tested in Maine, USA. No amplification resulted in markers Myrsp 2, 3, 5, 10, 18, or 19 tested in M. heterophyllum using published annealing temperatures [15]. Markers Myrsp 4, 6, 8, 12, 14, 15, and 16 [15] demonstrated utility for genetically characterizing invasive populations; however, no allelic diversity was observed in marker Myrsp 8 in Maine, USA.

The amplification of marker Myrsp 12 was mildly inconsistent, with weak or no amplification resulting in some instances. Upon sequencing the locus, it was determined that the four 3′-most nucleotides of the forward primer were mismatches in M. heterophyllum. Instead of the sequence 5′-TCTG-3′ of M. spicatum [15], 5′-CGCT-3′ occurred in M. heterophyllum (Table 1). A modification of the forward primer accordingly may improve amplification yield and fragment sizing clarity (signal strength) in future work.

The maximum number of alleles per individual (A_m) across Maine ranged from 3 to 1, with an average of 2.43. The total number of alleles per locus per region (A) ranged from 5 to 1 with an average of 2.73. The observed heterozygosity (H_o) values per locus within each region averaged to 0.29, 0.80, and 0.27 for the Sebago, Belgrade, and Downeast regions, respectively (

Table 2. Observed diversity in clonal populations of Myriophyllum heterophyllum across the Sebago, Belgrade, and Downeast regions of Maine, USA.

		Sebago (n = 25)		Belgrade (n = 30)		Downeast (n = 32)
Locus	Am	A	Ho	A	Ho	A	Ho
Myrsp4	3	5	0.720	4	0.967	3	0.031
Myrsp6	2	4	0.160	2	0.500	1	0.000
Myrsp8	1	1	0.000	-	-	-	-
Myrsp12	3	-	-	3	1.000	4	0.968
Myrsp14	1	-	-	1	0.367	1	0.000
Myrsp15	3	-	-	3	0.967	3	0.313
Myrsp16	3	-	-	2	1.000	3	0.313
Mean	2.429	3.333	0.293	2.667	0.800	2.500	0.271

A_m = maximum alleles per individual across Maine; A = total alleles/locus (per region) within Maine; H_o = observed heterozygosity.

).

No polymorphism was found at locus Myrsp 8 in a study piloting markers Myrsp 4, 6, and 8 in M. heterophyllum from the Sebago Lakes Region (n = 25). Yet in that same study, both loci Myrsp 4 and 6 showed a high number of unique genotypes (4 in Sebago Lake, 5 in the region) for each locus individually. Even with only two polymorphic loci used to characterize the Sebago Lakes region, it displayed as many clones (7) as the Belgrade Lakes region (7) and more than twice that of the Downeast region (3), which were each characterized with six markers.

The seven-marker library presented in this article was sufficient for the characterization of older infestations with several clones (>50 years; Sebago region, >25 years; Belgrade region) as well as a newer infestation (<5 years; Downeast region) with few clones. The marker library presented here trended toward the expected positive relationship between number of clones per region and age of infestation (R² = 0.985, p = 0.077), and it had the resolving power to distinguish three clones (two independent introductions and a third that likely arose as a mutation from the most common clone) in the Downeast region, an infestation which was initially expected to show a single clone due to its distance from other known infested water bodies.

4. Discussion

The seven-marker library described here has been useful in characterizing the clonal diversity within water bodies and across regions of the state of Maine, USA, showing a pattern of higher clonal diversity in older infestations and lower clonal diversity in a newly discovered infestation. The dispersal patterns of M. heterophyllum into and throughout Maine produce “populations” of clones within water bodies that do not contribute to a common gene pool; rather, clones propagate within and across water bodies only by fragmentation. This results in a low level of genetic diversity (among individuals) across the state of Maine and especially within any single water body. Novel genetic diversity at any scale comes primarily from the introduction of novel clones, or potentially from mutation [16].

It is difficult to determine the ploidy or allelic dosage of an individual from microsatellite fragment sizing analysis [15] as the maximum number of possible alleles at a locus would need to be represented. This was not observed in populations of M. spicatum within its native range [15]; it is even less likely to be observed in the invasive range of M. heterophyllum where alleles do not mix through sexual reproduction. Despite not being able to precisely determine allelic dosage, polyploidy is evident within the M. heterophyllum infestations in Maine, as more than half of the loci showed more than two alleles per individual (Table 2).

The capacity for per locus genetic diversity is higher in a polyploid relative to a diploid. Because there is higher heterozygosity in polyploids [17], fewer markers are necessary to characterize a relatively high number of genetic traits (e.g., STR alleles) in a polyploid than in a diploid [18]. For example, the capacity for allelic diversity per individual is the same across 6 loci in a hexaploid as it is across 18 loci in a diploid. Polyploidy increases heterozygosity and asexual propagation protects that heterozygosity in individuals [19], hence the high heterozygosity values observed in the Belgrade Lakes region. Furthermore, the exclusively asexual nature of propagation in M. heterophyllum in Maine means that there is a limited and constant (barring mutation or novel introductions) number of genotypes in a water body. Six loci were sufficient for identifying the clonal identity of every individual in the observed water bodies because of this combination of polyploidy and vegetative propagation.

It was expected that Sebago Lake would have the greatest genetic diversity (number of unique clones) of any waterbody in Maine since it is the oldest recorded infestation (1970) and has among the highest recreational boating use in the state [1,13,20]. Because of the high observed genetic diversity in markers Myrsp 4 and 6 and no observed genetic diversity in Myrsp 8, the use of Myrsp 8 was discontinued in further studies in Maine, USA, where additional polymorphic markers were added.

Future work should include the assessment of sexually reproducing M. heterophyllum, especially within its native range. It is possible that additional markers [15] will amplify and are polymorphic in Myriophyllum heterophyllum and other Myriophyllum species. Markers not tested [15] in this project could be screened and added to a marker library for that purpose.

Beyond M. heterophyllum, this marker library also shows potential for use in five other species in the genus Myriophyllum. A pilot study has confirmed amplification in samples from species M. sibiricum, M. alterniflorum, M. verticillatum, M. farwellii, and M. humile across markers Myrsp 4, 6, 8, 12, 14, 15, and 16 [21].