Detection of Kelch13 and Coronin Genes in Colpodella sp. ATCC 50594

Abstract

Colpodella species are predatory biflagellates phylogenetically related to pathogenic Apicomplexans. Following the attachment of Colpodella sp. to its prey, cytoplasmic contents of the prey are aspirated into a posterior food vacuole during myzocytosis. Trophozoites also endocytose nutrients as demonstrated by the uptake of 40 and 100 nm nanoparticles in Colpodella sp. ATCC 50594. This nutrient uptake is actin-mediated. However, the markers of myzocytosis and endocytosis are unknown. Furthermore, the relationship between Colpodella sp. ATCC 50594 and Colpodella sp. identified in arthropods, humans, and animals are unknown. In this study, we investigated the conservation of the coronin and Kelch 13 genes in Colpodella sp. ATCC 50594 using polymerase chain reaction (PCR). Kelch 13 distribution in Colpodella sp. ATCC 50594 was investigated using anti-Kelch 13 antibodies by immunofluorescence. Both genes were amplified from Colpodella sp. ATCC 50594. We amplified DNA encoding 18S rRNA with similarity to 18S rRNA amplified using piroplasm primers from the Italian Colpodella sp. identified in cattle and ticks. The detection of the coronin and Kelch 13 genes in Colpodella sp. provides, for the first time, markers for actin binding and endocytosis in Colpodella species that can be investigated further to gain important insights into the mechanisms of nutrient uptake in Colpodella sp.

1. Introduction

Apicomplexans pathogenic in humans and animals have been intensely investigated to understand the mechanisms of transmission and pathogenesis and to discover avenues for the treatment and prevention of infection. Apicomplexans such as Plasmodium spp., Babesia spp., Theileria spp., Cryptosporidium spp., and Toxoplasma gondii infect host cells, reside intracellularly within host cells, and obtain nutrients through a variety of structures including cytostomes and micropores [1,2]. Cryptosporidium spp. develop a feeder organelle at the interface of the parasite and the host epithelial cell [1]. Colpodella species are free-living relatives of the apicomplexa that prey on bodonids, ciliates, and algae [3,4] and have been described from marine, fresh-water, and soil environments [3,4,5]. Oligonucleotide primers targeting 18S rRNA from Cryptosporidium spp., Theileria spp., and Babesia spp. amplify 18S rRNA from Colpodella species identified in several species of ticks, biting flies associated with humans, goats, cattle, camels, horses, dogs, cats, ducks, foxes, and pangolins [[6], Supplementary Table S1, https://www.ncbi.nlm.nih.gov/nuccore/?term=Colpodella (Accessed on 17 January 2025)]. Colpodella spp. have also been detected in blood from human and horse infections as well as in fecal samples from ruminants and a tiger [7,8,9,10]. Reports of Colpodella spp. detection now span a wide geographic area globally that includes Australia and countries in Africa, Asia, Europe, and North, Central, and South America (Table S1), [https://www.ncbi.nlm.nih.gov/nuccore/?term=Colpodella (Accessed on 17 January 2025)]. Colpodella gonderi and C. tetrahymenae prey on ciliates and remain on the ciliates for prolonged periods as ectoparasites, before encysting in the case of C. tetrahymenae [5,11]. Colpodella species are increasingly reported in various species of ticks and biting flies that are associated with the “transmission” of Colpodella spp. into animals such as goats, cats, and dogs [6] and into humans [7,12]. Colpodella spp. have also been identified in fecal samples. Oligonucleotide primers targeting the 18S rDNA of Cryptosporidium spp., Babesia spp., and Theileria spp. have identified Colpodella spp. in routine screenings for Cryptosporidium spp. and piroplasms in animals [8] (Table S1). Reported cases of Colpodella spp. infection in humans and animals suggest both tick-borne and direct transmission mechanisms. Relapsing fever was reported in two human cases [7] (Table S1). In one human case of relapsing fever associated with natural killer (NK) cell deficiency, a blood infection with infected erythrocytes and hemolytic anemia was reported [7]. In a third human case, neurological symptoms and inflammation were reported [12]. An infection of a South China Tiger bitten by a tick showed clinical symptoms of organ swelling, anorexia, whole body jaundice, runny nose, and drooling [8]. Examination of tissues following the death of the tiger showed extensive tissue damage [8]. The only organism identified in ticks from the tiger and ticks from areas around the tiger enclosure was Colpodella spp. Three genera of ticks—Haemaphysalis, Rhipicephalus, and Dermacentor—carried Colpodella spp. and were associated with the tiger infection. Similarly, in the human cases, only Colpodella spp. DNA was detected [7,12] (Table S1). However, the specific mechanisms of Colpodella transmission are currently unknown, and markers associated with transmission, pathogenesis, nutrient uptake, and survival of Colpodella spp. within the vertebrate and arthropod hosts are unknown.

Among the Myzozoans, which comprise apicomplexans, dinoflagellates, and chrompodellids such as Colpodella spp., Voromonas pontica, and Chromera spp., myzocytosis for nutrient uptake has been described [1]. Myzocytosis is a type of endocytosis, where the predator attaches to its prey, takes up the plasma membrane of the prey, degrades the membrane, and aspirates the cytoplasmic contents of the prey as described for Colpodella sp. ATCC 50594 [13]. Among apicomplexans, nutrients are obtained within the host cells by endocytosis along with food vacuole formation such as the process described in Plasmodium spp. and in gregarines [1]. The life cycle of Colpodella spp. consists of a trophozoite and a cyst stage [4,5,14]. A posterior food vacuole is formed in Colpodella sp. at the conclusion of myzocytosis; this is followed by encystation in species that encyst [4,5,14]. The trophozoite stages of Colpodella sp. carry out endocytosis in addition to myzocytosis [15,16], and actin has been shown to be involved in nutrient uptake [15]. However, it is unclear whether endocytosis alone can lead to the encystation and development of juvenile trophozites to continue their life cycle. Additional methods of nutrient uptake have been described, such as phagocytosis and apical phagotrophy [1,17,18], but the mechanisms are unclear, and no molecular markers have been identified. This is an area that needs further investigation. Markers of endocytosis have been identified in Plasmodium falciparum and T. gondii and include Kelch 13, AP-2µ, UBP1, and Eps-15 [19,20]. Kelch 13 has been identified in Myzozoans, including the apicomplexans, dinoflagellates, and chrompodellids [18]. Conserved domains in the Kelch 13 gene are shared among ciliates and other eukaryotes [18]. A stable endocytotic complex identified in T. gondii and located in the inner membrane complex (IMC) has molecular conservation to the cytostome described in Plasmodium spp. [18]. In P. falciparum, the protein VPS45 also plays a role in hemoglobin uptake [20]. The inactivation of VPS45 and Kelch 13 genes leads to decreased hemoglobin uptake, and Kelch 13 depletion disrupts endocytosis and plasma membrane homeostasis in T. gondii [20]. Mutations in the Kelch 13 gene in P. falciparum results in resistance to artemisinin combination therapies (ACTs), bringing focus to the importance of the Kelch 13 gene [19,21,22]. In addition to Kelch 13, mutations in the coronin gene are also associated with resistance to ACT in P. falciparum infections [23,24]. Both Kelch 13 and coronin proteins have roles as actin-binding proteins, with the WD40 domain of P. falciparum coronin binding to F-actin and having additional functions in phagocytosis, locomotion, and proliferation [25,26]. Due to the involvement of actin in myzocytosis in Colpodella sp. ATCC 50594, the formation of the posterior food vacuole, and the demonstration of nutrient uptake by endocytosis in Colpodella sp. ATCC 50594 trophozoites [15], we investigated the conservation of the Kelch 13 and coronin genes in Colpodella sp. ATCC 50594 and evaluated the expression and distribution of the Kelch 13 protein in the life cycle stages of Colpodella sp. ATCC 50594.

2. Materials and Methods

2.1. Diprotist Culture Conditions

The predator Colpodella sp. (ATCC 50594) and its prey Parabodo caudatus in a diprotist culture were obtained from the American-type culture collection (ATCC) (Manassas, VA, USA). Both protists were cultured in Hay medium (Wards Scientific Rochester, New York, NY, USA) bacterized with Enterobacter aerogenes as described previously [27]. The prey species Parabodo caudatus (ATCC 30905) was also maintained in Hay medium, bacterized with E. aerogenes. Both protists in tissue culture flasks were observed using an inverted microscope.

2.2. Genomic DNA Isolation

Diprotist cultures containing Colpodella sp. and P. caudatus, and a monoprotist culture containing P. caudatus, were centrifuged at 1475× g for 15 min; the supernatant was discarded, and the pellet was used for genomic DNA (gDNA) isolation. Plasmodium falciparum schizont pellets were obtained as described previously [27], following hypotonic lysis in 10 mM Tris buffer, pH 8.8. Diprotist, monoprotist, and P. falciparum schizont pellets were homogenized in a solution of 10 mM Tris-HCl pH 7.6, 50 mM EDTA pH 8.0, 0.1% SDS, and 1 mg/mL proteinase K by passing the pellet suspension 30× through a 25 G needle. The homogenate was incubated overnight (O/N) in a 50 °C water bath and processed for DNA extraction as described previously [27].

2.3. Polymerase Chain Reaction and DNA Sequencing

Conventional and nested polymerase chain reaction (PCR) was performed using oligonucleotide primers targeting P. falciparum Kelch 13 and coronin genes. PCR was performed in a total volume of 25 µL containing 13 µL Dream Taq green master mix, 2 µL each of forward and reverse primer, 3–4 µL of template DNA, and nuclease-free water to make up 25 µL for the total reaction volume. For nested PCR, 13 µL Dream Taq green Master Mix, 2 µL each of forward and reverse primers, and 8 µL of DNA from the first round of PCR were used for amplification. Amplified products were separated by electrophoresis on 1.5% agarose gels containing ethidium bromide for visualization. A Gene Ruler 1 kb Plus DNA ladder and 100 bp ladder (ThermoFisher, Carlsbad, CA, USA) were used as standards. Plasmodium falciparum genomic DNA was used as a positive control, and nuclease-free water was added to reaction tubes instead of template DNA serving as a negative control. Amplified products showing single DNA bands on agarose gels were sequenced. Sequencing was performed by MCLAB (San Francisco, CA, USA). The identity of the nucleotide sequences was searched for homology by BLAST in the databases at NCBI (www.ncbi.nlm.nih.gov, (accessed on 4 September 2024)).

Primers for 18S rDNA for Colpodella spp. [28] (18s colpo SY F = AATACCCAATCCTGACACAGGG; R = TTAAATACGAATGCCCCCAAC) were used in PCR as described using the cycling parameters: initial denaturation at 94 °C for 2 min, 30 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 1 min, and a final extension for 7 min at 72 °C. Primers for Kelch 13 were used in a nested PCR. For the Kelch 13 nested PCR, the primary pair of primers designated, (5a) Kelch13 F for SY = GGGAATCTGGTGGTAACAGC and (5a) Kelch13 R for SY = CGGAGTGACCAAATCTGGGA, were used in first round of PCR using the following cycling conditions: denaturation at 95 °C for 1 min, followed by 35 cycles at 95 °C for 20 s, 58 °C for 20 s, and 60 °C for 1 min, with a final extension at 60 °C for 3 min. For nested PCR, a nested pair of primers, (5b) Kelch13 (S) F for SY = GCCTTGTTGAAAGAAGCAGA and (5b) Kelch13 (S) R for SY = GCCAAGCTGCCATTCATTTG, were used for nested PCR, using the following cycling conditions: denaturation at 95 °C for 1 min, followed by 35 cycles at 95 °C for 20 s, 56 °C for 20 s, and 60 °C for 1 min, with a final extension at 60 °C for 3 min. Primers for Kelch 13 [[29], Kelch 13 direct] were used for conventional PCR: Kelch13 Direct PCR; forward— 5′-CTATACCCATACCAA AAGATTTAAGTG-3′, reverse—5′-GCTTGGCCCATCTTTATTAGTTCC C-3′) (from codon 412 to codon 723). The PCR cycling conditions were denaturation at 94 °C 3 min, followed by 10 cycles of 94 °C for 30 s, 57 °C for 30 s, and 72 °C for 30 s, and then 30 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, with a final extension at 72 °C for 3 min.

Primers for Kelch 13 were used for nested PCR as described [30]. The primers ACT-treated Kelch (F-A) CGGAGTGACCAAATCTGGGA and ACT-treated Kelch (R-A) GGGAATCTGGTGGTAACAGC were used for the primary reactions, and ACT-treated Kelch (F-B) GCCAAGCTGCCATTCATTTG and ACT-treated Kelch (R-B) GCCTTGTTGAAAGAAGCAGA were used for the nested reaction. PCR cycling conditions for both the primary and nested reactions included 5 min of initial denaturation at 95 °C, followed by 40 cycles of 30 s, denaturation at 94 °C, 90 s annealing at 60 °C, 90 s extension at 72 °C, and a 10 min final extension at 72 °C.

Primers for Kelch 13 nested Propeller were used for PCR as described [31]: Kelch 13 Propeller (F-A) CGGAGTGACCAAATCTGGGA; Kelch 13 Propeller (R-A) GGGAATCTGGTGGTAACAGC; Kelch 13 Propeller (F-B) TCAACAATGCTGGCGTATGTG; Kelch 13 Propeller (R-B) TGATTAAGGTAATTAAAAGCTGCTCC. For the first round, DNA was denatured at 95 °C for 5 min; this was followed by 40 cycles of denaturation at 94 °C for 30 min, 60 °C for 1 min 30 s, and 72 °C for 1 min 30 s, and final elongation at 72 °C for 10 min. For the second round of PCR, the same amplification parameters were used, with 5 μL of the first PCR product used as template.

Primers for coronin were used in conventional PCR as described [23]. ACT Coronin (F:ATGGCAAGTTGAAGGGGGAG; R:TTGTCTTCACCACCAAATCCA), using the cycling parameters for amplification with denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 56 °C for 45 s, and extension at 68 °C for 30 s, followed by a final extension at 72 °C for 7 min.

For coronin nested PCR, the first round of PCR included the following: 3D7 Coronin (F-A)-TGATTTGTTCATATTATA GGTAC-3′ and 3D7 Coronin (R-A)-TATTCTGAC AAGTTCCACTTAATA. The cycling program was as follows: 30 s at 90 °C; followed by 30 cycles of 20 s at 90 °C, 30 s at 45 °C, and 1.30 min at 68 °C. For the nested PCR, the following were used: 3D7 Coronin (F-B)-CATATTATAGGTACCATG GCAAGTT and 3D7 Coronin (R-B)-AGGCTT CTTCTCATTTTCTATATC. For the nested PCR, primary PCR products were amplified under the same conditions using the following cycling program: 30 s at 90 °C; followed by 45 cycles of 15 s at 94 °C, 30 s at 50 °C, and 1 min at 68 °C. All PCR products were analyzed by electrophoresis on agarose gels (Table S2).

2.4. Phylogenetic Tree Analysis

Phylogenetic tree reconstruction was performed using the Colpodella sp. 18S rRNA, coronin, and Kelch 13 DNA sequences, along with DNA sequences retrieved from the NCBI database in order to determine the phylogenetic relationship between the Colpodella DNA sequences, with DNA sequences from related Apicomplexan species. Phylogenetic tree reconstruction was performed using NCBI distance tree construction following a BLAST search (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 30 November 2024)) as well as a phylogenetic tree analysis conducted using maximum likelihood using the PhyML (aLRT) program (https://www.phylogeny.fr/index.cgi (accessed on 30 November 2024)) following DNA sequence alignment by MUSCLE.

2.5. Immunofluorescence and Confocal Microscopy

Immunofluorescence and confocal microscopy was performed on Colpodella sp. and P. caudatus diprotist culture as described previously [27] using 5% formalin-fixed cells. Formalin-fixed cells from diprotist cultures were permeabilized with 0.1% Triton X-100 for 5 min, washed three times with 1× PBS, then blocked in 3% bovine serum albumin (BSA) for 30 min followed by three washes in 1× PBS. Briefly, smears were incubated with an anti-Kelch 13 mouse monoclonal antibody Mab K13, clone D9 (a gift from Dr. David Fidock, Columbia University, Irving Medical Center, New York, NY, USA), diluted 1:500 and 1:1000. Incubation with the primary antibody was carried out for 1 h at 37 °C; slides were washed three times with 1× PBS and then incubated for 1 h with secondary rabbit anti-mouse antibody conjugated to Alexa 488 diluted 1:500 (Molecular Probes, ThermoFisher Scientific). The smears were washed three times with 1× PBS followed by one wash in distilled water. Fluoroshield mounting medium containing 4′, 6-diamidino-2-phenylindole (DAPI; (Abcam, Waltham, MA, USA) or ProLong Diamond Antifade Mountant with DAPI (Invitrogen by ThermoFisher Scientific, Life Technologies Corporation, Eugene, OR, USA) was used to mount the slides. Normal mouse serum (NMS) was used as a negative control for IFA. Images were collected using a Leica TCS-SP5II upright laser scanning confocal microscope (Leica Microsystems, GmbH, Wetzlar, Germany). In addition, an SP8 True Scanning Confocal (TCS) on a DMI8 inverted microscope was used to generate differential interference contrast (DIC) images. Scale bars were inserted in confocal images using ImageJ (version 1.54m). Sam-Yellowe’s trichrome-stained and confocal images were adjusted to 300 dpi using the CYMK color mode and RGB color mode on Adobe Photoshop (CS6). Confocal microscopy was performed at the Cleveland Clinic, Lerner Research Institute Imaging Core, Cleveland, OH, USA.

3. Results

During the life cycle of Colpodella sp. ATCC 50594, trophozoites prey on the trophozoites of Parabodo caudatus and aspirate cytoplasmic contents of the prey into a posterior food vacuole in the process of myzocytosis. Using Sam-Yellowe’s trichrome staining for light microscopy, the enlarged posterior food vacuole can be observed while the Colpodella trophozoite is still attached to its prey (Figure 1A,B, yellow arrows). Following myzocytosis, the pre-cyst, still containing the food vacuole with aspirated contents from the prey (Figure 1A,C,D, orange arrows), will develop into a cyst.

We investigated the conservation of Kelch 13 and coronin genes in Colpodella sp. ATCC 50594 using oligonucleotide primers targeting Kelch 13 and coronin genes from P. falciparum using conventional and nested PCR. We also investigated the relationship of Colpodella sp. ATCC 50594 to the recently identified Colpodella species from ticks reported from Italy and using Colpodella sp. ATCC 50594 DNA templates extracted from two different diprotist cultures and a monoprotist culture containing only P. caudatus. Figure 2A shows amplified coronin DNA bands of approximately 368 bp from Colpodella sp. ATCC 50594 identified in lane 2 and from P. falciparum (strain HB3) in lane 4. The Kelch 13 gene was also amplified from P. falciparum (HB3) in lanes 2 and 3 as well as in Colpodella sp. using nested PCR in lane 4 (Figure 2B). Primers targeting a partial region of 18S rRNA genes for piroplasm parasites [28] amplified DNA bands of approximately 408 bp shown in lanes 6 and 7 (Figure 2B). BLAST (BLASTn) searches of DNA sequences were performed using the NCBI databases (https://blast.ncbi.nlm.nih.gov/Blast (accessed on 30 November 2024)) to identify homologous DNA sequences. Nucleotide sequence identities of 100%, 99.67%, and 99.01% were obtained with Colpodella sp. ATCC 50594 18S rDNA amplified using the Piro primers in the current study. Sequence identities of 97.82% and 97.55% were obtained with Colpodella isolates 103 and 115, respectively, identified from horse blood and 89.2% sequence identity to Cryptosporidium sp. isolate NJ3559, from BLAST searches.

The DNA sequence for the amplified coronin DNA BLAST search in the database matched the coronin gene of P. falciparum. The nucleotide sequence of the Colpodella sp. ATCC 50594 coronin gene showed 99.34% sequence identity to the P. falciparum coronin gene and 96.39%, 93.73%, and 93.07% sequence identities, respectively, to the P. reichenowi, P. gaboni, and Plasmodium sp. gorilla clade G2 coronin gene. A BLAST search of the nucleotide sequences obtained for the Colpodella sp. ATCC 50594 Kelch 13 gene showed 100% sequence identity to P. falciparum Kelch 13. Phylogenetic tree reconstruction was performed using the Colpodella sp. 18S rRNA, coronin, and Kelch 13 DNA sequences obtained in the current study and DNA sequences were retrieved from the NCBI database in order to determine the phylogenetic relationship between the Colpodella DNA sequences with DNA sequences from related Apicomplexan species.

A phylogenetic tree analysis of Colpodella sp. ATCC 50594 18S rRNA, performed along with sequences retrieved from the NCBI database, is shown in Figure 3. This larger phylogenetic tree reconstruction performed within NCBI BLAST distance tree analysis shows a clade containing Cryptosporidium spp. sequences more closely related to Colpodella sp. ATCC 50594 as a paraphyletic clade. The Colpodella sp. clone Kc2-17 detected in a cat (Table S1) is a sister to the DNA sequences from Colpodella sp. ATCC 50594 but branched separately. The 18S rRNA gene sequence obtained from the current study also groups with most of the 18S rRNA gene sequences retrieved from the NCBI database, in a large clade identified from sheep and dog ticks, pangolin ticks, and ticks associated with relapsing fever in two human cases, in a tree analysis conducted using maximum likelihood using PhyML (aLRT) program (http://www.phylogeny.fr/index.cgi (accessed on 30 November 2024)) (Figure 4). The Colpodella angusta (isolate Zotu 1986) 18S rRNA gene sequences branched separately from the rest of the sequences.

Phylogenetic tree analysis of Colpodella sp. ATCC 50594 coronin gene, along with five sequences retrieved from the NCBI database and P. falciparum HB3 coronin DNA sequenced in the current study, was conducted using maximum likelihood using PhyML (3.1/3.0 aLRT), which showed both coronin gene sequences clustered within a clade containing P. falciparum isolates. DNA sequences from Dictyostelium discoideum were branched separately from the Plasmodium and Colpodella sequences (Figure 5). In a more expanded phylogenetic tree reconstruction performed using NCBI distance tree construction, the Colpodella sp. ATCC 50594 coronin gene was closely clustered with Plasmodium falciparum Pf coronin gene alleles KG278d14 and KG278d0 and more distantly related to the coronin genes from P. reichenowi, P. gaboni, and the Plasmodium sp. gorilla clade (Figure 6).

Phylogenetic tree reconstruction was performed using the DNA sequences obtained for the Colpodella sp. ATCC 50594 Kelch 13 gene in the current study, along with four sequences retrieved from NCBI and P. falciparum HB3 sequences obtained in the current study. Following analysis by PhyML, all sequences were seen to be closely related (Figure 7). An expanded phylogenetic tree analysis showed the Colpodella sp. ATCC 50594 Kelch 13 gene to be in the same cluster with 25 Plasmodium falciparum isolates. Plasmodium falciparum isolate KBG-05-15 was separate from the 25 isolates as seen in Figure 8.

In order to determine the localization of the Kelch 13 protein in Colpodella sp. ATCC 50594 life cycle stages, we performed immunofluorescence and confocal microscopy using an anti-PfKelch 13 monoclonal antibody. Figure 9A,C,E,G show the antibody’s reactivity with the posterior food vacuole of Colpodella trophozoites attached to prey (Figure 9A,C) and in the pre-cyst stage (Figure 9E,G). DAPI-stained nuclei and kinetoplasts aspirated from the prey were detected in the food vacuole of Colpodella sp. (Figure 9A,B,E,F,I,J).

4. Discussion

In this study, we investigated the conservation of the Kelch 13 and coronin genes in Colpodella sp. ATCC 50594. The 18S rRNA gene from Colpodella sp. ATCC 50594 was also investigated to determine the phylogenetic relationship to 18S rRNA genes identified from ticks associated with various animals and two human cases of Colpodella infection. Colpodella sp. ATCC 50594 obtains nutrients by myzocytosis and endocytosis. Colpodella trophozoites attach to P. caudatus trophozoites in a process known as myzocytosis by engulfing the plasma membrane of the prey, degrading the membrane, and aspirating the cytoplasmic contents of the prey into a posterior food vacuole [13]. Colpodella trophozoites also perform endocytosis for nutrient uptake and have been shown to take up nanobeads of 40 and 100 nm [15]. Following myzocytosis, encystation occurs in cyst-forming Colpodella species [4,5,14]. The mechanisms of nutrient uptake are unknown among Colpodella species. However, the process of attachment and tether formation by Colpodella trophozoites is actin-mediated due to the distortion of the tether observed following cytochalasin D treatment [13].

Markers of endocytosis and myzocytosis have not been identified in Colpodella species. In P. falciparum, several molecules have been identified as markers of endocytosis. These include Kelch 13, adaptor protein-2µ (AP-2µ), ubiquitin carboxyl-terminal hydrolase (UBP1), epidermal growth factor receptor substrate-15 (Eps15) [20], coronin [25], and VPS45, a protein directly involved in host cell cytosol uptake in P. falciparum [20,32]. The inactivation of VPS45 results in a decreased uptake of cytoplasmic contents into the digestive vacuole (food vacuole) of P. falciparum [20,32]. Of these proteins, Kelch 13 is reported to be a conserved protein associated with endocytosis among myzozoans [18]. However, the gene has not been reported in Colpodella species. Similarly, the coronin gene has not been reported in Colpodella species. We report the detection of coronin and Kelch 13 genes in Colpodella sp. ATCC 50594. Amplified DNA sequences from Colpodella sp. ATCC 50594 had high sequence identity to different strains of Plasmodium falciparum, e.g., 99.34% similarity to P. falciparum (3D7), 99.02% to P. falciparum (KG305d0), and 96.7% similarity to P. falciparum (IJ026D7). DNA sequence identity was also detected in P. reichenowi (96.39%), P. gaboni (93.73%), and P. gorilla clade G2 (93.07%). Colpodella sp. ATCC 50594 Kelch 13 DNA sequences had 100% identity to DNA sequences from several different strains of P. falciparum. These data suggest a high level of gene conservation for the coronin and Kelch 13 genes in Colpodella sp. ATCC 50594. In order to gain a better understanding of the function of both genes in the life cycle of Colpodella, additional Colpodella species would need to be investigated to determine the role of coronin and Kelch 13 in myzocytosis and endocytosis.

Cellular structures used for endocytosis have been identified in P. falciparum, such as the cytostome [19] and micropores in both P. falciparum and Toxoplasma gondii [2,33]. Pores present on the parasitophorous vacuole membrane (PVM) of T. gondii and P. falciparum could allow for the transport of nutrients and other metabolites across the PVM [34]. The endosomal and phagosomal pathways utilized for nutrient uptake and degradation among the apicomplexa remain areas that are poorly understood and merit further investigations. In the current study, anti-P. falciparum Kelch 13 antibodies cross-reacted with Colpodella sp. proteins in the food vacuole. However, the role of Kelch 13 in the formation of the myzocytic aperture or uptake of the prey’s cytoplasmic contents is unknown. Antibodies specific for the coronin protein were unavailable for use in coronin localization in this study. Therefore, it is unclear whether Kelch 13 and coronin are present in the same compartments or whether both proteins function at the same time periods in the life cycle during myzocytosis and food vacuole formation. Colpodella species have been identified in several tick species and biting flies associated with cattle, small ruminants, dogs, cats, camels, pangolins, and two cases of relapsing fever in humans [[6], Table S1]. Colpodella spp. have also been identified from animal skin, blood, and fecal samples and in different environmental sources such as in cattle manure, mine caves, lake water, wastewater, and thrombolithic mats (Table S1). The potential for zoonotic infections caused by Colpodella species poses a public health concern. Therefore, being able to identify species and strains using specific molecular markers is crucial. The morphology of the different Colpodella species recently identified by PCR from arthropods, humans, animals, and environmental sources is unknown, and none have been cultured. Staining and microscopy will be required to aid morphological characterization, diagnosis, and investigations of the life cycles of newly identified Colpodella species. Previously identified species such as Colpodella tetrahymenae have also been identified in ticks and biting flies (Table S1). In our previous studies, we have used Sam-Yellowe’s trichrome staining to identify and differentiate the life cycle stages of Colpodella sp. ATCC 50594. This has aided confocal and electron microscopic analysis of Colpodella sp. ATCC 50594 morphology [13,16]. The phylogenetic relationship obtained via analysis of the 18S rRNA of Colpodella species shows that different species and strains of Colpodella are represented in the DNA sequences obtained, and some of these sequences demonstrate close relationships with the apicomplexans Cryptosporidium spp. and Theileria spp. Primers for Cryptosporidium spp. and piroplasms such as Theileria spp. and Babesia spp. have amplified Colpodella species 18S rRNA from ticks and from fecal samples [8,10,35,36,37]. Colpodella spp. have been identified in Stomoxys indicus on horses [38] and in six genera of ticks: Ixodes persulcatus, Rhipicephalus (Boophilus) microplus, R. bursa, R. duttoni, Haemaphysalis longicornis, H. flava, H. bispinosa, H. hystricis, Hyalomma dromedarii, Dermacentor everestianus, D. nuttalli, D. andersoni, D. atrosignatus, D. taiwanensis, and Amblyomma javanense [8,12,28,34,36,37,39] (Table S1). Whether the ticks are true biological vectors capable of transmitting Colpodella infection is presently unknown. Two major unanswered questions are how Colpodella species survive within arthropod, mammalian, and avian hosts and what they use as a nutrient source. It is also unclear if Colpodella species have host specificity for different arthropod and vertebrate hosts. Colpodella sp. co-infections with bacteria [28,39,40,41] and piroplasms [39,40] in ticks have been reported. Direct detection of Colpodella sp. DNA in blood samples of a human [7], a dog and a cat [34], a horse [9], and cattle [42] is suggestive of direct transmission. However, the mode of transmission and the life cycle stages present in arthropods and vertebrate hosts are currently unknown.

The detection of antibody reactivity with the food vacuole of Colpodella sp. represents the first time a marker for endocytosis has been identified within the food vacuole in Colpodella species. Kelch 13 specific antibody reactivity was identified within the digestive vacuole, cytoplasm, plasma membrane, and endoplasmic reticulum (ER) of P. falciparum [43], demonstrating that structures involved with the uptake of nutrients into the food vacuole can be identified. Electron microscopy will be required to confirm the specific structures involved with the food vacuole and their distribution within the trophozoite of Colpodella sp. ATCC 50594. The demonstration that the coronin and Kelch 13 genes are conserved in Colpodella sp. ATCC 50594 will pave the way for the identification of other important genes that will provide insights into life cycle stage transitions and the process of nutrient uptake in culture, in the environment, and within the arthropod and vertebrate hosts infected by Colpodella species.