Next Article in Journal
Analysis of Parent and F1 Progeny Verification in African Yam Bean (Sphenostylis stenocarpa Hochst, Ex. A. Rich. Harms) Using Cowpea SSR Markers
Previous Article in Journal
Application of Pyroligneous Acid as a Plant Growth Stimulant Can Improve the Nutritional Value of Soybean Seed
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Crops
Volume 4
Issue 4
10.3390/crops4040033
crops-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Minimizing the Adverse Impacts of Soil Salinity on Maize and Tomato Growth and Productivity through the Application of Plant Growth-Promoting Rhizobacteria

by
Hiba Yahyaoui
1,2,
Nadia El Allaoui
1,
Aziz Aziz
3,
Majida Hafidi
2 and
Khaoula Habbadi
1,*
1
Plant Protection Research Unit, National Institute of Agronomic Research (INRA), Regional Center of Agronomic Research of Meknes (CRRA), Meknes 50000, Morocco
2
Laboratory of Biotechnology and Bio-Resources Valorization, Faculty of Sciences, University Moulay Ismail, Meknes 50000, Morocco
3
Research Unit “Induced Resistance and Plant Bioprotection”, RIBP-USC INRAe 1488, University of Reims Champagne-Ardenne, 51100 Reims, France
*
Author to whom correspondence should be addressed.
Crops 2024, 4(4), 463-479; https://doi.org/10.3390/crops4040033
Submission received: 25 August 2024 / Revised: 26 September 2024 / Accepted: 8 October 2024 / Published: 12 October 2024
Browse Figures
Versions Notes

Abstract

:
Soil salinity significantly impacts crop productivity. In response, plant growth-promoting rhizobacteria (PGPR) offer an innovative and eco-friendly solution to mitigate salinity stress. However, research on PGPR’s effects on crop physiology under varying salinity levels is still emerging. This study evaluates the impact of five bacterial strains, isolated from compost, on the growth of maize (Zea mays) and tomato (Solanum lycopersicum) plants under different levels of salt stress. This study involved treating maize and tomato seeds with five bacterial strains, and then planting them in a greenhouse under varying salt stress conditions (43 mM, 86 mM, 172 mM, 207 mM NaCl) using a Randomized Complete Block Design. Results showed that bacterial inoculation improved plant growth under saline conditions. S2015-1, S2026-2, and S2027-2 (Bacillus cereus, Acinetobacter calcoaceticus, Bacillus subtilis) were particularly effective in promoting plant growth under salt stress, especially at ionic concentrations of 43 mM and 86 mM, leading to a substantial increase in fresh and dry weight, with strain S2015-1 boosting chlorophyll by 29% at 86 mM in both crops. These results highlight the potential of PGPR to enhance crop resilience and productivity under salinity stress, promoting climate-smart agricultural practices.

1. Introduction

Climate change presents significant challenges to global agricultural systems, particularly regarding its impact on soil health and productivity [1]. Changes in temperature, precipitation patterns, and the frequency of extreme weather events exacerbate soil salinity, a major threat to agriculture, especially in arid and semi-arid regions [2]. Currently, soil salinity affects 20% of the world’s cultivated land and 33% of irrigated agricultural lands, with projections of an increase due to ongoing climatic shifts [3,4]. The rise in salinity not only reduces soil fertility but also threatens food security by limiting crop growth and yield. Salt stress conditions restrict plant growth, reduce seed germination, and impair seedling establishment due to lower osmotic potential and toxic ion effects [5,6]. These effects are linked to several harmful pathways, including osmotic imbalance, ion toxicity, water stress, oxidative stress, nutritional disorders, membrane disorganization, reduced cell division and expansion, and genotoxicity [7,8]. Addressing these challenges requires the development of comprehensive policies that not only ensure food security and promote social and economic welfare but also preserve natural resources in the long term. Recognizing the severity of soil salinity, Morocco has implemented the Green Moroccan Plan (GMP) since 2008, which aims to modernize agriculture, stimulate economic growth, and alleviate poverty [9]. A key component of the GMP is the promotion of high-value crops suited for export markets, while simultaneously reducing the area under cereal cultivation by 22%, thereby enhancing the efficiency of production systems [10,11].
Plant responses to salt and water stress share similarities, as salinity reduces the ability of plants to absorb water, initially slowing growth and triggering metabolic changes akin to water stress [12]. In the early stages of salt exposure, there is a reduction in cell growth, division, and leaf growth. As salt stress progresses, a decline in shoot growth and overall plant size occurs. Visual symptoms of salt injury, such as wilting, yellowing leaves, and stunted growth, emerge gradually [13]. In later stages, plants exhibit chlorosis, leaf tip burning, and leaf necrosis, with symptoms first appearing in the oldest leaves [14]. It is thus essential to develop novel, effective methods to mitigate salinity stress in crops. Some desalinization technologies have been developed, such as drainage-based cropping systems, physical adsorption improvements, brine discharge pipes, and slag adsorption. However, these are water-intensive and unsuitable for arid and semi-arid areas [15]. Efforts to improve plant salt tolerance have explored various mechanisms, including plant growth-promoting rhizobacteria (PGPR), traditional breeding, and genetic engineering [16,17,18,19].
Among the promising solutions, plant growth-promoting rhizobacteria (PGPR) have gained attention for their ability to mitigate the adverse effects of soil salinity [20]. These beneficial bacteria enhance plant growth by improving nutrient uptake, reducing ion toxicity, and promoting resilience under stress conditions [20]. PGPR offer a sustainable and eco-friendly alternative to chemical fertilizers, thereby supporting soil health and boosting agricultural productivity [21,22]. The use of PGPR to reclaim saline soil is a far better approach than the use of chemical and organic fertilizers because of their environmentally friendly and persistent nature, with PGPR proliferating slowly and gradually in inoculated soil, ensuring their survival for decades. For this purpose, PGPR should be isolated from their native stress habitat [23], and reinoculated into affected fields to enhance soil physicochemical properties, ultimately improving crop growth and yield [24,25]. Modern agriculturalists have recently started to pay attention to a collective approach to exploiting PGPR’s potential to alleviate salinity [21]. In the current climate change scenario, the exploitation of PGPR could be an eco-friendly strategy with which to promote organic farming [22].
Tomatoes (Solanum lycopersicum L.) and maize (Zea mays L.) are economically important crops in Morocco. They are known for their nutritional value and contribution to the agricultural sector [26,27]. Tomato is one of the most important vegetable crops globally, with Morocco exporting nearly 660,000 tons of greenhouse tomatoes in 2023, primarily to the European Union. Annually, a wide variety of factors can affect tomato yield and fruit nutritional quality [28]. Among these factors, the salt content in soil and water used in irrigation stands out. Furthermore, by 2050, more than 50% of arable land is expected to become saline due to a combination of factors: the weathering of native rocks, irrigation with saline water, the increasing frequency of droughts projected by climate change, and intensive agronomic practices, which may force farmers to rely on salty water [29]. In a saline environment, plant growth is influenced by the complex interaction of plant hormones, nutritional imbalance, poor water relations, and specific ion effects, which ultimately result in defective plant biomasses and poor yield [30]. Maize is generally considered a salt-sensitive crop [31]. The salt stress imposes detrimental effects on morphological performance, biochemical changes, and physiological mechanisms, which in turn cause a reduction in seed germination [32], fresh and dry biomass [33], and photosynthesis [34]. They also influence the accumulation of mineral nutrients [35].
Microorganisms that inhabit the internal plant tissues and establish close associations with plants are known as endophytes [36]. Endophytic bacteria, being the safest bacteria, are highly beneficial for the improvement of salt tolerance in plants [37]. Bacterial species belonging to Bacillus, Acetobacter, Burkholderia, Enterobacter, Paraburkholderia, Pseudomonas, Paenibacillus, Pantoea, and Streptomyces genera have all been reported to significantly alleviate the salinity stress [38,39]. B. subtilis is one of the most common and effective plant growth-promoting endophytic bacteria [40]. The protective effect of B. subtilis under different abiotic stresses has been shown for various plant species, including maize [41,42] and tomato [43,44,45]. Some Pantoea species are known to interact with plants and occur as plant epiphytes or endophytes and exhibit PGP [46,47], including salt-stress alleviation in various crops [48,49,50].
PGPR have demonstrated the potential to enhance maize salt tolerance [51]. However, their full potential has not been thoroughly explored, particularly in arid and semi-arid regions, and their efficacy has been inconsistent in some cases, with limited application range [52]. This study aims to evaluate the effect of PGPR strains, isolated from compost, on the growth of maize and tomato plants under varying levels of salt stress. The research focuses on assessing how these bacterial strains influence plant growth metrics, nutrient uptake, and stress tolerance in maize and tomato cultivated in Moroccan soils under increasing salinity levels. This research aims to help develop sustainable agricultural practices in salinity-affected regions, offering insights into using PGPR as a viable strategy to enhance crop resilience and productivity under stress conditions.

2. Materials and Methods

2.1. Plant Material

In this study, tomato (Solanum lycopersicum) and maize (Zea mays) were chosen to assess the impact of specific bacterial strains on plant growth under saline stress. The selection of these crops is driven by their substantial agricultural and scientific importance. To ensure experimental accuracy and prevent contamination, untreated tomato and maize seeds were sourced from a local market and subjected to a thorough sterilization process. They were immersed in a 10% sodium hypochlorite solution for 2 min, followed by two washes with sterile water [53]. After sterilization, the seeds were placed on Whatman No. 1 filter paper to air dry before being inoculated with the selected bacterial suspensions in preparation for planting.

2.2. Bacterial Strains and Culture Conditions

The research aimed to evaluate the impact of five bacterial strains (S2026-2, S2027-2, S2015-1, S2025-1, S2025-11) isolated from compost samples collected from the Fez-Meknes region in north-central Morocco and the Souss-Massa region in central Morocco (Table 1). The compost used in this study was a mixture of organic waste materials, primarily agricultural residues, which had undergone microbial decomposition, resulting in a nutrient-rich substrate ideal for supporting beneficial microorganisms.
Each strain was cultured on a YPGA medium (yeast extract, 5 g/L; peptone, 5 g/L; glucose, 10 g/L; agar, 15 g/L) for 24–48 h at 27 ± 1 °C. The large-scale bacterial production process involved culturing the bacteria in a YPGA medium across five replicates. Bacterial growth was continuously monitored, and adjustments to concentration were made based on optical density (OD600) measurements using a spectrophotometer. Once the target cell concentration of 108 CFU/mL was achieved, the bacterial cultures were used to prepare 2 L bacterial suspensions for the inoculations.
The strains were previously reported for their essential plant growth-promoting traits, including nitrogenase activity for nitrogen fixation and phosphatase activity for phosphate solubilization [54,55]. For instance, Strains 2025-1 and 2027-2 showed enzymatic activities such as cellulase and chitinase, aiding cellulose and chitin degradation. They also produced indole acetic acid (IAA). Most strains, except strain 2026-2, were positive for protease activity, enhancing nutrient availability in the soil.

2.3. Experimental Layout and Treatments

The present trial was conducted in 2020 at the Phytobacteriology and Plant Protection Laboratory of the National Institute of Agronomic Research. In this study, maize (Zea mays) and tomato (Solanum lycopersicum) seeds were pre-treated with the five bacterial strains previously mentioned before planting. In addition to the primary treatments, control groups were established. The experiment was conducted in plastic pots arranged in a Randomized Complete Block Design (RCBD) with a factorial layout [56]. The plastic pots, measuring 10–13 cm in diameter with a 1 L capacity, were filled with 3 kg of soil composed of peat, clay, and sand, mixed in equal proportions (1:1:1). The seed treatment involved immersing seeds in a bacterial suspension, prepared and adjusted to a concentration of 108 CFU/mL, for 30 min. Four seeds per treatment were planted in each pot.
The experimental groups were as follows: control pots with seeds treated only with bacterial suspensions; and salt-treated pots with seeds exposed to bacterial suspensions and varying NaCl concentrations (43 mM, 86 mM, 172 mM, 207 mM). The negative control pots, which were sown with untreated seeds, received regular watering with deionized water and were not treated with bacteria. A second set of negative controls was only treated with varying concentrations of NaCl, chosen for the experiment. Each treatment was replicated in duplicate. Salt treatments began 10 days after sowing. The pots were maintained in a greenhouse under controlled conditions, with natural sunlight, a temperature of 25 ± 1 °C, and 50% humidity. These conditions were suitable for crop growth.

2.4. Plant Harvest and Biometric Analysis

To evaluate the effects of the bacterial strains on maize and tomato cultivation in a greenhouse setting, various growth parameters were measured after 8 weeks of seed growth. Plant height was recorded from the soil surface to the tip of the main stem using a ruler. Stem diameter and the number of leaves per plant were also documented. At the 4-leaf and 10-leaf stages, three plants were randomly selected from each plot to measure the chlorophyll content in the top, middle, and lower leaves. This was assessed using a SPAD chlorophyll meter (model: SPAD; reference: 20210036_0042; maximum size: 63.5 × 42.33 cm/300 dpi), based on the method described by Yadava [57], which correlates SPAD values with extracted leaf chlorophyll levels.
To determine the plants’ physiological water status, relative water content (RWC) was measured. Fresh weight (FW) and dry weight (DW) were obtained, and the water content was calculated using the following formula:
% relative water content = [(FW − DW)/FW] ∗ 100.
where FW is the resulting fresh weight per plant, and DW is the measured dry weight per plant. Additional growth metrics, including root length and leaf width, were also recorded.

2.5. Molecular Identification of Selected Bacterial Strains

The identification of plant growth-promoting rhizobacteria (PGPR) was conducted using the conserved 16S rRNA gene for bacterial detection and identification. DNA extraction for PCR amplification was performed following the protocol described by Campillo et al. [58]. Briefly, cells from a single colony were resuspended in 10 μL of 20 mmol/L NaOH and incubated at 37 °C for 5 min. Three microliters of this suspension were then used for PCR in a 60 μL reaction mixture. The lysed bacterial cells were stored at 4 °C until further use.
PCR amplification was performed using primers F809 pA (AGAGTTTGATCCTGGC-TCAG) and F810pH (AAGGAGGTGATCCAGCCGCA). The reaction mix included 38.6 μL H2O, 6 μL of 2 mM dNTPs, 1.2 μL of 2 mM MgCl2, 3 μL of DMSO, 1 μL of each primer (10 μM), 0.2 μL of Taq DNA polymerase (Invitrogen, France), and 3 μL of the lysed cell suspension. The PCR protocol consisted of an initial denaturation at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 55 °C for 1 min, and extension at 72 °C for 1 min, with a final extension at 72 °C for 5 min.
Electrophoresis was conducted using a 1% agarose gel, which was stained with ethidium bromide. DNA fragments were visualized using an ultraviolet (UV) transilluminator, and the gel was photographed. The 16S rRNA gene from each isolate was sequenced (GenoScreen Lille, France) and analyzed using NCBI-BLAST software (BLAST+ 2.14.0) for identification.

2.6. Data Analysis

The agronomic data collected were statistically analyzed using SPSS 21 software. In this study, to assess the effect of the different treatments and soil salinity on plant growth parameters, statistical analysis was carried out using analysis of variance (ANOVA) to assess the chlorophyll content and root and stem length. The Tukey HSD multiple comparison test was used to compare group means and identify significant differences between treatments, after confirming significant differences via ANOVA. All statistical tests were performed at a significance level of p < 0.05.

3. Results

3.1. Differential Salt Tolerance in Tomato and Maize: Impact on Plant Growth and the Efficacy of Bacterial Inoculation

This study sought to evaluate the efficacy of five distinct bacterial strains (S2026-2, S2027-2, S2015-1, S2025-1, and S2025-11) in mitigating the detrimental effects of salt stress on the growth of tomato (Solanum lycopersicum) and maize (Zea mays) plants. Plants were exposed to four saline concentrations (43 mM, 86 mM, 172 mM, and 207 mM) (Figure 1).
The results demonstrated that bacterial inoculation significantly enhanced the fresh weight of plants under saline conditions compared to non-inoculated controls, underscoring the potential role of these bacteria in improving salt tolerance. Certain strains also promoted an increase in dry weight, particularly at moderate saline concentrations, indicating their ability to sustain plant growth under stress.
Among the strains, S2015-1, S2026-2, and S2027-2 were particularly effective in promoting plant growth under salt stress, especially at ionic concentrations of 43 mM and 86 mM, leading to a substantial increase in fresh and dry weight. These findings suggest that these strains could be pivotal in developing bio-stimulation strategies to enhance salt tolerance in tomato and maize crops (Figure 1A,B).
However, a critical observation was that while strains S2025-1 and S2025-11 did enhance plant growth up to 86 mM, their efficacy diminished at higher salinity levels, with a progressive reduction in growth observed beyond this threshold. The outcome indicates a tolerance limit, beyond which these strains are less effective (Figure 1C).
The results show that plants treated with bacterial suspensions maintained significantly higher RWC than those in the non-inoculated control plants (Figure 1D). As salt concentrations increased, control plant RWC sharply declined, especially at 172 mM and 207 mM NaCl. However, the PGPR-treated plants demonstrated improved water retention under these stressful conditions. Notably, strains 2025-1 and 2027-2 were the most effective, helping plants retain higher RWC, even at the highest salt concentrations. Other strains, such as 2015-1, 2025-11, and 2026-2, also improved RWC, but showed a more moderate response at higher salinity levels (Figure 2).
The data analysis presented in Figure 3 highlights the differential performance of the bacterial strains under salinity stress. While all five strains improved plant growth to some extent, strains S2026-2 and S2027-2 were particularly noteworthy for their capacity to maintain growth under high salinity, tolerating concentrations up to 172 mM and significantly increasing the fresh weight of inoculated plants. In contrast, strain S2015-1 showed effectiveness up to 86 mM but experienced a decline in growth beyond this level. Strains S2025-1 and S2025-11 exhibited limited tolerance to salinity, with a marked reduction in plant biomass under higher saline conditions, indicating a higher sensitivity to salt stress.
Visual observations indicate a clear trend of progressive decline in the growth of tomato and maize plants with increasing salt concentrations, culminating in plant mortality at 207 mM. The onset of salt stress symptoms is evident as early as the fifth treatment, initially presenting as leaf chlorosis, followed by progressive dehydration and a reduction in overall plant stature. At the highest saline concentrations, plants exhibit severe wilting and pronounced dehydration and ultimately succumb to senescence (Figure 4, Figure 5 and Figure 6).
Salinity tolerance tests on plants inoculated with various rhizobacterial strains revealed significant variability in their ability to mitigate salt stress. Strains S2026-2 and S2027-2 demonstrated exceptional tolerance, effectively supporting plant growth at salinity levels up to 172 mM. These strains were particularly effective in promoting plant growth under extreme saline conditions.
Conversely, strain S2015-1 showed salt tolerance up to 86 mM, beyond which its effectiveness diminished, indicating increased sensitivity. Strains S2025-11 and S2025-1 displayed even more limited tolerance, effectively supporting plant growth only up to 43 mM. Beyond this concentration, their ability to sustain plant growth rapidly declined, significantly reducing growth.

3.2. Impact of Salinity on Root and Stem Development: Efficacy of Bacterial Inoculation

The analysis of plant responses to increasing salt concentrations, with and without bacterial inoculation, reveals a clear trend of decreasing root length as salinity levels rise. Non-inoculated plants show a substantial reduction in root length, particularly at higher salt concentrations of 172 mM and 207 mM. In contrast, plants treated with bacterial suspensions demonstrate significantly enhanced root growth under the same conditions, underscoring the positive impact of beneficial bacteria on root development under salt stress.
Similarly, the stem diameter decreases in response to increasing salinity in both inoculated and non-inoculated plants, reflecting the inhibitory effects of salt on overall plant growth. However, this reduction is less severe in bacteria-treated plants, indicating a protective effect against salinity-induced growth inhibition (Figure 7). The observed decline in root length and stem diameter under salt stress is likely associated with the production of secondary metabolites in the roots, which serves as an adaptive response to mitigate the adverse effects of stress (Table 2).

3.3. Influence of Salt on Chlorophyll Content, Leaf Area, and Leaf Number in Tomato and Maize Plants

The results of this study demonstrated that increasing salinity leads to a reduction in photosynthetic pigments in maize and tomato plants. However, inoculation with plant growth-promoting rhizobacteria (PGPR) elevated this stress. Results show the very close dependency of chlorophyll content upon the soil ionic concentration; salt-stressed plants exhibited a significant increase in photosynthetic pigments compared to non-inoculated control plants, which resulted in improved photosynthetic activity. This enhancement in photosynthetic activity translated into better plant growth, an increase in the number of leaves, and an expansion of leaf area.
Specific data on chlorophyll content in inoculated tomato and maize plants revealed notable differences among the bacterial strains tested. Strains 2015-1 and 2026-2 caused the most significant increase in chlorophyll content at 43 mM and 86 mM concentrations, indicating a solid capacity to support photosynthesis under these salinity levels. Strain 2027-2 also showed a significant increase in chlorophyll, particularly at a concentration of 43 mM.
On the other hand, strains 2025-1 and 2025-11 contributed to increased chlorophyll content, but to a lesser extent than the other strains. Although these two strains showed positive results at a concentration of 43 mM, their relative effectiveness was lower than that of strains 2015-1, 2026-2, and 2027-2 (Figure 8A). These findings revealed significant differences (Table 3).
Salt stress induces a secondary type of stress, known as water stress, by increasing the salt concentration in irrigation water. The data obtained showed that irrigation with saline water reduced biomass production and WUE. However, inoculation with PGPR demonstrated a moderating effect on this reduction. Specifically, the combined effect of salt stress and bacterial inoculation suggests that the bacteria mitigate the decrease in WUE imposed by salt.

3.4. Molecular Identification of Selected PGP Strains

Further molecular analysis was conducted using the universal primers F809PA and F810PH, targeting the 16S rDNA gene with an amplified product of 1477 bp (Figure 9). The 16S rDNA sequences of five PGPR isolates from various samples and locations in Morocco were analyzed using BLAST-NCBI, as summarized in Table 4. The sequencing results revealed that the PGPR isolates belonged to different species across various genera, including Bacillus, Acinetobacter, Pantoea, and Paenibacillus. Strains 2026-2 and 2015-1 were identified as belonging to the genus Bacillus, specifically Bacillus cereus and Bacillus subtilis, respectively. Strain 2027-2 was identified as Acinetobacter calcoaceticus with the GenBank accession number KP170504.1. The other two strains, 2025-1 and 2025-11, were identified as Pantoea agglomerans and Paenibacillus brasiliensis, respectively.

4. Discussion

Climate change exacerbates abiotic stresses, with far-reaching consequences for plants, animals, and humans. Among these stresses, salinity is a critical threat to global food security. It significantly affects plant growth, productivity, yield, and food quality, exacerbating the challenges posed by biotic and abiotic factors [59,60]. Abiotic stresses such as drought, salinity, extreme temperatures, heavy metals, and organic pollutants are particularly detrimental, with soil salinization being the most damaging [61]. Soil salinity is recognized as a significant limiting factor for agricultural productivity and food security. This study focuses on the role of plant–bacterial interactions in mitigating salt stress, providing detailed insights into plant-level mechanisms that contribute to improved crop yields.
In this study, the application of five distinct bacterial strains, S2026-2, S2027-2, S2015-1, S2025-1, and S2025-11, demonstrated a significant improvement in the growth and productivity of tomato (Solanum lycopersicum) and maize (Zea mays) plants under salt stress. The inoculation of these plants with beneficial rhizobacteria, collected from the Fez-Meknes and Souss-Massa regions, resulted in notable enhancements in fresh and dry weight, particularly under saline conditions. These results indicate the potential of these strains to bolster plant growth despite the adverse effects of soil salinity. Specifically, the bacterial strains contributed to increased fresh weight and, in some cases, improved dry weight at moderate saline concentrations (43 mM and 86 mM). These outcomes suggest that the bacteria can effectively support plant growth by enhancing nutrient uptake and possibly producing growth-promoting substances. Among the strains, S2015-1, 2026-2, and 2027-2 strains demonstrated exceptional performance, and were particularly effective in maintaining plant growth under high salinity levels up to 172 mM. They were noted for their ability to enhance plants’ fresh and dry weight, highlighting their resilience and effectiveness in supporting plant development despite increased salinity. The molecular identification of nucleotide sequences for these two revealed two genera, Bacillus and Acinetobacter, namely, 2015-1 (Bacillus subtilis), 2026-2 (Bacillus cereus), and 2027-2 (Acinetobacter calcoaceticus). Various salt-tolerant PGPR strains, including Azospirillum, Burkholderia, Rhizobium, Pseudomonas, Acetobacter, and Bacillus, have been successfully applied and tested to improve plant growth under salt stress conditions [62,63].
Abiotic stress negatively impacts plant growth and development, but certain plant-associated bacteria, like Bacillus subtilis, exhibit high resilience to these conditions due to their genomic structure and metabolic capabilities. Bacillus subtilis and other Bacillus species are abundant in soil, and are often isolated from the rhizosphere of various plants [64,65]. These bacteria thrive in drought- and salt-affected soils and protect plants from the stresses caused by salinity and drought [66]. Bacillus species, particularly Bacillus subtilis, act synergistically with host plants, regulating their physiochemical processes through producing volatile organic compounds (VOCs). For instance, gas chromatography–mass spectroscopy analysis has shown that VOCs like albuterol and 1,3-propanediol, produced by B. subtilis SYST2, promote plant growth by enhancing photosynthetic activity and phytohormone production [67].
Among the tested strains, S2026-2 and S2027-2 emerged as the top performers, significantly enhancing root length, shoot length, and chlorophyll content, particularly under high-salinity conditions. These strains demonstrated superior efficacy in promoting plant growth and physiological responses, suggesting their strong potential in mitigating the adverse effects of soil salinity. The beneficial effects of these plant growth-promoting rhizobacteria (PGPR) can be attributed to their ability to secrete biologically active secondary metabolites, including phytohormones [68].
Research has extensively documented the potential of Bacillus species in alleviating salt stress. For example, Din et al. [69] reported that Bacillus strains play a substantial role in reducing salt stress in wheat by producing exopolysaccharides (EPS), ACC deaminase, and indole-3-acetic acid (IAA) in vitro. Bacillus cereus strains have also been shown to promote plant growth effectively under both normal and stressful environmental conditions. These strains positively impact physiological traits such as dry and fresh weight, shoot and root length, germination, and biochemical traits, like chlorophyll content, relative water content, protein, proline, and antioxidant activity, under abiotic stress conditions [70]. Notably, under heat stress, the ACC deaminase-producing B. cereus KTES strain significantly enhanced shoot and root length, weight, and leaf area in Solanum lycopersicum [70]. Additionally, the endophytic strain B. cereus SA1 was found to produce IAA, gibberellin, and organic acids, further promoting plant growth [70].
Conversely, the performance of other strains varied with salinity levels. For example, Bacillus subtilis S2015-1 performed well under moderate salinity but was less effective at higher concentrations. In contrast, Pantoea agglomerans S2025-1 and Paenibacillus brasiliensis S2025-11 showed limited efficacy, especially under high-salinity conditions. These strains improved plant growth at lower salinity levels (up to 86 mM), but their effectiveness declined as salinity increased, with notable reductions in growth beyond this threshold. The plant growth-promoting effects of different Pantoea species are mainly attributed to mechanisms such as the biosynthesis of phytohormones, including IAA, auxins, cytokinin, abscisic acid, and gibberellic acid [71]. For instance, Pantoea ananatis, P. agglomerans, P. dispersa, and P. vegans have demonstrated the ability to produce IAA, which is crucial in stimulating cell division, plant growth, and differentiation [72,73].
The efficiency of the Pantoea genus in promoting plant growth has been well-documented in rice plants. For example, P. dispersa strain AS18 reduced sodium uptake while improving seedling growth, chlorophyll content, and antioxidant enzyme activity [74]. P. agglomerans has been shown to stimulate rice plant growth in poor soil conditions, reducing sodium uptake and proline and malondialdehyde levels while increasing biomass, photosynthetic pigment, and calcium and potassium uptake under salt stress [75]. The successful colonization and survival of some Pantoea. sp. isolates may be partially attributed to the production of IAA and carotenoids, which are involved in nutrient leakage from plant leaves [75].
Salinity disrupts ion fluxes within plants, leading to an imbalance. In this study, control plants exposed to salinity showed increased Na+ levels and decreased K+ levels. In contrast, plants inoculated with PGPR showed significantly lower Na+ concentrations and higher K+ levels, consistent with the findings of Rojas-Tapias et al. [76]. Disruption of ion flux can damage cell membranes and alter the water potential within plant cells [77]. Plant growth depends on leaf water status, as salt and drought stress can cause water deficits in plant tissues. Relative water content (RWC) is a key indicator of a plant’s stress response [78]. The PGPR-treated plants maintained a higher RWC than the non-inoculated controls, indicating improved water retention and uptake under salt stress. In addition, increased root length and stem diameter highlighted the positive effects of PGPR on plant growth, demonstrating their beneficial role in stress alleviation. These findings are consistent with other studies [78], which suggest that PGPR reduces stress and helps plants access water sources that are otherwise unavailable to non-inoculated plants. Environmental stress often leads to increased leakage of electrolytes such as K+ ions due to the displacement of membrane-associated Ca2+ from the plasma membrane, resulting in membrane permeability damage and increased electrolyte efflux within plant cells and tissues [79].

5. Conclusions

The present study demonstrates that treatment with specific PGPR strains alleviates the effects of salinity stress on tomato (Solanum lycopersicum) and maize (Zea mays). The strains tested, Bacillus cereus, Acinetobacter calcoaceticus, Bacillus subtilis, Pantoea agglomerans, and Paenibacillus brasiliensis, show varying performance, highlighting the importance of selecting appropriate strains based on environmental salinity conditions. For example, strains S2026-2 (Bacillus cereus) and S2027-2 (Acinetobacter calcoaceticus) are promising for areas with high salinity due to their ability to sustain growth under extreme conditions. Conversely, strains S2025-1 and S2025-11, identified as Pantoea agglomerans, and Paenibacillus brasiliensis may be more suitable for regions with lower salinity. This tailored approach could optimize PGPR use to enhance crop resilience to salt stress and improve agricultural productivity in saline-affected areas of Morocco. Future research at multiple field sites and a detailed investigation of the underlying molecular mechanisms will be essential for applying these microbes as biofertilizers in salt-affected soils, ultimately enhancing tomato and maize production.

Author Contributions

Conceptualization, H.Y., N.E.A. and K.H.; methodology, H.Y. and K.H.; software, N.E.A.; validation, A.A., M.H. and K.H.; formal analysis, H.Y. and N.E.A.; investigation, H.Y. and K.H.; resources, A.A. and K.H.; data curation, H.Y., N.E.A. and K.H.; writing—original draft preparation, H.Y. and N.E.A.; writing—review and editing, K.H., H.Y. and N.E.A. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Aziz Aziz from the University of Reims Champagne Ardenne in France, as part of a collaborative effort between the University of and the National Institute of Agronomic Research in Morocco.

Data Availability Statement

The original contributions presented in the study are included in the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Han, G.; Xu, J.; Zhang, X.; Pan, X. Efficiency and Driving Factors of Agricultural Carbon Emissions: A Study in Chinese State Farms. Agriculture 2024, 14, 1454. [Google Scholar] [CrossRef]
  2. Hassani, H.; Huang, X.; Silva, E. Big data and climate change. Big Data Cogn. Comput. 2019, 3, 12. [Google Scholar] [CrossRef]
  3. Srivastava, A.K.; Gaiser, T.; Ewert, F. Climate change impact and potential adaptation strategies under alternate climate scenarios for yam production in the sub-humid savannah zone of West Africa. Mitig. Adapt. Strat. Glob. Change 2016, 21, 955–968. [Google Scholar] [CrossRef]
  4. CSSRI, NAIP. Final Report of NAIP Sub-Project on: Strategies for Sustainable Management of Degraded Coastal Land and Water for Enhancing Livelihood Security of Farming Communities (Component 3, GEF Funded); Burnan, D., Mandal, S., Mahanta, K.K., Eds.; Central Soil Salinity Research Institute, Regional Research Station (CSSRI, RRS): Canning Town, India, 2014; p. 104. [Google Scholar]
  5. Aydınoğlu, A.U.; Özdemir, B.E. Green Deal: Review of history and academic research. Trakya Univ. Fac. Econ. Adm. Sci. E-J. 2022, 11, 107–121. [Google Scholar]
  6. Farooq, M.S.; Uzair, M.; Raza, A.; Habib, M.; Xu, Y.; Yousuf, M.; Ramzan Khan, M. Uncovering the research gaps to alleviate the negative impacts of climate change on food security: A review. Front. Plant Sci. 2022, 13, 927535. [Google Scholar] [CrossRef]
  7. Menberg, K.; Blum, P.; Kurylyk, B.L.; Bayer, P. Observed groundwater temperature response to recent climate change. Hydrol. Earth Syst. Sci. 2014, 18, 4453–4466. [Google Scholar] [CrossRef]
  8. Zhu, T.; Lund, J.R.; Jenkins, M.W.; Marques, G.F.; Ritzema, R.S. Climate change, urbanization, and optimal long-term floodplain protection. Water Resour. Res. 2007, 43, W06409. [Google Scholar] [CrossRef]
  9. Saidi, A.S.; Diouri, M. Food self-sufficiency under the Green-Morocco Plan. J. Exp. Biol. Agric. Sci. 2017, 5, 33–40. [Google Scholar] [CrossRef]
  10. Mrabet, R.; Moussadek, R.; Fadlaoui, A.; Van Ranst, E. Conservation agriculture in dry areas of Morocco. Field Crop. Res. 2012, 132, 84–94. [Google Scholar] [CrossRef]
  11. FAOStat. 2017. Available online: https://www.fao.org/faostat/fr/#home (accessed on 7 July 2020).
  12. Munns, R. Comparative physiology of salt and water stress. Plant Cell Environ. 2002, 25, 239–250. [Google Scholar] [CrossRef]
  13. Okon, O.G. Effect of salinity on physiological processes in plants. In Microorganisms Saline Environments: Strategies and Functions; Springer: Cham, Switzerland, 2019; pp. 237–262. [Google Scholar]
  14. Machado, R.M.A.; Serralheiro, R.P. Soil salinity: Effect on vegetable crop growth. Management practices to prevent and mitigate soil salinization. Horticulturae 2017, 3, 30. [Google Scholar] [CrossRef]
  15. Ilangumaran, G.; Smith, D.L. Plant growth promoting rhizobacteria in amelioration of salinity stress: A systems biology perspective. Front. Plant Sci. 2017, 8, 1768. [Google Scholar] [CrossRef] [PubMed]
  16. Li, E.; Wang, S.; Li, C.; Wang, X.; Chen, K.; Chen, L. Transcriptome sequencing revealed the genes and pathways involved in salinity stress of Chinese mitten crab, Eriocheir sinensis. Physiol. Genom. 2014, 46, 177–190. [Google Scholar] [CrossRef] [PubMed]
  17. Ondrasek, G.; Rengel, Z.; Maurović, N.; Kondres, N.; Filipović, V.; Savić, R.; Romić, D. Growth and element uptake by salt-sensitive crops under combined NaCl and Cd stresses. Plants 2021, 10, 1202. [Google Scholar] [CrossRef] [PubMed]
  18. Fita, A.; Rodríguez-Burruezo, A.; Boscaiu, M.; Prohens, J.; Vicente, O. Breeding and domesticating crops adapted to drought and salinity: A new paradigm for increasing food production. Front. Plant Sci. 2015, 6, 978. [Google Scholar] [CrossRef] [PubMed]
  19. Sun, T.; Yang, Z.F.; Shen, Z.Y.; Zhao, R. Environmental flows for the Yangtze Estuary based on salinity objectives. Commun. Nonlinear Sci. Numer. Simul. 2009, 14, 959–971. [Google Scholar] [CrossRef]
  20. AbuQamar, S.F.; El-Saadony, M.T.; Saad, A.M.; Desoky, E.S.M.; Elrys, A.S.; Abd El-Mageed, T.A.; El-Tarabily, K.A. Halotolerant plant growth-promoting rhizobacteria improve soil fertility and plant salinity tolerance for sustainable agriculture—A review. Plant Stress. 2024, 12, 100482. [Google Scholar] [CrossRef]
  21. Arora, N.K.; Fatima, T.; Mishra, J.; Mishra, I.; Verma, S.; Verma, R.; Bharti, C. Halo-tolerant plant growth promoting rhizobacteria for improving productivity and remediation of saline soils. J. Adv. Res. 2020, 26, 69–82. [Google Scholar] [CrossRef]
  22. Etesami, H.; Noori, F. Soil salinity as a challenge for sustainable agriculture and bacterial-mediated alleviation of salinity stress in crop plants. In Saline Soil-Based Agriculture by Halotolerant Microorganisms; Springer: Singapore, 2019; pp. 1–22. [Google Scholar]
  23. Sandhya, V.S.K.Z.; Ali, S.Z.; Grover, M.; Reddy, G.; Venkateswarlu, B. Effect of plant growth promoting Pseudomonas spp. on compatible solutes, antioxidant status and plant growth of maize under drought stress. Plant Growth Regul. 2010, 62, 21–30. [Google Scholar] [CrossRef]
  24. Nosheen, A.; Bano, A. Growth enrichment of Carthamus tinctorius (L) and reduction in dosage of chemical fertilizers with application of plant growth promoting rhizobacteria. Int. J. Agron. Agric. Res. 2014, 4, 75–84. [Google Scholar]
  25. Khan, N.; Bano, A. Role of plant growth promoting rhizobacteria and Ag-nano particle in the bioremediation of heavy metals and maize growth under municipal wastewater irrigation. Int. J. Phytoremed. 2016, 18, 211–221. [Google Scholar] [CrossRef] [PubMed]
  26. Benabderrazik, K.; Kopainsky, B.; Monastyrnaya, E.; Thompson, W.; Tazi, L.; Joerin, J.; Six, J. Climate resilience and the human-water dynamics: The case of tomato production in Morocco. Sci. Total Environ. 2022, 849, 157597. [Google Scholar] [CrossRef] [PubMed]
  27. Achli, S.; Epule, T.E.; Dhiba, D.; Chehbouni, A.; Er-Raki, S. Vulnerability of barley, maize, and wheat yields to variations in growing season precipitation in Morocco. Appl. Sci. 2022, 12, 3407. [Google Scholar] [CrossRef]
  28. Inculet, C.-S.; Mihalache, G.; Sellitto, V.M.; Hlihor, R.-M.; Stoleru, V. The effects of a microorganisms-based commercial product on the morphological, biochemical, and yield of tomato plants under two different water regimes. Microorganisms 2019, 7, 706. [Google Scholar] [CrossRef] [PubMed]
  29. Hssaisoune, M.; Bouchaou, L.; Sifeddine, A.; Bouimetarhan, I.; Chehbouni, A. Moroccan groundwater resources and evolution with global climate changes. Geosciences 2020, 10, 81. [Google Scholar] [CrossRef]
  30. Parihar, P.; Singh, S.; Singh, R.; Singh, V.P.; Prasad, S.M. Effect of salinity stress on plants and its tolerance strategies: A review. Environ. Sci. Pollut. Res. 2015, 22, 4056–4075. [Google Scholar] [CrossRef]
  31. Farooq, M.; Hussain, M.; Wakeel, A.; Siddique, K.H. Salt stress in maize: Effects, resistance mechanisms, and management. A review. Agron. Sustain. Dev. 2015, 35, 461–481. [Google Scholar] [CrossRef]
  32. Rabie, G.H.; Almadini, A.M. Role of bioinoculants in development of salt-tolerance of Vicia faba plants under salinity stress. Afr. J. Biotechnol. 2005, 4, 210. [Google Scholar]
  33. Kamran, M.; Parveen, A.; Ahmar, S.; Malik, Z.; Hussain, S.; Chattha, M.S.; Chen, J.T. An overview of hazardous impacts of soil salinity in crops, tolerance mechanisms, and amelioration through selenium supplementation. Int. J. Mol. Sci. 2019, 21, 148. [Google Scholar] [CrossRef]
  34. Naveed, M.; Sajid, H.; Mustafa, A.; Niamat, B.; Ahmad, Z.; Yaseen, M.; Chen, J.T. Alleviation of salinity-induced oxidative stress, improvement in growth, physiology and mineral nutrition of canola (Brassica napus L.) through calcium-fortified composted animal manure. Sustainability 2020, 12, 846. [Google Scholar] [CrossRef]
  35. Bonachela, S.; Fernández, M.D.; Cabrera-Corral, F.J.; Granados, M.R. Salt and irrigation management of soil-grown Mediterranean greenhouse tomato crops drip-irrigated with moderately saline water. Agric. Water Manag. 2022, 262, 107433. [Google Scholar] [CrossRef]
  36. Schulz, B.; Boyle, C. What are endophytes? In Microbial Root Endophytes; Springer: Berlin/Heidelberg, Germany, 2006; pp. 1–13. [Google Scholar]
  37. Vaishnav, A.; Shukla, A.K.; Sharma, A.; Kumar, R.; Choudhary, D.K. Endophytic bacteria in plant salt stress tolerance: Current and future prospects. J. Plant Growth Regul. 2019, 38, 650–668. [Google Scholar] [CrossRef]
  38. Ayaz, M.; Ali, Q.; Jiang, Q.; Wang, R.; Wang, Z.; Mu, G.; Gu, Q. Salt-tolerant Bacillus strains improve plant growth traits and regulation of phytohormones in wheat under salinity stress. Plants 2022, 11, 2769. [Google Scholar] [CrossRef] [PubMed]
  39. Bano, A.; Fatima, M. Salt tolerance in Zea mays (L). following inoculation with Rhizobium and Pseudomonas. Biol. Fertil. Soils 2009, 45, 405–413. [Google Scholar] [CrossRef]
  40. Chatterjee, P.; Biswas, S.; Biswas, A.K. Amelioration of salinity stress by NaCl pretreatment with reference to sugar metabolism in legumes Cajanas cajan L. and Vigna mungo L. Plant. Sci. Today 2017, 4, 28–40. [Google Scholar] [CrossRef]
  41. Ferreira, N.C.; Mazzuchelli, R.D.C.L.; Pacheco, A.C.; Araujo, F.F.D.; Antunes, J.E.L.; Araujo, A.S.F.D. Bacillus subtilis improves maize tolerance to salinity. Ciência Rural. 2018, 48, e20170910. [Google Scholar] [CrossRef]
  42. Song, P.; Zhao, B.; Sun, X.; Li, L.; Wang, Z.; Ma, C.; Zhang, J. Effects of Bacillus subtilis HS5B5 on maize seed germination and seedling growth under NaCl stress conditions. Agronomy 2023, 13, 1874. [Google Scholar] [CrossRef]
  43. Medeiros, P.R.; Duarte, S.N.; Silva, Ê.F. Efficiency of water use and fertilizer in fertirrigation of management in the tomato crop under conditions of soil salinity. Commun. Soil Sci. Plant Anal. 2012, 43, 258–264. [Google Scholar]
  44. De O Nunes, P.S.; De Medeiros, F.H.; De Oliveira, T.S.; De Almeida Zago, J.R.; Bettiol, W. Bacillus subtilis and Bacillus licheniformis promote tomato growth. Braz. J. Microbiol. 2023, 54, 397–406. [Google Scholar] [CrossRef]
  45. Popp, P.F.; Dotzler, M.; Radeck, J.; Bartels, J.; Mascher, T. The Bacillus BioBrick Box 2.0: Expanding the genetic toolbox for the standardized work with Bacillus subtilis. Sci. Rep. 2017, 7, 15058. [Google Scholar] [CrossRef]
  46. Cherif-Silini, H.; Thissera, B.; Bouket, A.C.; Saadaoui, N.; Silini, A.; Eshelli, M.; Belbahri, L. Durum wheat stress tolerance induced by endophyte Pantoea agglomerans with genes contributing to plant functions and secondary metabolite arsenal. Int. J. Mol. Sci. 2019, 20, 3989. [Google Scholar] [CrossRef] [PubMed]
  47. Lim, H.K.; Jeong, M.H.; Min, B.H.; Kim, S.H.; Park, C.J. Survival rate and oxygen consumption patterns with respect to salinity changes in juvenile abalone Haliotis discus hannai. Anim. Cells Syst. 2014, 18, 380–386. [Google Scholar] [CrossRef]
  48. Giuffrida, F.; Scuderi, D.; Giurato, R.; Leonardi, C. Physiological response of broccoli and cauliflower as affected by NaCl salinity. In Proceedings of the VI International Symposium on Brassicas and XVIII Crucifer Genetics Workshop, Catania, Italy, 12–16 November 2012; pp. 435–441. [Google Scholar]
  49. Walitang, D.I.; Kim, C.G.; Kim, K.; Kang, Y.; Kim, Y.K.; Sa, T. The influence of host genotype and salt stress on the seed endophytic community of salt-sensitive and salt-tolerant rice cultivars. BMC Plant Biol. 2018, 18, 51. [Google Scholar] [CrossRef] [PubMed]
  50. Sun, Z.; Lou, F.; Zhang, Y.; Song, N. Gill transcriptome sequencing and de novo annotation of Acanthogobius ommaturus in response to salinity stress. Genes 2020, 11, 631. [Google Scholar] [CrossRef] [PubMed]
  51. Chen, L.; Liu, Y.; Wu, G.; Veronican Njeri, K.; Shen, Q.; Zhang, N.; Zhang, R. Induced maize salt tolerance by rhizosphere inoculation of Bacillus amyloliquefaciens SQR9. Physiol. Plant. 2016, 158, 34–44. [Google Scholar] [CrossRef]
  52. Wu, F.; Wan, J.H.C.; Wu, S.; Wong, M. Effects of earthworms and plant growth-promoting rhizobacteria (PGPR) on availability of nitrogen, phosphorus, and potassium in soil. J. Plant Nutri. Soil Sci 2012, 175, 423–433. [Google Scholar] [CrossRef]
  53. Chakfe, N.; Riepe, G.; Dieval, F.; Le Magnen, J.F.; Wang, L.; Urban, E.; Beaufigeau, M.; Durand, B.; Imig, H.; Kretz, J.G. Longitudinal ruptures of polyester knitted vascular prostheses. J. Vasc. Surg. 2001, 33, 1015–1021. [Google Scholar] [CrossRef]
  54. Moustaine, M.; Elkahkahi, R.; Benbouazza, A.; Benkirane, R.; Achbani, E.H. Effect of plant growth-promoting rhizobacterial (PGPR) inoculation on growth in tomato (Solanum lycopersicum L.) and characterization for direct PGP abilities in Morocco. Int. J. Environ. Agric. Biotechnol. 2017, 2, 238708. [Google Scholar]
  55. Moustaine, M.; Kahkahi, R.E.; Benbouazza, A.; Benkirane, R.; Achbani, E.H. The role of plant growth-promoting rhizobacteria (PGPR) in stimulating the growth of wheat (Triticum aestivum L.) in Meknes region, Morocco. Plant Cell Biotechnol. Mol. Biol. 2016, 17, 363–373. [Google Scholar]
  56. Pholsen, S.; Higgs, D.E.B. Effects of potassium fertiliser and dolomite on the dry matter yield and forage quality of signal grass grown on Korat soil series in Northeast Thailand, University of Hertfordshire. Pensee J. 2014, 76, 253–260. [Google Scholar]
  57. Yadava, U.L. A rapid and nondestructive method to determine chlorophyll in intact leaves. HortScience 1986, 21, 1449–1450. [Google Scholar] [CrossRef]
  58. Campillo, E.; Gaddam, S.; Mettle-Amuah, D.; Heneks, J. A tale of two tissues: AtGH9C1 is an endo-β-1, 4-glucanase involved in root hair and endosperm development in Arabidopsis. PLoS ONE 2012, 7, e49363. [Google Scholar] [CrossRef]
  59. Zhang, L.; Liu, Z.; Qi, X.; Pan, F.; Wei, Q.; Shi, Y. Comparative proteomics analysis reveals important drought responsive proteins in the leaves of a potato variety tolerant to drought stress. Pak. J. Bot. 2020, 52, 1525–1535. [Google Scholar] [CrossRef] [PubMed]
  60. Singh, V.K.; Singh, A.K.; Singh, P.P.; Kumar, A. Interaction of plant growth promoting bacteria with tomato under abiotic stress: A review. Agric. Ecosyst. Environ. 2018, 267, 129–140. [Google Scholar] [CrossRef]
  61. Daliakopoulos, I.N.; Pappa, P.; Grillakis, M.G.; Varouchakis, E.A.; Tsanis, I.K. Modeling soil salinity in greenhouse cultivations under a changing climate with SALTMED: Model modification and application in Timpaki, Crete. Soil Sci. 2016, 181, 241–251. [Google Scholar] [CrossRef]
  62. Chatterjee, P.; Samaddar, S.; Anandham, R.; Kang, Y.; Kim, K.; Selvakumar, G.; Sa, T. Beneficial soil bacterium Pseudomonas frederiksbergensis OS261 augments salt tolerance and promotes red pepper plant growth. Front. Plant. Sci. 2017, 8, 705. [Google Scholar] [CrossRef]
  63. Egamberdieva, D.; Wirth, S.; Bellingrath-Kimura, S.D.; Mishra, J.; Arora, N.K. Salt-tolerant plant growth promoting rhizobacteria for enhancing crop productivity of saline soils. Front. Microbiol. 2019, 10, 2791. [Google Scholar] [CrossRef]
  64. Earl, A.M.; Losick, R.; Kolter, R. Ecology and genomics of Bacillus subtilis. Trends Microbiol. 2008, 16, 269–275. [Google Scholar] [CrossRef]
  65. Sivasakthi, S.; Usharani, G.; Saranraj, P. Biocontrol potentiality of plant growth promoting bacteria (PGPR)-Pseudomonas fluorescens and Bacillus subtilis: A review. Afr. J. Agric. Res. 2014, 9, 1265–1277. [Google Scholar]
  66. Leontidou, K.; Genitsaris, S.; Papadopoulou, A.; Kamou, N.; Bosmali, I.; Matsi, T.; Mellidou, I. Plant growth promoting rhizobacteria isolated from halophytes and drought-tolerant plants: Genomic characterisation and exploration of phyto-beneficial traits. Sci. Rep. 2020, 10, 14857. [Google Scholar] [CrossRef]
  67. Tahir, H.A.S.; Gu, Q.; Wu, H.; Niu, Y.; Huo, R.; Gao, X. Bacillus volatiles adversely affect the physiology and ultra-structure of Ralstonia solanacearum and induce systemic resistance in tobacco against bacterial wilt. Sci. Rep. 2017, 7, 40481. [Google Scholar] [CrossRef] [PubMed]
  68. Ye, J.; Jensen, M.M.; Goonesekera, E.M.; Yu, R.; Smets, B.F.; Valverde-Pérez, B.; Domingo-Félez, C. Denitrifying communities enriched with mixed nitrogen oxides preferentially reduce N2O under conditions of electron competition in wastewater. J. Chem. Eng. 2024, 498, 155292. [Google Scholar] [CrossRef]
  69. Din, B.U.; Sarfraz, S.; Xia, Y.; Kamran, M.A.; Javed, M.T.; Sultan, T.; Chaudhary, H.J. Mechanistic elucidation of germination potential and growth of wheat inoculated with exopolysaccharide and ACC-deaminase producing Bacillus strains under induced salinity stress. Ecotoxicol. Environ. Saf. 2019, 183, 109466. [Google Scholar]
  70. Khan, N.; Martínez-Hidalgo, P.; Ice, T.A.; Maymon, M.; Humm, E.A.; Nejat, N.; Hirsch, A.M. Antifungal activity of Bacillus species against Fusarium and analysis of the potential mechanisms used in biocontrol. Front. Microbiol. 2018, 9, 2363. [Google Scholar] [CrossRef] [PubMed]
  71. Khan, M.A.; Asaf, S.; Khan, A.L.; Adhikari, A.; Jan, R.; Ali, S.; Lee, I.J. Plant growth-promoting endophytic bacteria augment growth and salinity tolerance in rice plants. Plant Biol. 2020, 22, 850–862. [Google Scholar] [CrossRef]
  72. Belaouni, H.A.; Bendaha, M.E.A.; Benattia, H.; Medouh, M.; Berini, K.I.; Ben Ahmed, S.; Zitouni, A. Alleviation of salt stress in winter wheat by Pantoea spp. endophytes isolated from spontaneous desert plants of the Sahara. Arch. Phytopathol. Plant Prot. 2022, 55, 2334–2355. [Google Scholar] [CrossRef]
  73. Bhise, K.K.; Dandge, P.B. Alleviation of salinity stress in rice plant by encapsulated salt tolerant plant growth promoting bacteria Pantoea agglomerans strain KL and its root colonization ability. Arch. Agron. Soil Sci. 2019, 65, 1955–1968. [Google Scholar] [CrossRef]
  74. Khan, W.U.D.; Aziz, T.; Maqsood, M.A.; Farooq, M.; Abdullah, Y.; Ramzani, P.M.A.; Bilal, H.M. Silicon nutrition mitigates salinity stress in maize by modulating ion accumulation, photosynthesis, and antioxidants. Photosynthetica 2018, 56, 1047–1057. [Google Scholar] [CrossRef]
  75. Bhise, K.K.; Dandge, P.B. Mitigation of salinity stress in plants using plant growth promoting bacteria. Symbiosis 2019, 79, 191–204. [Google Scholar] [CrossRef]
  76. Rojas-Tapias, D.; Moreno-Galván, A.; Pardo-Díaz, S.; Obando, M.; Rivera, D.; Bonilla, R. Effect of inoculation with plant growth-promoting bacteria (PGPB) on amelioration of saline stress in maize (Zea mays). App. Soil Ecol. 2012, 61, 264–272. [Google Scholar] [CrossRef]
  77. Hussain, K.; Ashraf, M.; Ashraf, M.Y. Relationship between growth and ion relation in pearl millet (Pennisetum glaucum (L.) R. Br.) at different growth stages under salt stress. Afr. J. Plant Sci. 2008, 2, 23–27. [Google Scholar]
  78. González, L.; González-Vilar, M. Determination of Relative Water Content. In Handbook of Plant Ecophysiology Techniques; Reigosa Roger, M.J., Ed.; Springer: Dordrecht, The Netherlands, 2003. [Google Scholar]
  79. Garg, N.; Manchanda, G. Role of arbuscular mycorrhizae in the alleviation of ionic, osmotic and oxidative stresses induced by salinity in Cajanus cajan (L.) Millsp.(pigeonpea). J. Agron. Crop Sci. 2009, 195, 110–123. [Google Scholar] [CrossRef]
Crops 04 00033 g001
Figure 1. Effects of bacterial strains irrigated with saline solution on (A) fresh weight (FW, g), (B) dry weight (DW, g), (C) shoot length (cm), and (D) relative water content (RWC) of tomato plants. Means sharing the same letter are considered relatively similar. The order of the letters (a > b > c > d > e > f) indicates a decreasing value of the means. Some means may belong to multiple groups (for example, ‘cd’ indicates that this mean is relatively similar to the means of groups c and d).
Figure 1. Effects of bacterial strains irrigated with saline solution on (A) fresh weight (FW, g), (B) dry weight (DW, g), (C) shoot length (cm), and (D) relative water content (RWC) of tomato plants. Means sharing the same letter are considered relatively similar. The order of the letters (a > b > c > d > e > f) indicates a decreasing value of the means. Some means may belong to multiple groups (for example, ‘cd’ indicates that this mean is relatively similar to the means of groups c and d).
Crops 04 00033 g001
Crops 04 00033 g002
Figure 2. Effect of bacterial strains on fresh weight (FW, g) and dry weight (DW, g) of tomato plants under saline irrigation.
Figure 2. Effect of bacterial strains on fresh weight (FW, g) and dry weight (DW, g) of tomato plants under saline irrigation.
Crops 04 00033 g002
Crops 04 00033 g003
Figure 3. Fresh weight (FW, g) variation in maize plants with increasing salinity levels.
Figure 3. Fresh weight (FW, g) variation in maize plants with increasing salinity levels.
Crops 04 00033 g003
Crops 04 00033 g004
Figure 4. Photographs of tomato plants irrigated with varying salt concentrations. (A): not inoculated with bacterial suspension 2015-1. (B): inoculated with bacterial suspension 2015-1.
Figure 4. Photographs of tomato plants irrigated with varying salt concentrations. (A): not inoculated with bacterial suspension 2015-1. (B): inoculated with bacterial suspension 2015-1.
Crops 04 00033 g004
Crops 04 00033 g005
Figure 5. Maize growth progression under varying salt concentrations (43 mM, 86 mM, 172 mM, 207 mM) and inoculation with bacterial suspensions.
Figure 5. Maize growth progression under varying salt concentrations (43 mM, 86 mM, 172 mM, 207 mM) and inoculation with bacterial suspensions.
Crops 04 00033 g005
Crops 04 00033 g006
Figure 6. Photographs0 depicting (A,B) size regression, (C) leaf yellowing, and (D) leaf wilting as a function of increasing salt concentration of maize plants.
Figure 6. Photographs0 depicting (A,B) size regression, (C) leaf yellowing, and (D) leaf wilting as a function of increasing salt concentration of maize plants.
Crops 04 00033 g006
Crops 04 00033 g007
Figure 7. Effect of rhizobacteria on (A) root length (cm) and (B) stem diameter (mm) during irrigation of maize plants with five NaCl concentrations.
Figure 7. Effect of rhizobacteria on (A) root length (cm) and (B) stem diameter (mm) during irrigation of maize plants with five NaCl concentrations.
Crops 04 00033 g007
Crops 04 00033 g008
Figure 8. The effect of rhizobacteria on (A) chlorophyll content (CCl), (B) leaf area (mm2), and (C) the number of leaves per plant during irrigation with a range of saline concentrations. Means sharing the same letter are considered relatively similar. The order of the letters indicates a decreasing value of the means. Means may that belong to multiple groups, example, ‘cd’ indicates that this mean is relatively similar to the means of groups c and d.
Figure 8. The effect of rhizobacteria on (A) chlorophyll content (CCl), (B) leaf area (mm2), and (C) the number of leaves per plant during irrigation with a range of saline concentrations. Means sharing the same letter are considered relatively similar. The order of the letters indicates a decreasing value of the means. Means may that belong to multiple groups, example, ‘cd’ indicates that this mean is relatively similar to the means of groups c and d.
Crops 04 00033 g008
Crops 04 00033 g009
Figure 9. PCR amplification of 16S rDNA from five bacterial strains tested.
Figure 9. PCR amplification of 16S rDNA from five bacterial strains tested.
Crops 04 00033 g009
Table 1. Bacterial strains used for seed inoculation.
Table 1. Bacterial strains used for seed inoculation.
Strain CodeOriginSampling Region
2026-2CompostFez-Meknes
2027-2CompostFez-Meknes
2015-1CompostFez-Meknes
2025-1CompostSouss-Massa
2025-11CompostSouss-Massa
Table 2. Analysis of variance (ANOVA) for roots length in treated maize plants.
Table 2. Analysis of variance (ANOVA) for roots length in treated maize plants.
Roots Length
Type III SSddlDSig.
Strain89.3951.4330.250
Concentration398.01 **131.9080.000
Error286.9023--
** significance at p-value < 0.05.
Table 3. Analysis of variance (ANOVA) for chlorophyll content, root length, and stem length in treated tomato plants.
Table 3. Analysis of variance (ANOVA) for chlorophyll content, root length, and stem length in treated tomato plants.
Chlorophyll CClStem Length
Type III SSddlDSig.Type III SSddlDSig.
Strain34.0951.8980.134327.32 **56.9400.000
Concentration83.61 **123.2810.000853.08 **190.4330.000
Error82.6023--216.9623--
** significance at p-value < 0.05.
Table 4. Comparative analysis of 16S rRNA sequences of strains using the NCBI BLASTn Database.
Table 4. Comparative analysis of 16S rRNA sequences of strains using the NCBI BLASTn Database.
Strain CodeIdentified SpeciesAccession Number
12026-2Bacillus cereusKR493006.1
22027-2Acinetobacter calcoaceticusKP170504.1
32015-1Bacillus subtilisKJ592619.2
42025-1Pantoea agglomeransKJ781904.1
52025-11Paenibacillus brasiliensisNR025106
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yahyaoui, H.; El Allaoui, N.; Aziz, A.; Hafidi, M.; Habbadi, K. Minimizing the Adverse Impacts of Soil Salinity on Maize and Tomato Growth and Productivity through the Application of Plant Growth-Promoting Rhizobacteria. Crops 2024, 4, 463-479. https://doi.org/10.3390/crops4040033

AMA Style

Yahyaoui H, El Allaoui N, Aziz A, Hafidi M, Habbadi K. Minimizing the Adverse Impacts of Soil Salinity on Maize and Tomato Growth and Productivity through the Application of Plant Growth-Promoting Rhizobacteria. Crops. 2024; 4(4):463-479. https://doi.org/10.3390/crops4040033

Chicago/Turabian Style

Yahyaoui, Hiba, Nadia El Allaoui, Aziz Aziz, Majida Hafidi, and Khaoula Habbadi. 2024. "Minimizing the Adverse Impacts of Soil Salinity on Maize and Tomato Growth and Productivity through the Application of Plant Growth-Promoting Rhizobacteria" Crops 4, no. 4: 463-479. https://doi.org/10.3390/crops4040033

APA Style

Yahyaoui, H., El Allaoui, N., Aziz, A., Hafidi, M., & Habbadi, K. (2024). Minimizing the Adverse Impacts of Soil Salinity on Maize and Tomato Growth and Productivity through the Application of Plant Growth-Promoting Rhizobacteria. Crops, 4(4), 463-479. https://doi.org/10.3390/crops4040033

Article Metrics

Back to TopTop