Next Article in Journal
Fat Profiles of Milk and Butter Obtained from Different Dairy Systems (High and Low Pasture) and Seasons (Spring and Fall): Focus on Healthy Fatty Acids and Technological Properties of Butter
Previous Article in Journal
Embryonic and Fetal Mortality in Dairy Cows: Incidence, Relevance, and Diagnosis Approach in Field Conditions
Previous Article in Special Issue
Dietary Factors and Production Season Effect on the Properties of Goat Cheese
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Coconut Fatty Acid Distillate Ca-Soap with Different Calcium Sources: Effects of Varied Proportions of Protected and Unprotected Fat Supplementation in Dairy Rations

1
Study Program of Nutrition and Feed Science, Graduate School, IPB University, Bogor 16680, Indonesia
2
Department of Nutrition and Feed Technology, Faculty of Animal Science, IPB University, Bogor 16680, Indonesia
3
Graduate School of Agriculture, Hokkaido University, Sapporo 060-8589, Japan
4
Research Center for Applied Zoology, National Research and Innovation Agency (BRIN), Cibinong 16911, Indonesia
*
Author to whom correspondence should be addressed.
Dairy 2024, 5(3), 542-554; https://doi.org/10.3390/dairy5030041
Submission received: 7 July 2024 / Revised: 19 August 2024 / Accepted: 27 August 2024 / Published: 13 September 2024

Abstract

This study aimed to compare calcium oxide (CaO) and calcium chloride (CaCl2) as calcium sources for coconut fatty acid distillate (CFAD) calcium soap (Ca-soap) production and to evaluate the supplementation ratios of unprotected and protected CFAD in dairy rations to optimize rumen function. This research included two steps: (1) assessing the protection strength of Ca-soap made with CaO and CaCl2 at mole ratios of Ca to CFAD of 1, 1.5, 2, and 2.5; (2) evaluating CFAD supplementation in an in vitro dairy ration study using a 5 × 4 randomized factorial block design. Factor A compared unprotected and protected CFAD ratios of A1 = 100:0, A2 = 75:25, A3 = 50:50, A4 = 25:75, and A5 = 0:100, and factor B compared supplementation levels of B1 = 0%, B2 = 1%, B3 = 2%, and B4 = 3%. CaCl2 at a 2.5-mole ratio to CFAD produced the lowest acid value and the carboxylic acid (C=O) chemical bond. Complete protection (0:100) exhibited the highest densities of Bacteroides and nutrient digestibility (p < 0.05) without significantly affecting rumen fermentability (p > 0.05). Higher CFAD levels significantly reduced methanogens and protozoa (p < 0.05) without significantly affecting estimated methane production. In conclusion, CaCl2 at a 2.5-mole ratio to CFAD provided the best protection, and its complete protection in CFAD supplementation optimized rumen function.

1. Introduction

Coconut fatty acid distillate (CFAD) is a by-product generated during the physical refining of coconut oil, particularly during the deodorizing process. This process removes odors and reduces moisture levels in the oil, resulting in two main products: coconut cooking oil and CFAD [1]. Indonesia, the world’s leading coconut producer, yielded 17.16 million metric tons of coconuts in 2021 [2]. The by-products, such as meal (ranging from 37.15 to 38.25% [1]) and fatty acid distillate (approximately 30%), are commonly used in soap manufacturing and biodiesel production, but their utilization as animal feed remains limited, requiring optimization.
Coconut fatty acid distillate contains rich medium-chain fatty acids (MCFAs), which can be utilized as an energy supplement and methane inhibitor for dairy cattle. MCFAs are fatty acids with chain lengths between 6 and 12 carbons, which have higher energy density and lower metabolic loss due to beta-oxidation and can access the inner mitochondrial membrane without requiring activation by carnitine [3]. Medium-chain fatty acids exhibit antimicrobial properties and are capable of disrupting the phospholipid membranes of membrane-enclosed pathogens like bacteria [4]. In ruminants, MCFAs could inhibit the growth of bacteria, methanogens [5], and protozoa [6], resulting in reduced methane production [7,8,9,10]. Supplementation with 120 mg/mL MCFAs from coconut oil decreased methane production with lower acetate and higher propionate molar proportions [11]. Methane reduction with the supplementation of unprotected coconut oil was associated with changes in the structure of the archaeal community, and it also decreased digestibility linearly [3,9].
The use of protected fat, produced using the calcium soap (Ca-soap) technique, was found to potentially enhance rumen safety for dairy cows [12,13], although it compromised methane inhibition. In contrast, unprotected coconut oil suppresses methane production but negatively affects fiber digestibility [3,10]. Dietary fats interfere with rumen fermentation by incorporating lipids into microbial cell membranes, disrupting membrane integrity and cellular function, altering microbial cell attachment to plant surfaces, and affecting the activity of microbial hydrolytic enzymes [14], resulting in feed digestion reduction. To reduce methane emissions and minimize energy losses, it is crucial to optimize rumen fermentation and improve feed digestion through specific dietary interventions [15]. Balancing the ratio of unprotected to protected CFAD is necessary to maximize energy availability and minimize methane production in the rumen. This approach ensures efficient feed utilization while mitigating the adverse effects on the rumen function caused by unprotected dietary fats.
Calcium soap is a protected fat produced by reacting fat with an alkaline form of oxide or hydroxide to produce granular soap [16], which is affordable for dairy farmers to use. The techniques for producing calcium soap include the modified fusion method using CaO [17] and the double decomposition process using CaCl2 [18]. The quality of calcium soap can be assessed by comparing chemical bonds based on the spectra generated from near-infrared reflectance spectroscopy (NIRS). NIRS is a spectroscopic technique that uses the infrared wavelength region to detect the reflectance of chemical bonds, such as the carboxylic group of C=O [19]. Based on the spectra, the reaction conversion of the raw materials and protected fat can be compared. Unlike the Ca-soap product, the raw material used is rich in free fatty acids in the form of carboxylic acids. A lower C=O indicates that the carboxylic bonds in the fat have been protected in the calcium soap [20]. However, there is limited research using this method to evaluate the quality of Ca-soap with different calcium sources. Additionally, there is a lack of research on the effect ratio of unprotected to protected CFAD supplementation in dairy rations, particularly concerning rumen function, methane reduction, and microbial populations.
This study hypothesizes that different calcium sources may produce CFAD Ca-soaps of varying quality and protection ratios, potentially impacting rumen function enhancement and methane reduction in different ways. The aim was to compare calcium oxide (CaO) and calcium chloride (CaCl2) as calcium sources for CFAD Ca-soap production based on their bonding strength using NIRS, as well as to evaluate the ratio of unprotected to protected CFAD supplementation in dairy rations to optimize rumen function, methane inhibition, and microbial populations.

2. Materials and Methods

2.1. Ethical Approval

The in vitro study using rumen fluids from fistulated cattle in this experiment was approved by The Animal Ethics Committee School of Veterinary Medicine and Biomedical Sciences, IPB University (No. 113/KEH/SKE/IX/2023).

2.2. Sample Preparation

Coconut fatty acid distillate was collected from a coconut oil refinery in Indonesia. Ca-soap is produced using two methods depending on the calcium source: a modified fusion reaction using CaO [17] and a double decomposition process using CaCl2 [18]. The best-protected CFAD was determined by comparing the acid value and carboxylic acid chemical bonds, as assessed by NIRS. The lowest acid value and carboxylic acid reflectance indicated optimal protection with the highest conversion of free fatty acids into Ca-soap, which was used for the in vitro study. Unprotected CFAD refers to raw materials used for CFAD. The best-practice dairy ration was formulated with a 40:60 forage/concentrate ratio, referring to Anzhany et al. [21] (Table 1). Ruminal fluids from three fistulated Frisian Holstein cattle were collected as inoculants before the morning feeding.

2.3. Measurements of Protected CFAD Quality

The acid value was determined according to ISO 660:1990, following the method of Handojo et al. [17]. NIRS spectra were collected using a Buchi NIRFlex N-500 Solids Cell (Flawil, Switzerland), according to Zahera et al. [24]. The reflectance of chemical bonds was analyzed using NIR-Cal V5.6 with an activated chemical bond module.

2.4. In Vitro Fermentability and Digestibility Measurement

The in vitro fermentability and digestibility were determined using the two-stage method described by Tilley and Terry [25]. This method involves fermentative digestion with ruminal fluid and enzymatic digestion with pepsin–HCl. Samples of 0.5 g were incubated under anaerobic conditions at 39 °C with 10 mL rumen liquor and 40 mL pre-warmed McDougall buffer solution for 48 h per stage. After 4 h in the fermentative stage, samples were collected to measure the total and partial volatile fatty acids (VFAs), ammonia concentration, pH, and microbial populations. Following enzymatic digestion, the samples were filtered through Whatman No. 41 filter paper and stored in porcelain cups. The filter paper and porcelain cup containing the residue were heated in an oven at 105 °C for 24 h to measure dry matter and burned at 600 °C for 4 h to measure organic matter. The blank was prepared using residues of fermented origin without a sample [26].
The rumen pH was measured using a pH meter (Hanna Instruments, HI98191, Cluj-Napoca, Romania). The ammonia concentration was determined using Conway’s microdiffusion method, and the total VFAs were determined using the steam distillation method according to Despal et al. [26]. The molar proportion of VFA concentrations was determined using Gas Chromatography (GC Bruker S/N BR 1303 M 705 with the Scion 436-GC model; Billerica, MA, USA), equipped with a Bruker-1ms column (0.25 mm ID × 15 m × 0.25 µm; Billerica, MA, USA), and using nitrogen (30 mL/min) and hydrogen (40 mL/min) as carrier gases. Volatile fatty acid profiles were determined using a standard protocol (Supelco Volatile Free Acid Mix; Sigma-Aldrich; Darmstadt, Germany). Estimated methane production was calculated according to Moss et al. [27] using the following formula:
CH4 (%) = (0.45 × acetate) − (0.275 × propionate) + (0.40 × butyrate)

2.5. Microbial Population Measurement

Rumen microbial populations, including total bacteria, methanogens, Butyrivibrio fibrisolvens, Genus Bacteroides, and Streptococcus bovis, were assessed using quantitative real-time polymerase chain reaction (qRT-PCR). Microbial DNA extracted from rumen fluid supernatants was stored at −30 °C until qRT-PCR analysis. The cycle threshold (CT) of the microbial population was then determined. The specific primers used for each target group and their respective quantities for real-time PCR are listed in Table 2 [28]. The relative quantification method used was the comparative 2−ΔΔCT method, according to Schmittgen and Livak [29]. The total protozoa population was measured as described by Ogimoto and Imai [30].

2.6. Experimental Design and Data Analysis

The first experiment was analyzed descriptively to assess the protective strength of Ca-soap produced by CaO and CaCl2 at various mole ratios of Ca to CFAD (1, 1.5, 2, and 2.5). The observed parameters included the acid value obtained using chemical methods and carboxylic acid (C=O) bonding using NIRS. The calcium source that provided the best protection was used in the second experiment. The second experiment used a factorial randomized block design (5 × 4) with three groups of ruminal fluid. Factor A represented the ratio of unprotected to protected CFAD (100:0, 75:25, 50:50, 25:75, and 0:100), whereas factor B represented the supplementation level (0%, 1%, 2%, and 3%). The assessed parameters included rumen fermentability (pH, ammonia, and VFAs), nutrient digestibility (dry and organic matter digestibility), estimated methane production, and microbial population. Data were analyzed using ANOVA (Analysis of Variance); significant differences (p < 0.05) and trends (p < 0.10) were identified by Tukey’s test using the statistical app SPSS version 25.

3. Results

3.1. Evaluation of the Quality of Protected Ca-Soap CFAD

Figure 1a illustrates the acid value (mg KOH/g sample) of Ca-soap CFAD products produced with different Ca sources and mole ratios of Ca to CFAD. Increasing the mole ratio of Ca to CFAD could reduce the acid value of Ca-soap CFAD when CaO or CaCl2 was used as a calcium source. However, CaCl2-CFAD exhibited a lower acid value than CaO-CFAD, indicating higher conversion of fatty acids into protected fat. The 2.5-mole ratio of Ca to CFAD resulted in the lowest acid value, suggesting it was the most effective method for protecting CFAD. The reflectance of chemical bonds from FT-NIRS compared Ca-soap CFAD with different calcium sources and the lowest acid value (2.5-mole ratio of Ca to CFAD). Figure 1b shows the CFAD, CaO-CFAD, and CaCl2-CFAD spectra, while Table 3 presents the reflectance values of the carboxylic group (C=O str. second overtone of COOH) or carboxylic groups in fatty acids. As shown in Figure 1b and Table 3, CaCl2-CFAD exhibited the lowest carboxylic group reflectance, indicating the highest conversion of fatty acids to protected fat among the tested conditions.

3.2. In Vitro Fermentability and Digestibility

The in vitro fermentability of CFAD, as supplemented to dairy cattle, is shown in Table 4. There was no interaction between the unprotected-to-protected CFAD ratio and the supplementation level (p > 0.05). There were no significant effects on the fermentability parameters, including pH, total VFAs, and ammonia (p > 0.05). The pH ranged from 6.87 to 6.96, which is suitable for microbial growth [26,31]. The total VFAs and ammonia showed the normal range for ruminal fermentation [32], with 101.85 to 121.55 mM and 6.56 to 8.71 mM, respectively. Table 5 shows the in vitro digestibility of CFAD supplementation in dairy cattle. There was no interaction between the unprotected-to-protected CFAD ratio and the supplementation level (p > 0.05). Nutrient digestibility in this study ranged from 56.60% to 63.30% for DMD and 52.74% to 62.01% for OMD, consistent with the findings reported by Anzhany et al. [21]. Complete-protection CFAD (0:100) showed the highest dry matter digestibility (p < 0.05) and tended to enhance organic matter digestibility (p = 0.10). However, increasing supplementation significantly decreased the dry matter and organic matter digestibility (p < 0.05).

3.3. Methane Production and Microbial Population

The molar proportions of VFAs, acetate-to-propionate ratios, and methane production are shown in Table 6. There was no interaction between the unprotected-to-protected CFAD ratio and the supplementation level (p > 0.05). Additionally, there were no significant effects on the molar proportions of VFAs, acetate-to-propionate ratios, or the estimated methane production (p > 0.05). The molar proportion of VFAs for acetate, propionate, butyrate, valerate, and the acetate-to-propionate ratio ranged from 53.09% to 65.72%, 19.26% to 26.66%, 8.33% to 13.85%, 1.08% to 2.58%, and 2.14% to 3.24%, respectively. These findings are consistent with those of previous studies conducted by Patra and Yu [3] and Lee et al. [33], who investigated the effects of coconut oil supplementation. The estimated methane production ranged 22.18–27.12 mol/100 mol, which is similar to the findings of Hidayah et al. [34], who supplemented protected vegetable oils in ruminant feeds. The effects on rumen fermentability and digestibility were related to the microbial populations (Table 7). There was no interaction between the unprotected-to-protected CFAD ratio and the supplementation level (p > 0.05). Increasing levels of CFAD supplementation led to a decrease in the methanogen and total protozoa populations (p < 0.05) without significantly affecting methane production. The supplementation of blended unprotected and protected CFAD did not significantly alter the relative densities of Butyrivibrio fibrisolvens and Streptococcus bovis (p > 0.05). However, a higher ratio of protected CFAD resulted in significantly higher relative densities of the Bacteroides genus (p < 0.05).

4. Discussion

Coconut fatty acid distillates can be converted into Ca-soap via saponification reactions with different calcium sources. Double decomposition and modified fusion are two methods used to produce Ca-soaps [35]. The acid value represents the amount of fatty acids remaining in the Ca-soap; thus, a lower acid value indicates a higher reaction conversion. The double decomposition process using CaCl2 as a calcium source resulted in a lower acid value than the modified fusion process, which used CaO as a calcium source. These results differ from those of Handojo et al. [35], who studied palm fatty acid distillate (PFAD). This difference is attributed to the use of a lower mole ratio of Ca to PFAD. A small stoichiometric mole ratio is insufficient to produce the desired Ca-soap during the double decomposition process. In the present study, the higher mole ratio reduced the acid value. The modified fusion process had a higher acid value because of the subsequent hexane washing process. Hexane washing decreases the acid content of Ca-soap PFAD to 6 mg KOH/g [17].
The protected quality can be evaluated by identifying the chemical bonds of the remaining reactants in the product [20] using NIRS. NIRS is an efficient method for measuring the chemical contents of feed ingredients based on the infrared absorption from the main chemical components. Several studies have characterized the nutritional content of animal feed used in dairy production [24,36,37,38]. The raw material for Ca-soap is rich in free fatty acids, particularly carboxylic acids. The presence of C=O functional groups is typical of carboxylic acid groups [20]. The reflectance of C=O in CaCl2-CFAD with a Ca-to-CFAD mole ratio of 2.5 was lower than that of other CaO-CFAD and raw materials, correlating with the lowest acid value of CaCl2-CFAD. The protection method using CaCl2 as a calcium source and the highest mole ratio (2.5) was the best in this experiment, resulting in the lowest acid value, indicating the highest conversion of fatty acid to Ca-soap.
Coconut fatty acid distillate, rich in MCFAs, can serve as an energy supplement. The antimicrobial properties of CFAD should be considered when evaluating rumen function, including fermentability and digestibility, to ensure proper metabolic pathways in the rumen before its application in dairy cattle. The rumen pH indicates the condition of the rumen and is a crucial factor in determining the efficiency of the fermentation process. Optimal pH conditions are essential to supporting the growth and activity of ruminal microbes and ensuring effective fermentation [39]. The unprotected-to-protected ratio of CFAD supplementation did not significantly affect ruminal pH. Previous studies in protected oils [40] and unprotected oils [26] found that supplementation did not significantly affect ruminal pH up to 3% to 6% level of supplementation. The normal pH levels observed in this study suggest that CFAD does not negatively affect rumen fermentation and supports the activity of rumen microbes that are essential for producing fermentation products, including volatile fatty acids and ammonia.
Rumen fermentation produces VFAs that are absorbed through the rumen wall and serve as the primary sources of energy and glucose for the ruminant hosts [41]. The unprotected-to-protected ratio of CFAD supplementation also did not influence the total VFA content. The result aligns with the findings by Patra and Yu [3], who reported that coconut oil supplementation did not alter the total VFAs. Fats and oils contain glycerol (8% to 14% of total fats), which can be metabolized to VFAs after being released from the oils [3]. Additionally, feed composition can influence the total VFA concentration [42]. Another study investigating dietary protected fats found no significant effect on total VFAs when included in up to five percent in dairy rations [43]. This study utilized 1% to 3% blended unprotected and protected CFAD supplementation with no changes in dietary ration, which may explain why total VFAs did not exhibit a significant effect. Ammonia is produced during rumen fermentation through the microbial degradation of nitrogenous compounds. Excess ammonia in the rumen is absorbed through the rumen wall and converted into urea in the liver and kidneys [44]. Maintaining normal ammonia levels is crucial for proper ruminal function. CFAD supplementation did not affect ammonia levels, which remained within the normal range. This suggests that the fatty acids in CFAD did not inhibit bacterial proteolytic activity [45]. Although this experiment suppressed methanogens and protozoa, it did not affect proteolytic activity in the rumen. Other studies also reported an insignificant effect on ammonia concentration with coconut oil supplementation [3,33].
In vitro digestibility indicates feed degradation by rumen microbes and digestion by digestive enzymes in the post-rumen, which evaluates the effectiveness of feed supplements in dairy nutrition [46]. Complete protection with CFAD significantly enhanced nutrient digestibility, so CFAD is suggested to be utilized in its protected form for dairy cattle. Several studies support an increasing nutrient digestibility through Ca-soap supplementation through in vitro [12] and in vivo [13,47,48] experiments. Protected fats enhance digestibility because of the ionic bonds between calcium ions and fatty acids, which are satisfactorily stable and minimize the effect of fatty acids on rumen microbes [13]. Protected fats are insoluble fats designed to resist microbial fermentation and biohydrogenation in the rumen and remain insoluble at normal rumen pH [43]. The lack of a significant effect on Butyrivibrio fibrisolvens and Streptococcus bovis indicates that CFAD supplementation did not adversely affect the growth of these bacteria. Butyrivibrio fibrisolvens is a critical player in fiber digestion and dominates the fatty acid biohydrogenation community [49]. It may be less sensitive to the lauric acid contained in CFAD. Streptococcus bovis is a lactic acid-promoting bacterium and was initially sensitive to lauric acid in an in vitro study [50]. The treatment did not significantly affect these bacteria, possibly because of the protective effects of lauric acid on CFAD. However, complete-protection CFAD affected the increase in the Bacteroides genus. This genus is linked to the dietary crude fiber content and mainly degrades complex plant structural carbohydrates [28], metabolizes polysaccharides and oligosaccharides, and provides nutrients to the host [51]. The higher relative densities of Bacteroides in the complete-protection CFAD supplementation indicated that the protected fat improved the growth of these bacteria, positively impacting nutrient digestibility. Protective calcium bonds are released in the post-rumen because of the acidic conditions of the abomasum, where HCl is secreted [12]. This release reduced antimicrobial effects in the rumen and enhanced fat absorption in the small intestine, resulting in improved digestibility.
Methane is produced from hydrogen and carbon dioxide in rumen fermentation. Hydrogen production via enteric fermentation can affect methane production. Acetate and butyrate serve as the substrates for hydrogen production, whereas propionate utilizes the hydrogen. Consequently, reducing the proportions of acetate and butyrate can suppress methane production [15,52]. Hristov et al. [53] reported that MCFAs increased propionate levels while decreasing acetate and butyrate levels, leading to methane reduction. However, in this study, supplementation with CFAD containing MCFA did not significantly affect the molar proportion of VFAs and the acetate-to-propionate ratio, which may explain the lack of a significant effect on the estimated methane production. Previous in vitro [3,54] and in vivo [5] studies have demonstrated that coconut oil, rich in MCFAs, could eliminate the protozoa population and reduce methane emissions. In this study, increased levels of CFAD supplementation inhibited the growth of protozoa and methanogens without significantly suppressing methane production. Methanogen reduction can be achieved through defaunation, which involves the removal of protozoa during rumen fermentation [6,55]. Protozoa have a symbiotic relationship with methanogens, facilitating interspecies hydrogen transfer and indirectly influencing methane production. Protozoa are critical for methanogenesis, likely due to their involvement in hydrogen metabolism, which influences both methanogen populations and microbiota composition [55]. Methane production depends on the availability of methanogenic substrates, the inhibition of the methanogenesis pathway, and the toxiSScity to methanogens. In this study, the decrease in the methanogen populations without a reduction in methane production may be attributed to the stable acetate levels, a precursor in the methanogenesis pathway [15,50]. These findings suggest that MCFAs in CFAD act as potent antiprotozoal agents and reduce methanogen populations [33], but do not positively affect methane inhibition.

5. Conclusions

The use of CaCl2 with a 2.5-mole ratio of Ca to CFAD produced the strongest protection for the CFAD Ca-soap, with the lowest acid value and reflectance of the carboxylic groups. Complete-protection CaCl2-CFAD (0:100) resulted in the best rumen function by enhancing nutrient digestibility and the Bacteroides genus. Therefore, it is suggested that complete-protection CaCl2-CFAD supplementation be considered for further in vivo studies on lactating dairy cows.

Author Contributions

Conceptualization, D., I.G.P., S.K. and R.Z.; methodology, D. and R.Z.; validation, D.; formal analysis R.Z., M.I.P. and A.F.; investigation R.Z., M.I.P. and A.F.; resources R.Z. and A.F.; data curation R.Z., M.I.P. and A.F.; writing—original draft preparation, R.Z.; writing—review and editing, D., I.G.P., S.K. and R.Z.; supervision, D., I.G.P. and S.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by IPB University Budget Year 2023 under the Young Scientist Research Grant (Grant No. 11441/IT3/PT.01.03/P/B/2023).

Institutional Review Board Statement

The fistulated cattle used was approved by The Animal Ethics Committee School of Veterinary Medicine and Biomedical Sciences, IPB University (No. 113/KEH/SKE/IX/2023).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available upon request from the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Rahardjo, B.; Jiang, B. An analysis for providing safety in the cooking oil production process through FMECA approach. Int. J. Basic. Appl. Sci. 2016, 5, 151–156. [Google Scholar] [CrossRef] [Scilit]
  2. Statista. Coconut Production Worldwide in 2021, by Leading Country. Available online: https://www.statista.com/statistics/1040499/world-coconut-production-by-leading-producers/ (accessed on 11 November 2023).
  3. Patra, A.K.; Yu, Z. Effects of coconut and fish oils on ruminal methanogenesis, fermentation, and abundance and diversity of microbial populations in vitro. J. Dairy Sci. 2013, 96, 1782–1792. [Google Scholar] [CrossRef] [Scilit]
  4. Jackman, J.A.; Boyd, R.D.; Elrod, C.C. Medium-chain fatty acids and monoglycerides as feed additives for pig production: Towards gut health improvement and feed pathogen mitigation. J. Anim. Sci. Biotechnol. 2020, 11, 44. [Google Scholar] [CrossRef] [Scilit]
  5. Burdick, M.; Zhou, M.; Guan, L.L.; Oba, M. Effects of medium-chain fatty acid supplementation on performance and rumen fermentation of lactating Holstein dairy cows. Animal 2022, 16, 100491. [Google Scholar] [CrossRef] [Scilit]
  6. Nguyen, S.H.; Hegarty, R.S. Effects of defaunation and dietary coconut oil distillate on fermentation, digesta kinetics and methane production of Brahman heifers. J. Anim. Physiol. Anim. Nutr. 2017, 101, 984–993. [Google Scholar] [CrossRef] [Scilit]
  7. Hollmann, M.; Powers, W.J.; Fogiel, A.C.; Liesman, J.S.; Beede, D.K. Response profiles of enteric methane emissions and lactational performance during habituation to dietary coconut oil in dairy cows. J. Dairy Sci. 2013, 96, 1769–1781. [Google Scholar] [CrossRef] [Scilit]
  8. Delgado, D.C.; González, R.; Galindo, J.; Dihigo, L.E.; Cairo, J.; Almeida, M. Effect of the coconut oil on the consumption, digestion of nutrients and methane production in sheep fed with forage and concentrate. Cuba. J. Agric. Sci. 2012, 46, 381–384. [Google Scholar]
  9. Patra, A.K. A meta-analysis of the effect of dietary fat on enteric methane production, digestibility and rumen fermentation in sheep, and a comparison of these responses between cattle and sheep. Livest. Sci. 2014, 162, 97–103. [Google Scholar] [CrossRef] [Scilit]
  10. Yanza, Y.R.; Szumacher-Strabel, M.; Jayanegara, A.; Kasenta, A.M.; Gao, M.; Huang, H.; Patra, A.K.; Warzych, E.; Cieślak, A. The effects of dietary medium-chain fatty acids on ruminal methanogenesis and fermentation in vitro and in vivo: A meta-analysis. J. Anim. Physiol. Anim. Nutr. 2021, 105, 874–889. [Google Scholar] [CrossRef] [Scilit]
  11. Panyakaew, P.; Goel, G.; Lourenço, M.; Yuangklang, C.; Fievez, V. Medium-chain fatty acids from coconut or krabok oil inhibit in vitro rumen methanogenesis and conversion of non-conjugated dienoic biohydrogenation intermediates. Anim. Feed. Sci. Technol. 2013, 180, 18–25. [Google Scholar] [CrossRef] [Scilit]
  12. Wulandari; Widyobroto, B.P.; Noviandi, C.T.; Agus, A. In vitro digestibility and ruminal fermentation profile of ruminant diet in response to substitution of mixture feedstuff protected. Livest. Res. Rural Dev. 2020, 32, 12. [Google Scholar]
  13. dos Santos Neto, J.M.; Silva, J.O.; Meschiatti, M.A.P.; de Souza, J.; Negrão, J.A.; Lock, A.L.; Santos, F.A.P. Increasing levels of calcium salts of palm fatty acids affect production responses during the immediate postpartum and carryover periods in dairy cows. J. Dairy Sci. 2022, 105, 9652–9665. [Google Scholar] [CrossRef] [Scilit]
  14. Jenkins, T.C. Lipid Metabolism in the Rumen. J. Dairy Sci. 1993, 76, 3851–3863. [Google Scholar] [CrossRef] [Scilit]
  15. Hassan, F.; Arshad, M.A.; Ebeid, H.M.; Rehman, M.S.; Khan, M.S.; Shahid, S.; Yang, C. Phytogenic Additives Can Modulate Rumen Microbiome to Mediate Fermentation Kinetics and Methanogenesis through Exploiting Diet–Microbe Interaction. Front. Vet. Sci. 2020, 7, 575801. [Google Scholar] [CrossRef] [Scilit]
  16. Handojo, L.A.; Indarto, A.; Shofinita, D.; Saadi, M.R.; Yulistia, D.; Hasyyati, F.I. Calcium Soap from Palm Fatty Acid Distillate for Ruminant Feed: Reaction Method. Int. J. Eng. Adv. Technol. 2019, 8, 422–425. [Google Scholar]
  17. Handojo, L.A.; Indarto, A.; Shofinita, D.; Meitha, A.; Nabila, R.; Triharyogi, H. Calcium soap from palm fatty acid distillate (PFAD) for ruminant feed: Quality of calcium source. MATEC Web Conf. 2018, 156, 02007. [Google Scholar] [CrossRef] [Scilit]
  18. Kumar, R.; Sivaiah, K.; Reddy, Y.R.; Ekambram, B.; Reddy, T.J.; Reddy, G.V.N. Effect of supplementation of dietary protected lipids on intake and nutrient utilization in Deccani lambs. Trop. Anim. Health Prod. 2006, 38, 151–158. [Google Scholar] [CrossRef] [Scilit]
  19. Grabska, J.; Ishigaki, M.; Beć, K.B.; Wójcik, M.J.; Ozaki, Y. Correlations between Structure and Near-Infrared Spectra of Saturated and Unsaturated Carboxylic Acids. Insight from Anharmonic Density Functional Theory Calculations. J. Phys. Chem. A 2017, 121, 3437–3451. [Google Scholar] [CrossRef] [Scilit]
  20. Handojo, A.; Indarto, D.; Shofinita, M.R.; Saadi, D.; Yulistia, D.; Hasyyati, F.I. Calcium soap from palm fatty acid distillate for ruminant feed: Analysis of Product Quality (FTIR). IJSBB 2018, 2, 1–5. [Google Scholar]
  21. Anzhany, D.; Toharmat, T.; Despal. Ration to Produce Milk High in Conjugated Linoleic Acid (CLA) at Smallholder Dairy Farm: An In Vitro Reconstruction. Am. J. Anim. Vet. Sci. 2022, 17, 130–138. [Google Scholar]
  22. Wardeh, F.M. Models for Estimating Energy and Protein Utilization for Feeds. Ph.D. Thesis, Utah State University, Logan, UT, USA, 1981. [Google Scholar]
  23. Mertens, D.R. Creating a System for Meeting the Fiber Requirements of Dairy Cows. J. Dairy Sci. 1997, 80, 1463–1481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Zahera, R.; Sari, L.A.; Permana, I.G.; Despal. The use of near-infrared reflectance spectroscopy (NIRS) to predict dairy fibre feeds in vitro digestibility. IOP Conf. Ser. Earth Environ. Sci. 2022, 951, 012100. [Google Scholar] [CrossRef] [Scilit]
  25. Tilley, J.M.A.; Terry, R.A. A two stage technique for the in vitro digestion of forage crops. Grass Forage Sci. 1963, 18, 104–111. [Google Scholar] [CrossRef] [Scilit]
  26. Despal, D.; Irmadani, D.; Permana, I.G.; Zahera, R.; Nuraina, N. Effect of Different Unsaturated Fatty Acids Sources on in Vitro Fermentability and Digestibility of Ration in Dairy Cattle. Online J. Anim. Feed. Res. 2022, 12, 154–159. [Google Scholar] [CrossRef] [Scilit]
  27. Moss, A.R.; Jouany, J.P.; Newbold, J. Methane production by ruminants: Its contribution to global warming. Anim. Res. 2000, 49, 231–253. [Google Scholar] [CrossRef] [Scilit]
  28. Putra, L.O.; Suharti, S.; Sarwono, K.A.; Sutikno, S.; Fitri, A.; Astuti, W.D.; Rohmatussolihat, R.; Widyastuti, Y.; Ridwan, R.; Fidriyanto, R.; et al. The effects of heat-moisture treatment on resistant starch levels in cassava and on fermentation, methanogenesis, and microbial populations in ruminants. Vet. World 2023, 16, 811–819. [Google Scholar] [CrossRef] [Scilit]
  29. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [Scilit]
  30. Ogimoto, K.; Imai, S. Atlas of Rumen Microbiology; Societe Press: Tokyo, Japan, 1981. [Google Scholar]
  31. Putri, E.M.; Zain, M.; Warly, L.; Hermon, H. Effects of rumen-degradable-to-undegradable protein ratio in ruminant diet on in vitro digestibility, rumen fermentation, and microbial protein synthesis. Vet. World 2021, 14, 640–648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. McDonald, P.; Edwards, R.; Greenhalgh, J.; Morgan, C.; Sinclair, L.; Wilkinson, R. Animal Nutrition, 7th ed.; Preason Education Limited: England, UK, 2010. [Google Scholar]
  33. Lee, C.; Hristov, A.N.; Heyler, K.S.; Cassidy, T.W.; Long, M.; Corl, B.A.; Karnati, S.K.R. Effects of dietary protein concentration and coconut oil supplementation on nitrogen utilization and production in dairy cows. J. Dairy Sci. 2011, 94, 5544–5557. [Google Scholar] [CrossRef] [Scilit]
  34. Hidayah, N.; Suharti, S.; Wiryawan, K.G. In Vitro rumen fermentation of ration supplemented with protected vegetable oils. Med. Pet. 2014, 37, 129–135. [Google Scholar] [CrossRef] [Scilit]
  35. Handojo, L.A.; Indarto, A.; Shofinita, D.; Saadi, M.R.; Yulistia, D.; Hasyyati, F.I. Calcium soap from palm fatty acid distillate for ruminant feed: Calcium oxide particles size. IMATEC Web of Conf. 2019, 268, 03001. [Google Scholar] [CrossRef] [Scilit]
  36. Evangelista, C.; Basiricò, L.; Bernabucci, U. An overview on the use of near infrared spectroscopy (nirs) on farms for the management of dairy cows. Agriculture 2021, 11, 296. [Google Scholar] [CrossRef] [Scilit]
  37. Mentink, R.L.; Hoffman, P.C.; Bauman, L.M. Utility of near-infrared reflectance spectroscopy to predict nutrient composition and in vitro digestibility of total mixed rations. J. Dairy Sci. 2006, 89, 2320–2326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Coppa, M.; Martin, B.; Agabriel, C.; Chassaing, C.; Sibra, C.; Constant, I.; Graulet, B.; Andueza, D. Authentication of cow feeding and geographic origin on milk using visible and near-infrared spectroscopy. J. Dairy Sci. 2012, 95, 5544–5551. [Google Scholar] [CrossRef] [Scilit]
  39. Yang, Z.; Liu, S.; Xie, T.; Wang, Q.; Wang, Z.; Yang, H.; Li, S.; Wang, W. Effect of Unsaturated Fatty Acid Ratio In Vitro on Rumen Fermentation, Methane Concentration, and Microbial Profile. Fermentation 2022, 8, 540. [Google Scholar] [CrossRef] [Scilit]
  40. Suharti, S.; Nasution, A.R.; Wiryawan, K.G. In vitro rumen fermentation characteristics and fatty acid profiles added with calcium soap of canola/flaxseed oil. Med. Pet. 2017, 40, 171–177. [Google Scholar] [CrossRef] [Scilit]
  41. Gleason, C.B.; Beckett, L.M.; White, R.R. Rumen fermentation and epithelial gene expression responses to diet ingredients designed to differ in ruminally degradable protein and fiber supplies. Sci. Rep. 2022, 12, 2933. [Google Scholar] [CrossRef] [Scilit]
  42. Cherdthong, A.; Wanapat, M. Manipulation of in vitro ruminal fermentation and digestibility by dried rumen digesta. Livest. Sci. 2013, 153, 94–100. [Google Scholar] [CrossRef] [Scilit]
  43. Behan, A.A.; Loh, T.C.; Fakurazi, S.; Kaka, U.; Kaka, A.; Samsudin, A.A. Effects of supplementation of rumen protected fats on rumen ecology and digestibility of nutrients in sheep. Animals 2019, 9, 400. [Google Scholar] [CrossRef] [Scilit]
  44. Shen, J.; Zheng, W.; Xu, Y.; Yu, Z. The inhibition of high ammonia to in vitro rumen fermentation is pH dependent. Front. Vet. Sci. 2023, 10, 1163021. [Google Scholar] [CrossRef] [Scilit]
  45. Adelusi, O.O.; Onwuka, C.F.I.; Anifowose, I.O.; Ojo, V.O.A.; Yusuf, K.O. Effects of mixtures of coconut and palm kernel oil on the rumen fermentation parameters and microbial population of cattle. Livest. Res. Rural Dev. 2023, 27, 136. [Google Scholar]
  46. Anele, U.Y.; Crumel, X.; Olagunju, L.; Compart, D.P. Effects of Yucca schidigera Based Feed Additive on In Vitro Dry Matter Digestibility, Efficiency of Microbial Production, and Greenhouse Gas Emissions of Four Dairy Diets. Dairy 2022, 3, 326–332. [Google Scholar] [CrossRef] [Scilit]
  47. dos Santos Neto, J.M.; de Souza, J.; Lock, A.L. Effects of calcium salts of palm fatty acids on nutrient digestibility and production responses of lactating dairy cows: A meta-analysis and meta-regression. J. Dairy Sci. 2021, 104, 9752–9768. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Golovin, A.; Devyatkin, V. Effect of Protected Vegetable Fats on Nutrient Digestibility and Productivity of Dairy Cows. In Fundamental and Applied Scientific Research in the Development of Agriculture in the Far East; Springer: Cham, Switzerland, 2021; pp. 367–376. [Google Scholar]
  49. Lourenço, M.; Ramos-Morales, E.; Wallace, R.J. The role of microbes in rumen lipolysis and biohydrogenation and their manipulation. Animal 2010, 4, 1008–1023. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Yabuuchi, Y.; Tani, M.; Matsushita, Y.; Otsuka, H.; Kobayashi, Y. Effects of lauric acid on physical, chemical and microbial characteristics in the rumen of steers on a high grain diet. Anim. Sci. J. 2007, 78, 387–394. [Google Scholar] [CrossRef] [Scilit]
  51. Zafar, H.; Saier, M.H. Gut Bacteroides species in health and disease. Gut Microbes 2021, 13, 1–20. [Google Scholar] [CrossRef] [Scilit]
  52. Nguyen, S.H.; Bremner, G.; Cameron, M.; Hegarty, R.S. Methane emissions, ruminal characteristics and nitrogen utilisation changes after refaunation of protozoa-free sheep. Small Rumin. Res. 2016, 144, 48–55. [Google Scholar] [CrossRef] [Scilit]
  53. Hristov, A.N.; Vander Pol, M.; Agle, M.; Zaman, S.; Schneider, C.; Ndegwa, P.; Vaddella, V.K.; Johnson, K.; Shingfield, K.J.; Karnati, S.K.R. Effect of lauric acid and coconut oil on ruminal fermentation, digestion, ammonia losses from manure, and milk fatty acid composition in lactating cows. J. Dairy Sci. 2009, 92, 5561–5582. [Google Scholar] [CrossRef] [Scilit]
  54. Volmer, J.G.; McRae, H.; Morrison, M. The evolving role of methanogenic archaea in mammalian microbiomes. Front. Microbiol. 2023, 14, 1268451. [Google Scholar] [CrossRef] [Scilit]
  55. Qin, W.Z.; Li, C.Y.; Kim, J.K.; Ju, J.G.; Song, M.K. Effects of defaunation on fermentation characteristics and methane production by rumen microbes in vitro when incubated with starchy feed sources. Asian-Australas. J. Anim. Sci. 2012, 25, 1381–1388. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Quality of protected Ca-soap CFAD. (a) Effect of calcium sources and mole ratio of Ca to CFAD on acid value; and (b) NIRS spectra of CFAD compared to Ca-soap from both CaO and CaCl2.
Figure 1. Quality of protected Ca-soap CFAD. (a) Effect of calcium sources and mole ratio of Ca to CFAD on acid value; and (b) NIRS spectra of CFAD compared to Ca-soap from both CaO and CaCl2.
Dairy 05 00041 g001
Table 1. Nutrient composition of dairy ration.
Table 1. Nutrient composition of dairy ration.
Ingredients%
DM 1
Ash *EE 2*CP 3*CF 4*NFE 5TDN 6#NDF 7*NFC 8#
------------------------% DM ------------------------------
Napier grass4014.353.3212.9936.3642.1354.5357.9711.39
Concentrates609.773.9615.1711.4459.6672.3832.2038.90
Total10011.603.7014.3021.4152.6565.2442.5127.89
1 DM = dry matter; 2 EE = Ether Extract; 3 CP = Crude Protein; 4 CF = crude fiber; 5 NFE = Nitrogen-free extract; 6 TDN = total digestible nutrient; 7 NDF = Neutral Detergent Fiber; 8 NFC = Non-Fiber Carbohydrate. * NIRS result. # Calculation results (TDN [22], NFC [23]).
Table 2. Primers used for polymerase chain reaction.
Table 2. Primers used for polymerase chain reaction.
TargetNameSequence (5′-3′)Amount Added (µ)
Total bacteria1114-f
1275-r
CGGCAACGAGCGCAACCC
CCATTGTAGCACGTGTGTAGCC
0.6
0.6
Methanogensq-mcrA-f
q-mcra-r
TTCGGTGGATCDCARAGRGC
GBARGTCGWAWCCGTAGAATCC
1.2
1.2
Butyrivibrio fibrisolvensButFib 2F
ButFib 2R
ACCGCATAAGCGCACGGA
CGGGTCCATCTTGTACCGATAAAT
0.2
0.1
Genus bacteroidesAllBac 296-f
AllBac 412-r
GAGAGGAAGGTCCCCCAC CGCTACTTGGCTGGTTCAG0.2
3.6
Streptococcus bovisStrBoy 2F
StrBoy 2R
TTCCTAGAGATAGGAAGTTTCTTCGG ATGATGGCAACTAACAATAGGGGT8.8
8.8
Table 3. Reflectance value of CFAD, CaO-CFAD, and CaCl2-CFAD.
Table 3. Reflectance value of CFAD, CaO-CFAD, and CaCl2-CFAD.
TreatmentsC=O Str. Second Overtone of COOH
Wavenumber = 5263 cm−1
CFAD 10.8199
CaO-CFAD 20.5453
CaCl2-CFAD 30.1079
1 CFAD = coconut fatty acid distillate; 2 CaO-CFAD = calcium soap from calcium oxide; 3 CaCl2-CFAD = calcium soap from calcium chloride.
Table 4. In vitro fermentability (pH, ammonia, and total VFAs) of CaCl2-CFAD supplementation with unprotected-to-protected ratios in dairy rations.
Table 4. In vitro fermentability (pH, ammonia, and total VFAs) of CaCl2-CFAD supplementation with unprotected-to-protected ratios in dairy rations.
ParametersLevelUnprotected-to-Protected CFAD 1 RatioAverage
100:075:2550:5025:750:100
pH0%6.93 ± 0.066.97 ± 0.066.90 ± 0.106.97 ± 0.066.97 ± 0.066.95 ± 0.03
1%6.87 ± 0.066.97 ± 0.156.97 ± 0.156.90 ± 0.106.90 ± 0.106.92 ± 0.04
2%6.93 ± 0.066.93 ± 0.126.93 ± 0.066.97 ± 0.156.90 ± 0.106.93 ± 0.02
3%6.97 ± 0.066.97 ± 0.156.97 ± 0.156.93 ± 0.066.90 ± 0.106.95 ± 0.03
Average6.93 ± 0.046.96 ± 0.026.94 ± 0.036.94 ± 0.036.92 ± 0.03
Ammonia
(mM)
0%7.69 ± 4.417.57 ± 3.957.85 ± 3.877.78 ± 1.947.42 ± 2.787.66 ± 0.17
1%7.96 ± 3.596.56 ± 1.936.98 ± 2.758.71 ± 3.068.08 ± 3.087.66 ± 0.87
2%8.43 ± 1.576.87 ± 1.938.64 ± 4.067.25 ± 1.67.62 ± 3.537.76 ± 0.76
3%7.47 ± 1.608.15 ± 1.378.71 ± 2.967.76 ± 2.928.43 ± 3.068.10 ± 0.50
Average7.88 ± 0.417.29 ± 0.718.04 ± 0.817.87 ± 0.617.89 ± 0.46
Total VFAs 2
(mM)
0%108.12 ± 13.87113.84 ± 9.97106.12 ± 10.35111.02 ± 7.83114.70 ± 3.12110.76 ± 3.66
1%101.85 ± 9.35116.14 ± 10.42113.75 ± 11.49111.49 ± 9.25111.95 ± 7.50111.04 ± 5.45
2%117.71 ± 20.01114.86 ± 14.00111.18 ± 6.67110.98 ± 13.15107.18 ± 7.95112.38 ± 4.03
3%121.55 ± 12.61108.97 ± 13.73109.69 ± 12.15114.36 ± 10.24115.99 ± 8.16114.11 ± 5.12
Average112.31 ± 8.97113.45 ± 3.13110.19 ± 3.18111.96 ± 1.61112.45 ± 3.90
1 CFAD = coconut fatty acid distillate; 2 VFAs: volatile fatty acids
Table 5. In vitro digestibility of CaCl2-CFAD supplementation with unprotected-to-protected ratios in dairy rations.
Table 5. In vitro digestibility of CaCl2-CFAD supplementation with unprotected-to-protected ratios in dairy rations.
ParametersLevelUnprotected-to-Protected CFAD 1 RatioAverage
100:075:2550:5025:750:100
IVDMD 2
(%)
0%62.48 ± 1.2163.92 ± 0.2763.83 ± 0.2362.71 ± 0.9863.56 ± 1.2263.30 ± 0.66 a
1%62.84 ± 2.3161.64 ± 0.5562.72 ± 1.3461.27 ± 0.6262.38 ± 3.1162.17 ± 0.69 ab
2%60.25 ± 2.0160.86 ± 0.5260.80 ± 2.9561.22 ± 2.3863.45 ± 1.6761.32 ± 1.24 b
3%56.60 ± 3.3057.94 ± 1.2959.06 ± 0.6162.42 ± 2.4262.22 ± 1.8859.65 ± 2.59 c
Average60.54 ± 2.21 b61.09 ± 0.66 ab61.60 ± 1.28 ab61.90 ± 1.60 ab62.90 ± 0.70 b
IVDMO 3
(%)
0%59.67 ± 1.2161.72 ± 0.2761.47 ± 0.2360.07 ± 0.9861.06 ± 1.2260.80 ± 0.89 a
1%60.07 ± 2.3158.59 ± 0.5559.55 ± 1.3458.39 ± 0.6259.62 ± 3.1159.24 ± 0.72 ab
2%56.75 ± 2.0157.63 ± 0.5257.63 ± 2.9558.09 ± 2.3860.80 ± 1.6758.18 ± 1.54 bc
3%52.74 ± 3.3057.39 ± 1.2956.76 ± 0.6159.72 ± 2.4259.31 ± 1.8857.18 ± 2.78 c
Average57.30 ± 3.3958.83 ± 1.9958.85 ± 2.1059.07 ± 0.9860.20 ± 0.86
a–c Means in the same column with different superscripts are significantly different (p < 0.05). a,b Means in the same row with different superscripts are significantly different (p < 0.05). 1 CFAD = coconut fatty acid distillate; 2 IVDMD = in vitro dry matter digestibility; 3 IVDMO = in vitro organic matter digestibility.
Table 6. Molar proportion of VFAs, acetate-to-propionate ratio, and methane production of CaCl2-CFAD supplementation with unprotected-to-protected ratios in dairy rations.
Table 6. Molar proportion of VFAs, acetate-to-propionate ratio, and methane production of CaCl2-CFAD supplementation with unprotected-to-protected ratios in dairy rations.
ParametersLevelUnprotected-to-Protected CFAD 1 RatioAverage
100:075:2550:5025:750:100
Acetate (%)0%59.89 ± 5.7956.71 ± 8.5060.57 ± 12.7261.00 ± 7.9563.10 ± 6.0360.25 ± 2.31
1%57.73 ± 9.7954.86 ± 9.4455.98 ± 4.0165.72 ± 3.7455.55 ± 6.1657.97 ± 4.46
2%56.41 ± 6.2162.63 ± 4.6962.65 ± 7.3056.22 ± 4.3257.09 ± 8.3059.00 ± 3.34
3%53.09 ± 5.8253.57 ± 6.2558.48 ± 4.8261.15 ± 8.2357.00 ± 8.3756.66 ± 3.39
Average56.78 ± 2.8556.94 ± 4.0159.42 ± 2.8661.02 ± 3.8858.19 ± 3.35
Propionate (%)0%22.61 ± 1.8524.25 ± 6.8219.26 ± 2.720.12 ± 3.2321.16 ± 2.3621.48 ± 1.99
1%23.76 ± 2.6922.05 ± 3.0223.42 ± 2.521.04 ± 2.724.29 ± 5.2422.91 ± 1.34
2%23.74 ± 2.7221.18 ± 5.3320.17 ± 1.0923.05 ± 4.3622.39 ± 5.6122.11 ± 1.44
3%25.76 ± 6.5426.66 ± 7.9823.52 ± 1.1522.01 ± 2.2825.07 ± 2.3724.60 ± 1.85
Average23.97 ± 1.3123.54 ± 2.4521.59 ± 2.221.56 ± 1.2623.23 ± 1.78
n-Butyrate (%)0%11.39 ± 4.0212.29 ± 4.5612.48 ± 5.6313.01 ± 3.0810.96 ± 4.0112.03 ± 0.83
1%12.02 ± 6.9613.68 ± 2.9112.34 ± 2.178.33 ± 2.6812.73 ± 2.9411.82 ± 2.05
2%13.78 ± 3.7410.78 ± 0.8110.83 ± 3.312.54 ± 4.111.72 ± 3.8611.93 ± 1.26
3%13.85 ± 4.8613.52 ± 0.8213.22 ± 4.2812.18 ± 5.2212.64 ± 5.0713.08 ± 0.67
Average12.76 ± 1.2512.56 ± 1.3412.22 ± 111.51 ± 2.1512.01 ± 0.84
Iso-Butyrate (%)0%2.18 ± 1.072.59 ± 1.262.65 ± 1.361.98 ± 0.871.69 ± 0.642.22 ± 0.41
1%1.82 ± 0.783.39 ± 1.562.94 ± 0.781.67 ± 0.963.12 ± 1.92.59 ± 0.79
2%1.33 ± 0.411.96 ± 0.552.27 ± 1.213.01 ± 1.563.13 ± 2.282.34 ± 0.75
3%3.02 ± 2.072.48 ± 1.261.65 ± 0.271.68 ± 0.492.03 ± 0.672.17 ± 0.58
Average2.09 ± 0.712.61 ± 0.592.38 ± 0.562.09 ± 0.632.49 ± 0.75
Iso-Valerate (%)0%2.10 ± 1.072.58 ± 1.632.52 ± 1.232.17 ± 1.082.01 ± 1.162.28 ± 0.26
1%2.59 ± 1.993.43 ± 1.552.97 ± 0.941.50 ± 0.162.11 ± 0.472.52 ± 0.75
2%2.76 ± 2.141.99 ± 0.852.31 ± 1.592.86 ± 0.713.09 ± 1.712.60 ± 0.44
3%2.58 ± 2.052.16 ± 0.781.79 ± 0.621.70 ± 0.51.95 ± 0.512.04 ± 0.35
Average2.51 ± 0.292.54 ± 0.642.4 ± 0.492.06 ± 0.62.29 ± 0.54
n-Valerate (%)0%1.84 ± 0.991.58 ± 1.932.51 ± 2.151.72 ± 1.241.08 ± 0.091.75 ± 0.52
1%2.07 ± 1.792.58 ± 0.892.35 ± 0.41.75 ± 0.72.2 ± 0.962.19 ± 0.31
2%1.99 ± 1.31.45 ± 0.341.77 ± 1.492.32 ± 0.212.58 ± 1.532.02 ± 0.44
3%1.70 ± 0.771.62 ± 0.471.35 ± 0.121.27 ± 0.491.31 ± 0.171.45 ± 0.19
Average1.90 ± 0.161.81 ± 0.522.00 ± 0.541.77 ± 0.431.79 ± 0.71
A:P 2 Ratio0%2.65 ± 0.222.47 ± 0.753.24 ± 1.023.12 ± 0.853.02 ± 0.542.90 ± 0.32
1%2.43 ± 0.382.55 ± 0.742.41 ± 0.383.17 ± 0.512.39 ± 0.752.59 ± 0.33
2%2.40 ± 0.353.15 ± 1.153.11 ± 0.392.51 ± 0.62.69 ± 0.882.77 ± 0.34
3%2.14 ± 0.502.18 ± 0.882.49 ± 0.252.82 ± 0.62.31 ± 0.532.39 ± 0.28
Average2.41 ± 0.212.59 ± 0.412.81 ± 0.422.9 ± 0.32.6 ± 0.32
CH4 (mol/100 mol)0%25.29 ± 1.0223.77 ± 4.2226.95 ± 4.2727.12 ± 3.2426.96 ± 1.7826.02 ± 1.46
1%24.25 ± 1.5524.09 ± 4.0723.68 ± 1.4527.12 ± 1.9723.41 ± 4.0724.51 ± 1.50
2%24.37 ± 1.6426.67 ± 3.5526.98 ± 1.9623.97 ± 4.0524.22 ± 6.0325.24 ± 1.46
3%22.35 ± 3.1222.18 ± 4.8925.13 ± 0.6826.34 ± 2.2423.81 ± 2.3723.96 ± 1.79
Average24.06 ± 1.2324.18 ± 1.8625.69 ± 1.5926.14 ± 1.4924.60 ± 1.61
1 CFAD = coconut fatty acid distillate; 2 A:P = acetate/propionate.
Table 7. Microbial population of CaCl2-CFAD supplementation with unprotected-to-protected ratios in dairy rations.
Table 7. Microbial population of CaCl2-CFAD supplementation with unprotected-to-protected ratios in dairy rations.
ParametersLevelUnprotected-to-Protected CFAD 1 RatioAverage
100:075:2550:5025:750:100
Butyrivibrio fibrisolvens
(2−ΔΔCT)
01.17 ± 0.60.96 ± 0.360.96 ± 0.361.43 ± 0.151.11 ± 0.71.13 ± 0.12
11.21 ± 0.760.65 ± 0.41.75 ± 0.591.15 ± 0.461.20 ± 0.301.19 ± 0.26
21.39 ± 0.741.58 ± 0.210.91 ± 0.240.97 ± 0.351.02 ± 0.351.17 ± 0.27
30.87 ± 0.331.24 ± 0.310.92 ± 0.200.79 ± 0.161.14 ± 0.270.99 ± 0.18
Average1.16 ± 0.191.11 ± 0.221.14 ± 0.361.09 ± 0.251.12 ± 0.08
Genus bacteroides
(2−ΔΔCT)
01.00 ± 0.060.89 ± 0.181.08 ± 0.091.40 ± 0.091.45 ± 0.531.17 ± 0.19
10.89 ± 0.061.07 ± 0.180.81 ± 0.091.51 ± 0.091.17 ± 0.531.09 ± 0.25
20.69 ± 0.220.88 ± 0.241.33 ± 0.321.09 ± 0.321.09 ± 0.161.02 ± 0.27
30.64 ± 0.150.75 ± 0.200.76 ± 0.331.22 ± 0.281.29 ± 0.230.93 ± 0.24
Average0.81 ± 0.15 b0.90 ± 0.17 b1.00 ± 0.37 b1.31 ± 0.07a1.25 ± 0.03 a
Streptococcus bovis
(2−ΔΔCT)
01.37 ± 0.831.23 ± 0.531.38 ± 0.40.99 ± 0.861.35 ± 0.941.27 ± 0.16
11.81 ± 0.981.29 ± 0.011.18 ± 0.480.88 ± 0.350.95 ± 0.161.22 ± 0.37
21.66 ± 0.391.01 ± 0.310.94 ± 0.921.86 ± 2.611.59 ± 0.991.41 ± 0.41
31.18 ± 0.261.99 ± 0.30.45 ± 0.470.38 ± 0.291.72 ± 1.411.14 ± 0.73
Average1.51 ± 0.281.38 ± 0.430.99 ± 0.401.03 ± 0.611.40 ± 0.34
Methanogens
(2−ΔΔCT)
01.46 ± 0.781.47 ± 0.561.53 ± 0.341.47 ± 0.561.15 ± 0.681.42 ± 0.15 a
10.92 ± 0.371.55 ± 0.551.34 ± 0.331.23 ± 0.430.81 ± 0.791.17 ± 0.31 ab
21.37 ± 0.311.27 ± 0.110.94 ± 0.351.01 ± 0.131.03 ± 0.681.12 ± 0.19 ab
31.32 ± 0.510.87 ± 0.760.89 ± 0.230.80 ± 0.240.99 ± 0.430.97 ± 0.2 b
Average1.27 ± 0.241.29 ± 0.31.17 ± 0.311.13 ± 0.290.99 ± 0.14
Total Protozoa
(log cell/mL)
06.19 ± 0.136.19 ± 0.126.27 ± 0.016.22 ± 0.086.19 ± 0.096.21 ± 0.03 a
16.18 ± 0.076.24 ± 0.086.16 ± 0.16.22 ± 0.056.16 ± 0.136.19 ± 0.04 ab
26.06 ± 0.156.03 ± 0.136.17 ± 0.026.19 ± 0.016.24 ± 0.096.14 ± 0.09 ab
35.96 ± 0.196.07 ± 0.136.12 ± 0.056.18 ± 0.066.10 ± 0.076.09 ± 0.08 b
Average6.10 ± 0.116.13 ± 0.16.18 ± 0.066.2 ± 0.026.17 ± 0.06
a,b Means in the same column with different superscripts are significantly different (p < 0.05). 1 CFAD = coconut fatty acid distillate.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zahera, R.; Pratiwi, M.I.; Fitri, A.; Koike, S.; Permana, I.G.; Despal. Coconut Fatty Acid Distillate Ca-Soap with Different Calcium Sources: Effects of Varied Proportions of Protected and Unprotected Fat Supplementation in Dairy Rations. Dairy 2024, 5, 542-554. https://doi.org/10.3390/dairy5030041

AMA Style

Zahera R, Pratiwi MI, Fitri A, Koike S, Permana IG, Despal. Coconut Fatty Acid Distillate Ca-Soap with Different Calcium Sources: Effects of Varied Proportions of Protected and Unprotected Fat Supplementation in Dairy Rations. Dairy. 2024; 5(3):542-554. https://doi.org/10.3390/dairy5030041

Chicago/Turabian Style

Zahera, Rika, Mega Indah Pratiwi, Ainissya Fitri, Satoshi Koike, Idat Galih Permana, and Despal. 2024. "Coconut Fatty Acid Distillate Ca-Soap with Different Calcium Sources: Effects of Varied Proportions of Protected and Unprotected Fat Supplementation in Dairy Rations" Dairy 5, no. 3: 542-554. https://doi.org/10.3390/dairy5030041

APA Style

Zahera, R., Pratiwi, M. I., Fitri, A., Koike, S., Permana, I. G., & Despal. (2024). Coconut Fatty Acid Distillate Ca-Soap with Different Calcium Sources: Effects of Varied Proportions of Protected and Unprotected Fat Supplementation in Dairy Rations. Dairy, 5(3), 542-554. https://doi.org/10.3390/dairy5030041

Article Metrics

Back to TopTop