Phenotypic Investigation and Detection of Biofilm-Associated Genes in Acinetobacter baumannii Isolates, Obtained from Companion Animals
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolates Included in the Study
2.2. Phenotypic Quantification of Biofilm Production by the Microplate Adhesion Technique
2.3. Detection of Biofilm-Related Genes
3. Results
3.1. Included Strains, Type of Samples, and Antibiotic Resistance Patterns
3.2. Phenotypic Quantification of Biofilm Production
3.3. Association of Biofilm Quantification, Sample Type, and Antibiotic Resistance
3.4. Detection of Biofilm-Related Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ayoub Moubareck, C.; Hammoudi Halat, D. Insights into Acinetobacter Baumannii: A Review of Microbiological, Virulence, and Resistance Traits in a Threatening Nosocomial Pathogen. Antibiotics 2020, 9, 119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, C.-H.; Su, P.-W.; Moi, S.-H.; Chuang, L.-Y. Biofilm Formation in Acinetobacter Baumannii: Genotype-Phenotype Correlation. Molecules 2019, 24, 1849. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roy, S.; Elgharably, H.; Sinha, M.; Ganesh, K.; Chaney, S.; Mann, E.; Miller, C.; Khanna, S.; Bergdall, V.K.; Powell, H.M.; et al. Mixed-species Biofilm Compromises Wound Healing by Disrupting Epidermal Barrier Function. J. Pathol. 2014, 233, 331–343. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brossard, K.A.; Campagnari, A.A. The Acinetobacter Baumannii Biofilm-Associated Protein Plays a Role in Adherence to Human Epithelial Cells. Infect. Immun. 2012, 80, 228–233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gaddy, J.A.; Tomaras, A.P.; Actis, L.A. The Acinetobacter Baumannii 19606 OmpA Protein Plays a Role in Biofilm Formation on Abiotic Surfaces and in the Interaction of This Pathogen with Eukaryotic Cells. Infect. Immun. 2009, 77, 3150–3160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sugawara, E.; Nikaido, H. OmpA Is the Principal Nonspecific Slow Porin of Acinetobacter Baumannii. J. Bacteriol. 2012, 194, 4089–4096. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tomaras, A.P.; Flagler, M.J.; Dorsey, C.W.; Gaddy, J.A.; Actis, L.A. Characterization of a Two-Component Regulatory System from Acinetobacter Baumannii That Controls Biofilm Formation and Cellular Morphology. Microbiology 2008, 154, 3398–3409. [Google Scholar] [CrossRef] [Scilit]
- Law, S.K.K.; Tan, H.S. The Role of Quorum Sensing, Biofilm Formation, and Iron Acquisition as Key Virulence Mechanisms in Acinetobacter Baumannii and the Corresponding Anti-Virulence Strategies. Microbiol. Res. 2022, 260, 127032. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahmad, I.; Nadeem, A.; Mushtaq, F.; Zlatkov, N.; Shahzad, M.; Zavialov, A.V.; Wai, S.N.; Uhlin, B.E. Csu Pili Dependent Biofilm Formation and Virulence of Acinetobacter Baumannii. NPJ Biofilms Microbiomes 2023, 9, 101. [Google Scholar] [CrossRef] [Scilit]
- Naeimi Mazraeh, F.; Hasani, A.; Sadeghi, J.; Samadi Kafil, H.; Soroush Barhaghi, M.H.; Yeganeh Sefidan, F.; Rishi Sharabiani, H.; Hematyar, Y.; Ahangarzadeh Rezaee, M. High Frequency of blaPER-1 Gene in Clinical Strains of Acinetobacter Baumannii and Its Association with Quorum Sensing and Virulence Factors. Gene Rep. 2021, 24, 101232. [Google Scholar] [CrossRef] [Scilit]
- Nocera, F.P.; Attili, A.-R.; De Martino, L. Acinetobacter Baumannii: Its Clinical Significance in Human and Veterinary Medicine. Pathogens 2021, 10, 127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peleg, A.Y.; Seifert, H.; Paterson, D.L. Acinetobacter Baumannii: Emergence of a Successful Pathogen. Clin. Microbiol. Rev. 2008, 21, 538–582. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Der Kolk, J.H.; Endimiani, A.; Graubner, C.; Gerber, V.; Perreten, V. Acinetobacter in Veterinary Medicine, with an Emphasis on Acinetobacter Baumannii. J. Glob. Antimicrob. Resist. 2019, 16, 59–71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zordan, S. Multidrug-Resistant Acinetobacter Baumannii in Veterinary Clinics, Germany. Emerg. Infect. Dis. 2011, 17, 1751–1754. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Endimiani, A.; Hujer, K.M.; Hujer, A.M.; Bertschy, I.; Rossano, A.; Koch, C.; Gerber, V.; Francey, T.; Bonomo, R.A.; Perreten, V. Acinetobacter Baumannii Isolates from Pets and Horses in Switzerland: Molecular Characterization and Clinical Data. J. Antimicrob. Chemother. 2011, 66, 2248–2254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Belmonte, O.; Pailhoriès, H.; Kempf, M.; Gaultier, M.P.; Lemarié, C.; Ramont, C.; Joly-Guillou, M.L.; Eveillard, M. High Prevalence of Closely-Related Acinetobacter Baumannii in Pets According to a Multicentre Study in Veterinary Clinics, Reunion Island. Vet. Microbiol. 2014, 170, 446–450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lysitsas, M.; Triantafillou, E.; Chatzipanagiotidou, I.; Antoniou, K.; Valiakos, G. Antimicrobial Susceptibility Profiles of Acinetobacter Baumannii Strains, Isolated from Clinical Cases of Companion Animals in Greece. Vet. Sci. 2023, 10, 635. [Google Scholar] [CrossRef] [Scilit]
- Christensen, G.D.; Simpson, W.A.; Bisno, A.L.; Beachey, E.H. Adherence of Slime-Producing Strains of Staphylococcus Epidermidis to Smooth Surfaces. Infect. Immun. 1982, 37, 318–326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stepanović, S.; Vuković, D.; Hola, V.; Bonaventura, G.D.; Djukić, S.; Ćirković, I.; Ruzicka, F. Quantification of Biofilm in Microtiter Plates: Overview of Testing Conditions and Practical Recommendations for Assessment of Biofilm Production by Staphylococci. APMIS 2007, 115, 891–899. [Google Scholar] [CrossRef] [Scilit]
- Babapour, E.; Haddadi, A.; Mirnejad, R.; Angaji, S.-A.; Amirmozafari, N. Biofilm Formation in Clinical Isolates of Nosocomial Acinetobacter Baumannii and Its Relationship with Multidrug Resistance. Asian Pac. J. Trop. Biomed. 2016, 6, 528–533. [Google Scholar] [CrossRef] [Scilit]
- Kuzi, S.; Blum, S.E.; Kahane, N.; Adler, A.; Hussein, O.; Segev, G.; Aroch, I. Multi-Drug-Resistant Acinetobacter Calcoaceticus-Acinetobacter Baumannii Complex Infection Outbreak in Dogs and Cats in a Veterinary Hospital: Nosocomial Acinetobacter Infection Outbreak. J. Small Anim. Pract. 2016, 57, 617–625. [Google Scholar] [CrossRef] [Scilit]
- Wareth, G.; Neubauer, H.; Sprague, L.D. Acinetobacter Baumannii—A Neglected Pathogen in Veterinary and Environmental Health in Germany. Vet. Res. Commun. 2019, 43, 1–6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leelapsawas, C.; Yindee, J.; Nittayasut, N.; Chueahiran, S.; Boonkham, P.; Suanpairintr, N.; Chanchaithong, P. Emergence and Multi-Lineages of Carbapenemase-Producing Acinetobacter Baumannii-Calcoaceticus Complex from Canine and Feline Origins. J. Vet. Med. Sci. 2022, 84, 1377–1384. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maboni, G.; Seguel, M.; Lorton, A.; Sanchez, S. Antimicrobial Resistance Patterns of Acinetobacter spp. of Animal Origin Reveal High Rate of Multidrug Resistance. Vet. Microbiol. 2020, 245, 108702. [Google Scholar] [CrossRef] [Scilit]
- Vestby, L.K.; Grønseth, T.; Simm, R.; Nesse, L.L. Bacterial Biofilm and its Role in the Pathogenesis of Disease. Antibiotics 2020, 9, 59. [Google Scholar] [CrossRef] [Scilit]
- Perez, L.R.R. Acinetobacter Baumannii Displays Inverse Relationship between Meropenem Resistance and Biofilm Production. J. Chemother. 2015, 27, 13–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amin, M.; Navidifar, T.; Saleh Shooshtari, F.; Rashno, M.; Savari, M.; Jahangirmehr, F.; Arshadi, M. Association Between Biofilm Formation, Structure, and the Expression Levels of Genes Related to Biofilm Formation and Biofilm-Specific Resistance of Acinetobacter Baumannii Strains Isolated from Burn Infection in Ahvaz, Iran. Infect. Drug Resist. 2019, 12, 3867–3881. [Google Scholar] [CrossRef] [Scilit]
- Hassan, P.A.; Khider, A.K. Correlation of Biofilm Formation and Antibiotic Resistance among Clinical and Soil Isolates of Acinetobacter Baumannii in Iraq. Acta Microbiol. Immunol. Hung. 2020, 67, 161–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, H.; Wu, Y.-Q.; Chen, L.-P.; Gao, X.; Huang, H.-N.; Qiu, F.-L.; Wu, D.-C. Biofilm-Related Genes: Analyses in Multi-Antibiotic Resistant Acinetobacter Baumannii Isolates From Mainland China. Med. Sci. Monit. 2016, 22, 1801–1807. [Google Scholar] [CrossRef] [Scilit]
- Bardbari, A.M.; Arabestani, M.R.; Karami, M.; Keramat, F.; Alikhani, M.Y.; Bagheri, K.P. Correlation between Ability of Biofilm Formation with Their Responsible Genes and MDR Patterns in Clinical and Environmental Acinetobacter Baumannii Isolates. Microb. Pathog. 2017, 108, 122–128. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.A.; Ryu, S.Y.; Seo, I.; Suh, S.-I.; Suh, M.-H.; Baek, W.-K. Biofilm Formation and Colistin Susceptibility of Acinetobacter Baumannii Isolated from Korean Nosocomial Samples. Microb. Drug Resist. 2015, 21, 452–457. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smitran, A.; Lukovic, B.; Bozic, L.; Jelic, D.; Jovicevic, M.; Kabic, J.; Kekic, D.; Ranin, J.; Opavski, N.; Gajic, I. Carbapenem-Resistant Acinetobacter Baumannii: Biofilm-Associated Genes, Biofilm-Eradication Potential of Disinfectants, and Biofilm-Inhibitory Effects of Selenium Nanoparticles. Microorganisms 2023, 11, 171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gautam, D.; Dolma, K.; Khandelwal, B.; Goyal, R.; Mitsuwan, W.; Gomes Pereira, M.L.; Klangbud, W.; Gupta, M.; Wilairatana, P.; Siyadatpanah, A.; et al. Acinetobacter Baumannii in Suspected Bacterial Infections: Association between Multidrug Resistance, Virulence Genes, & Biofilm Production. Indian J. Med. Res. 2023, 158, 439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, H.-W.; Koh, Y.M.; Kim, J.; Lee, J.-C.; Lee, Y.-C.; Seol, S.-Y.; Cho, D.-T.; Kim, J. Capacity of Multidrug-Resistant Clinical Isolates of Acinetobacter Baumannii to Form Biofilm and Adhere to Epithelial Cell Surfaces. Clin. Microbiol. Infect. 2008, 14, 49–54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richmond, G.E.; Evans, L.P.; Anderson, M.J.; Wand, M.E.; Bonney, L.C.; Ivens, A.; Chua, K.L.; Webber, M.A.; Sutton, J.M.; Peterson, M.L.; et al. The Acinetobacter Baumannii Two-Component System AdeRS Regulates Genes Required for Multidrug Efflux, Biofilm Formation, and Virulence in a Strain-Specific Manner. mBio 2016, 7, e00430-16. [Google Scholar] [CrossRef] [Scilit]
- Sun, X.; Ni, Z.; Tang, J.; Ding, Y.; Wang, X.; Li, F. The abaI/abaR Quorum Sensing System Effects on Pathogenicity in Acinetobacter Baumannii. Front. Microbiol. 2021, 12, 679241. [Google Scholar] [CrossRef] [Scilit] [PubMed]


| Mean OD | Biofilm Production |
|---|---|
| ≤ODc | No (−) |
| ODc < OD ≤ 2ODc | Weak (+) |
| 2ODc < OD ≤ 4ODc | Moderate (++) |
| 4ODc < OD | Strong (+++) |
| Primers | Primer Sequence (5′-3′) | Product Size (bp) |
|---|---|---|
| bap | TGCTGACAGTGACGTAGAACCACA | 184 |
| TGCAACTAGTGGAATAGCAGCCCA | ||
| blaPER-1 | GCAACTGCTGCAATACTCGG | 900 |
| ATGTGCGACCACAGTACCAG | ||
| csuE | CATCTTCTATTTCGGTCCC | 168 |
| CGGTCTGAGCATTGGTAA | ||
| ompA | GTTAAAGGCGACGTAGACG | 578 |
| CCAGTGTTATCTGTGTGACC |
| Strain Code | Origin | Sample | 1st Well | 2nd Well | 3rd Well | Mean Absorbance (±CI95%) | Classification of Biofilm Production |
|---|---|---|---|---|---|---|---|
| A1 | Canine | Soft tissue | 223 | 245 | 262 | 243.3 ± 18.1 | moderate |
| A2 | Canine | Pleural effusion | 536 | 618 | 652 | 602 ± 55.1 | strong |
| A3 | Canine | Soft tissue | 142 | 195 | 198 | 178.3 ± 16.3 | weak |
| A4 | Feline | Soft tissue | 294 | 159 | 182 | 211.7 ± 66.7 | weak |
| A5 | Feline | Urine | 259 | 262 | 231 | 250.7 ± 15.8 | moderate |
| A6 | Feline | Urine | 232 | 257 | 332 | 273.7 ± 48.1 | moderate |
| A7 | Canine | Soft tissue | 316 | 401 | 321 | 346 ± 12.7 | moderate |
| A8 | Canine | Soft tissue | 212 | 252 | 224 | 229.3 ± 19.0 | moderate |
| A9 | Canine | Soft tissue | 777 | 689 | 624 | 696.7 ± 71.0 | strong |
| A10 | Canine | Soft tissue | 652 | 602 | 762 | 672 ± 75.6 | strong |
| A11 | Canine | Soft tissue | 349 | 292 | 437 | 359.3 ± 67.5 | moderate |
| A12 | Feline | Nasal cavity | 1354 | 1145 | 1247 | 1248.7 ± 96.6 | strong |
| A13 | Canine | Soft tissue | 237 | 183 | 194 | 204.7 ± 26.4 | weak |
| A14 | Feline | Urine | 169 | 182 | 221 | 190.7 ± 25.0 | weak |
| A15 | Canine | Soft tissue | 242 | 277 | 329 | 282.7 ± 40.4 | moderate |
| A16 | Feline | Soft tissue | 779 | 558 | 652 | 663 ± 102.5 | strong |
| A17 | Canine | Pleural effusion | 683 | 692 | 643 | 672.7 ± 24.1 | strong |
| A18 | Feline | Soft tissue | 685 | 616 | 745 | 682 ± 59.6 | strong |
| A19 | Canine | Soft tissue | 1340 | 1454 | 1347 | 1380.3 ± 59.0 | strong |
| A20 | Feline | Urine | 488 | 505 | 518 | 503.7 ± 13.9 | strong |
| A21 | Canine | Urine | 1312 | 1156 | 1209 | 1225.7 ± 73.3 | strong |
| A22 | Feline | Urine | 237 | 168 | 177 | 194 ± 34.7 | weak |
| A23 | Feline | Urine | 589 | 484 | 500 | 524.3 ± 52.3 | strong |
| A24 | Feline | Nasal cavity | 723 | 579 | 725 | 675.7 ± 77.4 | strong |
| A25 | Canine | Ear canal | 701 | 562 | 724 | 662.3 ± 81.0 | strong |
| A26 | Canine | Urine | 853 | 981 | 826 | 886.7 ± 76.5 | strong |
| A27 | Feline | Ear canal | 646 | 634 | 512 | 597.3 ± 68.5 | strong |
| A28 | Canine | Ear canal | 488 | 553 | 534 | 525 ± 30.9 | strong |
| A29 | Feline | Urine | 2872 | 2513 | 2627 | 2670.7 ± 169.5 | strong |
| A30 | Canine | Ear canal | 1363 | 1452 | 1526 | 1447 ± 75.4 | strong |
| A31 | Canine | Soft tissue | 117 | 144 | 134 | 131.7 ± 12.6 | weak |
| A32 | Canine | Soft tissue | 334 | 336 | 241 | 303.7 ± 50.2 | moderate |
| A33 | Canine | Soft tissue | 451 | 597 | 412 | 486.7 ± 90.1 | strong |
| A34 | Canine | Soft tissue | 192 | 202 | 234 | 209.3 ± 20.3 | weak |
| A35 | Canine | Urine | 545 | 428 | 456 | 476.3 ± 56.5 | strong |
| A36 | Canine | Soft tissue | 1384 | 1393 | 1713 | 1496.7 ± 173.2 | strong |
| A37 | Canine | Urine | 236 | 239 | 214 | 229.7 ± 12.6 | moderate |
| A38 | Feline | Soft tissue | 629 | 809 | 564 | 667.3 ± 117.3 | strong |
| A39 | Feline | Urine | 252 | 229 | 237 | 239.3 ± 10.8 | moderate |
| A40 | Canine | Soft tissue | 303 | 256 | 350 | 303 ± 43.4 | moderate |
| A41 | Canine | Blood | 862 | 1042 | 1173 | 1025.7 ± 144.3 | strong |
| Sample Type | Number of Isolates Per Category | Total | ||
|---|---|---|---|---|
| Strong | Moderate | Weak | ||
| Canine | 14 | 8 | 4 | 26 |
| Feline | 9 | 3 | 3 | 15 |
| Total | 23 | 11 | 7 | 41 |
| Soft tissue | 8 | 7 | 5 | 20 |
| Urine | 6 | 4 | 2 | 12 |
| Ear canal | 4 | - | - | 4 |
| Nasal cavity | 2 | - | - | 2 |
| Pleural effusion | 2 | - | - | 2 |
| Blood | 1 | - | - | 1 |
| Total | 23 | 11 | 7 | 41 |
| Antibacterial Agent | Resistance Rate % (n) | Fischer’s Exact p-Value | |||
|---|---|---|---|---|---|
| Total | Biofilm Formation | ||||
| Strong | Moderate | Weak | |||
| Ampicillin + sulbactam | 48.8% (20) | 13% (3) | 100% (11) | 85.7% (6) | p < 0.001 |
| Piperacillin + tazobactam | 48.8% (20) | 13% (3) | 100% (11) | 85.7% (6) | p < 0.001 |
| Ceftazidime | 51.2% (21) | 13% (3) | 100% (11) | 100% (7) | p < 0.001 |
| Cefepime | 51.2% (21) | 13% (3) | 100% (11) | 100% (7) | p < 0.001 |
| Imipenem | 48.8% (20) | 13% (3) | 100% (11) | 85.7% (6) | p < 0.001 |
| Amikacin | 43.9% (18) | 8.7% (2) | 90.9% (10) | 85.7% (6) | p < 0.001 |
| Gentamicin | 75.6% (31) | 60.9% (14) | 100% (11) | 85.7% (6) | p = 0.03 |
| Tobramycin | 41.4% (17) | 4.3% (1) | 90.9% (10) | 85.7% (6) | p < 0.001 |
| Ciprofloxacin | 100% (41) | 100% (23) | 100% (11) | 100% (7) | p = 1 |
| Enrofloxacin | 100% (41) | 100% (23) | 100% (11) | 100% (7) | p = 1 |
| Sulph/zole + Trimethoprim | 63.4% (26) | 34.8% (8) | 100% (11) | 100% (7) | p < 0.001 |
| Doxycycline | 68.3% (28) | 43.5% (10) | 100% (11) | 100% (7) | p < 0.001 |
| Minocycline | 12.2% (5) | 4.3% (1) | 9.1% (1) | 42.9% (3) | p = 0.046 |
| Total | 41 | 23 | 11 | 7 | |
| Antibacterial Agent 1 | Mean Absorbance (±CI95%) | t-Test Comparison of Independent Means p-Value | |
|---|---|---|---|
| Non-Resistant 2 Isolates | Resistant Isolates | ||
| Ampicillin + sulbactam | 879.8 ± 130.1 | 319.6 ± 58.1 | p < 0.001 |
| Piperacillin + tazobactam | 879.8 ± 130.1 | 319.6 ± 58.1 | p < 0.001 |
| Ceftazidime | 914.1 ± 130.7 | 313.7 ± 55.7 | p < 0.001 |
| Cefepime | 914.1 ± 130.7 | 313.7 ± 55.7 | p < 0.001 |
| Imipenem | 879.8 ± 130.1 | 319.6 ± 58.1 | p < 0.001 |
| Amikacin | 867.1 ± 124.0 | 273.7 ± 27.6 | p < 0.001 |
| Gentamicin | 802.8 ± 118.3 | 543.3 ± 106.4 | p = 0.006 |
| Tobramycin | 851.2 ± 120.2 | 261.2 ± 24.7 | p < 0.001 |
| Sulph/zole + Trimethoprim | 939.7 ± 162.6 | 414.4 ± 73.2 | p < 0.001 |
| Doxycycline | 883.5 ± 106.7 | 463.0 ± 108.7 | p < 0.001 |
| Minocycline | 654.0 ± 96.1 | 265.1 ± 67.0 | p = 0.002 |
| Detected Genes | Number of Isolates/Phenotypic Biofilm Formation | Total | ||
|---|---|---|---|---|
| Strong | Moderate | Weak | ||
| bap, blaPER, csu, ompA | 21 | 5 | 0 | 26 |
| bap, csu, ompA | 1 | 5 | 6 | 12 |
| bap, blaPER, csu | 0 | 0 | 1 | 1 |
| bap, csu | 0 | 1 | 0 | 1 |
| bap, ompA | 1 | 0 | 0 | 1 |
| Strong | Moderate | Weak | Fischer’s Exact p-Value | |
|---|---|---|---|---|
| bap | 23/23 | 11/11 | 7/7 | p = 1 |
| blaPER | 21/23 | 5/11 | 1/7 | p < 0.001 |
| csu | 22/23 | 11/11 | 7/7 | p = 1 |
| ompA | 23/23 | 10/11 | 6/7 | p = 0.18 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lysitsas, M.; Triantafillou, E.; Chatzipanagiotidou, I.; Antoniou, K.; Spyrou, V.; Billinis, C.; Valiakos, G. Phenotypic Investigation and Detection of Biofilm-Associated Genes in Acinetobacter baumannii Isolates, Obtained from Companion Animals. Trop. Med. Infect. Dis. 2024, 9, 109. https://doi.org/10.3390/tropicalmed9050109
Lysitsas M, Triantafillou E, Chatzipanagiotidou I, Antoniou K, Spyrou V, Billinis C, Valiakos G. Phenotypic Investigation and Detection of Biofilm-Associated Genes in Acinetobacter baumannii Isolates, Obtained from Companion Animals. Tropical Medicine and Infectious Disease. 2024; 9(5):109. https://doi.org/10.3390/tropicalmed9050109
Chicago/Turabian StyleLysitsas, Marios, Eleutherios Triantafillou, Irene Chatzipanagiotidou, Konstantina Antoniou, Vassiliki Spyrou, Charalambos Billinis, and George Valiakos. 2024. "Phenotypic Investigation and Detection of Biofilm-Associated Genes in Acinetobacter baumannii Isolates, Obtained from Companion Animals" Tropical Medicine and Infectious Disease 9, no. 5: 109. https://doi.org/10.3390/tropicalmed9050109
APA StyleLysitsas, M., Triantafillou, E., Chatzipanagiotidou, I., Antoniou, K., Spyrou, V., Billinis, C., & Valiakos, G. (2024). Phenotypic Investigation and Detection of Biofilm-Associated Genes in Acinetobacter baumannii Isolates, Obtained from Companion Animals. Tropical Medicine and Infectious Disease, 9(5), 109. https://doi.org/10.3390/tropicalmed9050109

