Next Article in Journal
Under-Reporting Cases and Deaths from Melioidosis: A Retrospective Finding in Songkhla and Phatthalung Province of Southern Thailand, 2014–2020
Next Article in Special Issue
High Prevalence of Polyclonal Plasmodium falciparum Infections and Association with Poor IgG Antibody Responses in a Hyper-Endemic Area in Cameroon
Previous Article in Journal
Detection of Anti-ZIKV NS1 IgA, IgM, and Combined IgA/IgM and Identification of IL-4 and IL-10 as Potential Biomarkers for Early ZIKV and DENV Infections in Hyperendemic Regions, Thailand
Previous Article in Special Issue
Point-of-Care Diagnosis of Malaria Using a Simple, Purification-Free DNA Extraction Method Coupled with Loop-Mediated Isothermal Amplification-Lateral Flow
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Inter-Population Genetic Diversity and Clustering of Merozoite Surface Protein-1 (pkmsp-1) of Plasmodium knowlesi Isolates from Malaysia and Thailand

Department of Parasitology, Faculty of Medicine, Universiti Malaya, Kuala Lumpur 50603, Malaysia
*
Author to whom correspondence should be addressed.
Trop. Med. Infect. Dis. 2023, 8(5), 285; https://doi.org/10.3390/tropicalmed8050285
Submission received: 12 April 2023 / Revised: 12 May 2023 / Accepted: 18 May 2023 / Published: 20 May 2023
(This article belongs to the Special Issue Epidemiology, Detection and Treatment of Malaria)

Abstract

The genetic diversity of pkmsp-1 of Malaysian Plasmodium knowlesi isolates was studied recently. However, the study only included three relatively older strains from Peninsular Malaysia and focused mainly on the conserved blocks of this gene. In this study, the full-length pkmsp-1 sequence of recent P. knowlesi isolates from Peninsular Malaysia was characterized, along with Malaysian Borneo and Thailand pkmsp-1 sequences that were retrieved from GenBank. Genomic DNA of P. knowlesi was extracted from human blood specimens and the pkmsp-1 gene was PCR-amplified, cloned, and sequenced. The sequences were analysed for genetic diversity, departure from neutrality, and geographical clustering. The pkmsp-1 gene was found to be under purifying/negative selection and grouped into three clusters via a neighbour-joining tree and neighbour net inferences. Of the four polymorphic blocks in pkmsp-1, block IV, was most polymorphic, with the highest insertion–deletion (indel) sites. Two allelic families were identified in block IV, thereby highlighting the importance of this block as a promising genotyping marker for the multiplicity of infection study of P. knowlesi malaria. A single locus marker may provide an alternate, simpler method to type P. knowlesi in a population.

1. Introduction

Malaria remains a major public health challenge. In 2021, 247 million people were afflicted by this disease globally, with more than 600,000 deaths reported. Since 2018, Malaysia has had no reports of indigenous malaria cases caused by human malaria parasite species. However, zoonotic malaria caused by Plasmodium knowlesi has become the main cause of malaria cases in Malaysia, with a notable increase in the number of cases from 1600 to over 4000 between 2016 and 2018. In 2021, 13 deaths were reported due to this zoonotic infection [1], with 409 cases in Peninsular Malaysia and 3166 cases in Malaysian Borneo (Ministry of Health Malaysia, unpublished data). The situation is similar to other countries in Southeast Asia (SEA), as an upsurge of P. knowlesi cases in humans was also reported in neighbouring countries such as Brunei [2], Thailand [3], and Indonesia [4]. No later than 2018, Laos also documented their first human knowlesi case [5], making all countries in SEA endemic to this zoonotic infection, except for Timor-Leste [6]. This quotidian apicomplexan parasite undergoes the shortest asexual life cycle of 24 h in comparison to other human Plasmodium species [7], which results in the parasitaemia level increasing rapidly upon infection. High parasitaemia in patients with knowlesi malaria has been correlated with the development of debilitating symptoms and severe cases with potentially fatal outcomes. The fatality rate is similar to malignant malaria caused by P. falciparum, at approximately 6% to 9% [8]. Hyperparasitaemia, jaundice, and severe acute kidney injuries are among the clinical presentations and known predictors of severe human knowlesi infection [9,10]. Recently, a histological examination also demonstrated the ring stage of P. knowlesi on renal biopsies obtained from patients with acute kidney injury [11]. The microvascular injury may suggest the vascular involvement of the parasite.
A population-based case-controlled study in Sabah, Malaysia previously showed that males were 2.71 times more prone to acquiring P. knowlesi malaria compared to females. Other risk factors include staying overnight in the forest, not using mosquito repellent, and a history of malaria infection [12]. Besides that, P. knowlesi transmission is driven by natural and human-induced environmental variations, as seen in Sabah, where the shrinking primary forest coverage has been linked to an increase in infections [13]. The shift of monkey population into human settlements and remaining forest patches when habitats are deforested increases the chance of close contact between humans and the monkey hosts. Besides having them as pets, it has also been shown that monkeys present in areas where human activities occur can pose a risk to humans [12]. Asymptomatic infection poses another challenge to eradicating P. knowlesi, as it can infect mosquitoes that sustain the transmission [14]. In Malaysia, several studies have reported asymptomatic and/or submicroscopic knowlesi malaria cases [9,15,16], thus raising concerns, as humans can now act as infectious reservoirs and are unaware of harbouring the parasite. Therefore, there is an urgent need to reinforce monitoring and control programs, in addition to conducting active research on developing novel vaccine candidates to mitigate P. knowlesi infection.
The merozoite surface protein-1 (MSP-1), one of the most abundant surface proteins of Plasmodium spp., is involved in the invasion and survival of the parasite in host erythrocytes. A successful invasion into the host’s erythrocytes is governed by five crucial steps: complex recognition, initial attachment, re-orientation of merozoite’s apical end, formation of irreversible tight junction, and invagination of merozoite into the host’s erythrocyte [17]. MSP-1 mediates the initial attachment of merozoite onto the host’s erythrocyte along with other protein families [18]. In P. falciparum, MSP-1 is synthesized upon schizogony and closely linked with the merozoite surface protein-7 (MSP-7) [19], which will form a complex that acts as a ligand and binds to the membrane of the erythrocyte, which is then anchored by a glycosylphosphatidylinositol (GPI). Merozoite surface protein-6 (MSP-6) is also a unit of the MSP complex during the initial attachment [20]. MSP-1 is 185–225 kDa in size, and undergoes dual-endoproteolytic processes during the invasion to produce four protein subunits: 83-, 30-, 38-, and C-terminal 42-kDa. A second process then cleaves the 42-kDa into 33- and 19-kDa subunits [21]. These processes occur not only in the four human Plasmodium species, but also in P. knowlesi [22]. The 33-kDa subunit detaches and sheds along with the soluble subunits of the first proteolytic processing, while the 19-kDa is invaginated into the host’s erythrocytes [21,23]. Several studies revealed that specific antibodies raised against the C-terminal 42-kDa (MSP-142) inhibited parasite invasion and/or interrupted parasite growth [24,25], thereby demonstrating the importance of this subunit. Furthermore, purifying/negative selection was observed recently within the MSP-142 of P. knowlesi isolates from Malaysia [26,27] and Thailand [27], thus suggesting the functional constraint of this subunit.
Polymorphic blocks within the msp-1 and msp-2 have been used as markers for genetic diversity and multiplicity of infection (MOI) studies in Plasmodium falciparum and Plasmodium vivax populations [28,29,30,31,32,33,34], but there have been no reports for P. knowlesi. The structure of the pkmsp-1 gene was reported previously for Thailand P. knowlesi isolates [35], thus revealing a mosaic pattern with five conserved blocks (I, III, V, VII, and IX), which are intercalated by four polymorphic blocks (II, IV, VI, and VIII). A recent study investigated the genetic diversity of pkmsp-1 from Malaysian isolates [27] but focused mainly on the conserved blocks. Furthermore, the study only used three relatively older Peninsular Malaysia strains: H, MR4, and Pk1A. In this study, the full-length pkmsp-1 of recent P. knowlesi isolates from Peninsular Malaysia was analysed, along with pkmsp-1 sequences from Thailand and Malaysian Borneo that were retrieved from GenBank.

2. Materials and Methods

2.1. Ethical Clearance

The study received ethical clearance from the Medical Research Subcommittee of the Malaysian Ministry of Health (NMRR-15-67223975) for the use of blood specimens obtained from hospitals and district health offices in Peninsular Malaysia.

2.2. Plasmodium Species Confirmation

Twenty previously confirmed P. knowlesi human blood specimens by microscopy were re-confirmed via nested PCR targeting the 18S rRNA gene as described previously [36,37]. The specimens were also screened for the presence of the four human Plasmodium species, and none of the specimens had mixed infection. The details of the specimens are listed in Supplementary File (Table S1).

2.3. DNA Extraction

Plasmodium genomic DNA was extracted from 100 µL of human knowlesi malaria patient blood using Qiagen DNeasy Blood and Tissue Kits (Qiagen, Hilden, Germany) according to the manufacturer’s protocol and eluted with 50 µL of AE buffer in the kit for a total of 2 eluates. The eluates were pooled, and the DNA was stored at −20 °C until further use.

2.4. Amplification of pkmsp-1 Gene

The pkmsp-1 gene was amplified using gene-specific primer pairs PkMSP1-F: 5′ CGTTGGCCACTTTTAAG 3′ and PkMSP1-R: 5′ AATGTGCAGCCAAAGCC 3′ with the following composition: 4.0 µL DNA template, 1X GoTaq® Long PCR Master Mix (Promega, Madison, WI, USA), and 0.4 µM of each primer in 25 µL final volume reaction. The cycling conditions were set at 95 °C for 3 min, then 35 cycles at 94 °C for 30 s, 58 °C for 30 s, and 68 °C for 7 min, followed by a final extension at 72 °C for 10 min. Amplicons were electrophoresed on a 0.7% agarose gel pre-stained with SYBR® Safe DNA gel stain (Invitrogen, Eugene, OR, USA) at 90 V for 40 min and visualised using Gel Doc XR+ System (BioRad, Hercules, CA, USA).

2.5. Cloning and Sequencing of pkmsp-1

The amplicons were purified using the QIAquick PCR purification kit (Qiagen, Hilden, Germany) per manufacturer’s protocol, and the purified amplicons were ligated into pGEM-T® TA cloning vector (Promega, WI, USA). The ligation products were then transformed into One Shot™ Escherichia coli TOP10F’ competent cells (Invitrogen, Eugene, OR, USA). Colony PCR was then conducted against the transformants using the universal M13 forward (40 mer) and M13 reverse (48 mer) after a 16-h incubation at 37 °C. Plasmids containing the pkmsp-1 insert were harvested from positive recombinant clones using the QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany) and sent to a commercial laboratory (First BASE Laboratories Sdn. Bhd., Seri Kembangan, Malaysia) for nucleotide sequencing. Four primer pairs (Table 1) were used to sequence the pkmsp-1 insert via Sanger dideoxy sequencing method.

2.6. Genetic Diversity and Natural Selection Analysis

All raw sequences were trimmed to remove pGEM-T® TA vector sequences using BioEdit ver 7.2. The pkmsp-1 sequences (n = 20) (GenBank accession numbers: ON926538-ON926551 and ON926557-ON926562) were then aligned with the Malaysian Borneo sequences (n = 20) (GenBank accession numbers: ERR274221, ERR274222, ERR274224, ERR274225, ERR366425, ERR985377-ERR985381, ERR985387-ERR985391, ERR2762859, ERR2762860, ERR2762864, ERR2762867, and ERR2762887), Thailand sequences (n = 23) (Genbank accession numbers: JF837339-JF837353 and JX046791-JX046798), P. knowlesi strain H (Genbank accession number: PKNH_0728900) and strain MR4-H (Genbank accession number: SAMN04009580) using the ClustalW program in BioEdit ver 7.2. A total of 65 pkmsp-1 sequences were analysed in this study. Block-wise analyses on the single nucleotide polymorphisms (SNPs), insertion-deletion (indels), number of haplotypes (H), nucleotide diversity (π), and haplotype diversity (Hd) were performed using DnaSP ver 6.12. Departure from neutrality was investigated using Tajima’s D, Fu and Li’s D*, and Fu and Li’s F* tests. Tajima’s D is expected to be 0 when neutral. Both the sliding window plot and the natural selection analyses were conducted using DnaSP ver 6.12. The rate of synonymous (dS) and nonsynonymous (dN) substitutions was determined and evaluated for natural selection using MEGA X. A negative value (dN − dS < 0) signifies purifying/negative selection, while a positive value (dN − dS > 0) signifies diversifying/positive selection [38].

2.7. Phylogenetic Inference

The deduced pkmsp-1 amino acid sequences were used to construct a neighbour-joining tree using the Nei–Gojobori (Jukes–Cantor correction) method with 1000 bootstraps in MEGA X. The P. falciparum MSP-1 (GenBank accession number: XP_0013152170) was used as the outgroup. The robustness of the tree was re-appraised using the neighbour net method via SplitsTree6 ver 0.1.2-alpha [39]. The allelic clustering for each polymorphic block was conducted using a similar approach without the outgroup.

3. Results

3.1. Genetic Diversity and Natural Selection of pkmsp-1

The organization of the full-length pkmsp-1 gene obtained in this study was identical to previous reports [27,35], with five conserved blocks interspersed by four polymorphic blocks. There were 640 polymorphic sites, of which 127 were singleton and 456 were parsimony informative sites (Table 2). As a result of the extensive size variation within the polymorphic blocks, 805 sites with indels were identified. The nucleotide diversity in the sliding window plot (Figure 1) revealed high nucleotide diversity at the 5′ end, specifically at block II and block IV. Although pkmsp-1 was more diverse (π = 0.026, Hd: 0.996) than other invasion-related proteins of P. knowlesi, the protein was under a strong negative/purifying selection (dN − dS = −5.87, p < 0.0001). Of the four polymorphic blocks, block IV contained the highest number of sites with indels (326 sites), followed by block VIII (244 sites), block VI (147 sites), and block II (74 sites), thus indicating that there were more gaps within blocks IV and VII than other polymorphic blocks. However, between the two polymorphic blocks with the highest indels, block IV (π = 0.174) was more polymorphic than block VIII (π = 0.100). Block II (π = 0.162) had a slightly lower nucleotide diversity than block IV, while, among the four polymorphic blocks, block VI demonstrated the lowest nucleotide diversity (π = 0.051). Overall, the polymorphic blocks were shown to be under positive/diversifying selection, whereas the conserved blocks were under negative/purifying selection. Tajima’s D, Fu and Li’s D*, and Fu and Li’s F* tests revealed that, overall, pkmsp-1 did not depart significantly from neutrality.

3.2. Phylogenetic Analysis of pkmsp-1

The neighbour-joining phylogenetic tree of the pkmsp-1 sequences revealed three clusters (Figure 2). Cluster 3 comprised an admixture of Peninsular Malaysia and Malaysian Borneo sequences with no apparent sub-clustering. On the contrary, cluster 2 bifurcated from cluster 3, and contained Thailand sequences only. A few Peninsular Malaysia sequences were clustered together with some Thailand sequences in cluster 1. A similar clustering pattern was observed when the neighbour net method was employed (Figure 3). Further investigation of the polymorphic blocks (Figure 4, Figure 5, Figure 6 and Figure 7) revealed three allelic clusters for block II, two allelic clusters for block IV, three allelic clusters for block VI, and four allelic clusters for block VIII. In each block, the clusters obtained via the neighbour-joining and neighbour-net were similar. It is noteworthy that, in block IV, the two clusters bifurcated distinctly based on the neigbour-net method with shorter branches within the two clusters when compared with the neighbour-net tree of other polymorphic blocks. Meanwhile, the bifurcation of block VIII was most extensive with long branches linking the sequences, resulting in the highest number of clusters. As for block II, the bifurcation was as distinct as block IV, with cluster 3 forming a larger cluster upon bifurcation from cluster 2, thereby making cluster 3 the major allele in block II. The branch length between the clusters in block VI was shortest, thus indicating minute differences in sequences within the same cluster.

4. Discussion

This is the first study describing the genetic diversity of the polymorphic blocks of pkmsp-1 with the inclusion of recent isolates from Peninsular Malaysia. The findings in this study are in contrast to a previous observation by Ahmed et al. (2018) [27], who reported that block VIII had the highest nucleotide diversity (π ≈ 0.290). The difference in nucleotide diversity distribution between these studies may be attributed to the number of sequences analysed, i.e., 65 in this study versus 11 in the study by Ahmed et al. (2018) [27]. The polymorphic blocks of pkmsp-1 could serve as useful markers to genotype circulating P. knowlesi strain in a locality [35]. In addition to the two allelic families identified (based on the phylogenetic inference), block IV had the highest number of indels among the polymorphic blocks with the highest number of nucleotides. The indels are indicative of gaps within the block; hence, block IV may serve as a promising size polymorphism marker for the MOI of P. knowlesi malaria.
It is well established that there are three allelic families designated for pfmsp-1 (RO33, MAD20, and K1) and two for pfmsp-2 (FC27 and 3D7/IC) [31]. We propose to designate the T1 allelic family (corresponding to cluster 1 of block IV) and T2 allelic family (corresponding to cluster 2 of block IV) as genotyping the parasite allele circulating in a population, and, subsequently, calculating the multiplicity of infections (MOIs) are paramount. The MOI serves as a surrogate determinant of transmission intensity [40,41,42], where a higher mean MOI indicates high transmission intensity in the locality and vice versa. Genotyping is also useful in the context of ascertaining the parasite population. Previously, the K1 of pfmsp-1 and the 3D7/IC of pfmsp-2 were found to be predominantly circulating in Bobo-Dioulasso, Burkina Faso [41]. This suggests that P. falciparum, with either of those two alleles, adapts better in the population and is less virulent. Conversely, a study in Aceh, Indonesia revealed that the multiclonal infection by K1 + RO33 allelic families was strongly associated with a severe form of falciparum malaria [43]. In addition to testing the usefulness of the block IV of pkmsp-1 as a genotyping marker for P. knowlesi, future studies may also investigate the association of the allelic families in block IV with disease severity. The T1 of block IV was the major allele or the predominant allelic family found in this study. Although speculative, it can be postulated that P. knowlesi harbouring a T1 allelic family adapts better in the population. Further investigations employing adequate sample size are deemed necessary to validate this.
The nucleotide diversity of pkmsp-1 (π = 0.026) was higher when compared to the other genes encoding invasion-related proteins of P. knowlesi, such as pktrap (π = 0.009) [44], pkama-1 (π = 0.004) [45], pkβII (Peninsular Malaysia: π = 0.015, Malaysian Borneo: π = 0.007) [46], PkγII (π = 0.019) [47], pkdbpαII (π = 0.013) [48], pktramp (π = 0.009) [49], pkspatr (π = 0.0146) [50], and pkrap1 (π = 0.0167) [51]. The extensive sequence polymorphism in the four polymorphic blocks of pkmsp-1 could play a role in causing the vast difference in overall nucleotide diversity, if not the differences in gene size. This study found no significant departure of pkmsp-1 from neutrality, in contrast to the findings of a previous study [27]. Conversely, possibly due to the higher number of isolates examined, this study revealed a purifying/negative selection on pkmsp-1 (dN − dS = −5.87, p < 0.0001). This strong negative selection suggests structural or functional constraints of the protein. The disparity between the findings in this study with the previous study could stem from the different sample sizes.
Three clusters of pkmsp-1 were observed based on the full length of pkmsp-1. Interestingly, some of the Peninsular Malaysian pkmsp-1 sequences were clustered with those from Thailand in cluster 1, which may suggest a common ancestral origin of P. knowlesi. The Thailand sequences within cluster 1 (n = 7) were from six P. knowlesi human isolates and one Macaca nemestrina isolate and were all from provinces (Yala and Narathiwat) neighbouring northern Peninsular Malaysia. The transmission of P. knowlesi is thus not confined by a man-defined border. Recently, human knowlesi malaria cases were reported across the Laos–Vietnam border [52], and this could perhaps occur in a similar manner as in this study. The clustering of the Peninsular Malaysia isolates with the Thailand isolates corroborates the allopatric speciation of P. knowlesi in Malaysia, as proposed by Divis and colleagues, (2017) [53]. A previous study on the clustering of P. knowlesi based on its normocyte binding protein xa (pknbpxa) also showed the bifurcation of Peninsular-Malaysia-derived isolates from two other clusters [54]. This could be due to the submergence of the Sunda plate at the end of the last ice age, thus separating Malaysian Borneo from Peninsular Malaysia [48]. The admixture of Peninsular Malaysia and Malaysian Borneo isolates within cluster 3 mirrors the clustering of P. knowlesi reported in previous studies [49,50,54].
With the escalation of human knowlesi cases in Malaysia, vaccine development should be more progressive as an alternative approach, in addition to rigorous vector control and monitoring efforts implemented by the government. Since the last decade, ample studies investigating the natural selection acting on the invasion-related proteins of P. knowlesi have been conducted to gain insight and rudimentary data for better vaccine development and formulation [44,45,46,47,48,49,50,51]. The pkama-1 was deciphered previously to be an under purifying/negative selection [45,55]. Hence, this serves as a determinant of a vaccine candidate for human knowlesi malaria. Recently, Ng et al. (2023) found that rabbit-raised antibodies against the region II of pkama-1 displayed significant differences when compared to the negative control group, with close to 50% invasion inhibition [56]. The findings by Muh and colleagues (2018) are similar but with a lower antibody concentration used [57]. Similar investigations toward other invasion-related proteins of P. knowlesi should be conducted and compared, as antibodies are critical in developing immunity to malaria. Of note, RTS, S/AS01, the first malaria vaccine, specifically for falciparum malaria, has been approved to be used in pilot areas of Ghana, Kenya, and Malawi as part of the routine immunization for children [58]. The vaccine for P. knowlesi can be designed, perhaps in a similar way, by fusing the recombinant protein with an immunogen, such as the Hepatitis B surface antigen. Alternatively, a multistage or multiantigen vaccine is another promising approach [59].
MSP-1 is a promising candidate not only for P. knowlesi [60], but also for P. vivax [61] and P. falciparum [62]. However, vaccine studies are hampered owing to the extensive polymorphism across the gene. This can be observed from this study whereby high nucleotide diversity was observed for the full-length pkmsp-1 as a consequence of the four polymorphic blocks, thus, highlighting the functionality of investigating the genetic diversity and polymorphism of the vaccine candidates. Instead, the conserved blocks, particularly the 42-kDa subunit of PkMSP-1 (PkMSP-142), was studied as a potential vaccine candidate. Recent findings revealed novel binding peptides against the C-terminal of PkMSP-119 [63,64]. This further aids the vaccine development or peptide-based anti-malarial drug formulation, and it is in line with the objectives of the One Health initiative to intervene and mitigate the endemic zoonotic infection caused by P. knowlesi via activities, including vaccine development. This would subsequently provide better health and well-being to vulnerable communities, as environmental components, which are taken into account to mitigate the spread of the infection.

5. Conclusions

Three clusters of pkmsp-1 were observed across Thailand and Malaysia, with one cluster unique for Thailand. The pkmsp-1 was under purifying/negative selection, albeit it was more diverse than several genes encoding invasion-related proteins of P. knowlesi. Block IV of pkmsp-1 may serve as a promising genotyping marker for the MOI study of P. knowlesi malaria. Therefore, further investigation should be conducted on block IV to test its feasibility as an MOI genotyping marker in humans, as well as for the macaque population in Southeast Asia.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/tropicalmed8050285/s1, Table S1: Details of Peninsular Malaysia specimens included in the study.

Author Contributions

Conceptualization, M.Y.F.; methodology, N.R.N.; software, N.R.N.; validation, F.W.C. and Y.L.L.; formal analysis, F.W.C. and Y.L.L.; investigation, N.R.N.; resources, M.Y.F.; data curation, N.R.N.; writing—original draft preparation, N.R.N.; writing—review and editing, M.Y.F., F.W.C., and Y.L.L.; visualization, N.R.N.; supervision, M.Y.F., Y.L.L., and F.W.C.; project administration, M.Y.F.; funding acquisition, M.Y.F. All authors have read and agreed to the published version of the manuscript.

Funding

This project is supported by the Ministry of Higher Education Malaysia; Long-Term Research Grant Scheme LRGS/1/2018/UM/01/1/1.

Institutional Review Board Statement

The study has obtained ethical clearance from the Medical Research Subcommittee of the Malaysian Ministry of Health (NMRR-15-67223975) for the use of blood specimens obtained from hospitals and district health offices in Peninsular Malaysia.

Informed Consent Statement

Written consent was retrieved from each participant to publish this article.

Data Availability Statement

The nucleotide sequences are available on the NCBI GenBank (accession number: ON926538-ON926551, ON926557-ON926562). All figures are in already in the main article.

Acknowledgments

We would like to express our gratitude to Mohd Hafizi Abdul Hamid and Jenarun Jelip from the Vector Borne Disease Sector, Disease Control Division, Ministry of Health, Malaysia, Rose Nani Mudin (Sabah Health Department, Malaysia), Ooi Choo Huck (Sarawak Health Department, Malaysia), and Joel Judson Jaimin (Sabah Health Department, Malaysia) for their contribution in coordinating nationwide sample collection. We also thank the public health officials from the Malaysian State Health Department and District Health offices in Pahang, Kelantan, Johor, Kedah, Terengganu, Perak, Negeri Sembilan, Selangor, Sabah, Sarawak and Federal Territory of Kuala Lumpur for their help in sample collection.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. World Health Organization. World Malaria Report 2022; Licence: CC BY-NC-SA 3.0 IGO; World Health Organization: Geneva, Switzerland, 2022; Available online: https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2021 (accessed on 9 March 2023).
  2. Koh, G.J.; Ismail, P.K.; Koh, D. Occupationally Acquired Plasmodium knowlesi Malaria in Brunei Darussalam. Saf. Health Work. 2019, 10, 122–124. [Google Scholar] [CrossRef] [PubMed]
  3. Ngernna, S.; Rachaphaew, N.; Thammapalo, S.; Prikchoo, P.; Kaewnah, O.; Manopwisedjaroen, K.; Phumchuea, K.; Suansomjit, C.; Roobsoong, W.; Sattabongkot, J.; et al. Case report: Case series of human Plasmodium knowlesi infection on the Southern border of Thailand. Am. J. Trop. Med. Hyg. 2019, 101, 1397–1401. [Google Scholar] [CrossRef] [PubMed][Green Version]
  4. Lubis, I.N.D.; Wijaya, H.; Lubis, M.; Lubis, C.P.; Divis, P.C.S.; Beshir, K.B.; Sutherland, C.J. Contribution of Plasmodium knowlesi to multispecies human Malaria infections in North Sumatera, Indonesia. J. Infect. Dis. 2017, 215, 1148–1155. [Google Scholar] [CrossRef] [PubMed]
  5. Iwagami, M.; Nakatsu, M.; Khattignavong, P.; Soundala, P.; Lorphachan, L.; Keomalaphet, S.; Xangsayalath, P.; Kawai, S.; Hongvanthong, B.; Brey, P.T.; et al. First case of human infection with Plasmodium knowlesi in Laos. PLoS Negl. Trop. Dis. 2018, 12, e0006244. [Google Scholar] [CrossRef] [PubMed][Green Version]
  6. Vythilingam, I.; Wong, M.L.; Wan-Yussof, W.S. Current status of Plasmodium knowlesi vectors: A public health concern? Parasitology 2018, 145, 32–40. [Google Scholar] [CrossRef][Green Version]
  7. Sinton, J.A.; Mulligan, H.W. A critical review of the literature relating to the identification of the malaria parasites recorded from monkeys of the families Ceropithecidae and Colobidae. Rec. Malar. Surv. India 1932, 3, 357–380. [Google Scholar]
  8. Daneshvar, C.; Davis, T.M.; Cox-Singh, J.; Rafa’ee, M.Z.; Zakaria, S.K.; Divis, P.C.; Singh, B. Clinical and laboratory features of human Plasmodium knowlesi infection. Clin. Infect. Dis. 2009, 49, 852–860. [Google Scholar] [CrossRef][Green Version]
  9. Fornace, K.M.; Herman, L.S.; Abidin, T.R.; Chua, T.H.; Daim, S.; Lorenzo, P.J.; Grignard, L.; Nuin, N.A.; Ying, L.T.; Grigg, M.J.; et al. Exposure and infection to Plasmodium knowlesi in case study communities in Northern Sabah, Malaysia and Palawan, The Philippines. PLoS Negl. Trop. Dis. 2018, 12, e0006432. [Google Scholar] [CrossRef][Green Version]
  10. Kotepui, M.; Kotepui, K.U.; Milanez, G.D.; Masangkay, F.R. Prevalence of severe Plasmodium knowlesi infection and risk factors related to severe complications compared with non-severe P. knowlesi and severe P. falciparum malaria: A systematic review and meta-analysis. Infect. Dis. Poverty 2020, 9, 106. [Google Scholar] [CrossRef]
  11. Kaur, C.; Pramanik, A.; Kumari, K.; Mandage, R.; Dinda, A.K.; Sankar, J.; Bagga, A.; Agarwal, S.K.; Sinha, A.; Singh, G.; et al. Renal detection of Plasmodium falciparum, Plasmodium vivax and Plasmodium knowlesi in malaria associated acute kidney injury: A retrospective case-control study. BMC Res. Notes 2020, 13, 37. [Google Scholar] [CrossRef]
  12. Chin, A.Z.; Avoi, R.; Atil, A.; Awang Lukman, K.; Syed Abdul Rahim, S.S.; Ibrahim, M.Y.; Ahmed, K.; Jeffree, M.S. Risk factor of Plasmodium knowlesi infection in Sabah Borneo Malaysia, 2020: A population-based case-control study. PLoS ONE. 2021, 16, e0257104. [Google Scholar] [CrossRef]
  13. Fornace, K.M.; Abidin, T.R.; Alexander, N.; Brock, P.; Grigg, M.J.; Murphy, A.; William, T.; Menon, J.; Drakeley, C.J.; Cox, J. Association between landscape factors and spatial patterns of Plasmodium knowlesi infections in Sabah, Malaysia. Emerg. Infect. Dis. 2016, 22, 201–208. [Google Scholar] [CrossRef][Green Version]
  14. World Health Organization. Malaria Policy Advisory Group (MPAG) Meeting. Available online: https://www.who.int/news-room/events/detail/2021/04/13/default-calendar/19th-meeting-of-the-malaria-policy-advisory-group (accessed on 16 March 2023).
  15. Noordin, N.R.; Lee, P.Y.; Mohd Bukhari, F.D.; Fong, M.Y.; Abdul Hamid, M.H.; Jelip, J.; Mudin, R.N.; Lau, Y.L. Prevalence of asymptomatic and/or low-density malaria infection among high-risk groups in Peninsular Malaysia. Am. J. Trop. Med. Hyg. 2020, 103, 1107–1110. [Google Scholar] [CrossRef]
  16. Imwong, M.; Madmanee, W.; Suwannasin, K.; Kunasol, C.; Peto, T.J.; Tripura, R.; von Seidlein, L.; Nguon, C.; Davoeung, C.; Day, N.P.J.; et al. Asymptomatic natural human infections with the simian malaria parasites Plasmodium cynomolgi and Plasmodium knowlesi. J. Infect. Dis. 2019, 219, 695–702. [Google Scholar] [CrossRef][Green Version]
  17. Aikawa, M.; Miller, L.H.; Johnson, J.; Rabbege, J. Erythrocyte entry by malarial parasites. J. Cell Biol. 1978, 77, 72–82. [Google Scholar] [CrossRef]
  18. Holder, A.A.; Freeman, R.R. Biosynthesis and processing of a Plasmodium falciparum schizont antigen recognized by immune serum and a monoclonal antibody. J. Exp. Med. 1982, 156, 1528–1538. [Google Scholar] [CrossRef]
  19. Pachebat, J.A.; Kadekoppala, M.; Grainger, M.; Dluzewski, A.R.; Gunaratne, R.S.; Scott-Finnigan, T.J.; Ogun, S.A.; Ling, I.T.; Bannister, L.H.; Taylor, H.M.; et al. Extensive proteolytic processing of the malaria parasite merozoite surface protein 7 during biosynthesis and parasite release from erythrocytes. Mol. Biochem. Parasitol. 2007, 151, 59–69. [Google Scholar] [CrossRef]
  20. Trucco, C.; Fernandez-Reyes, D.; Howell, S.; Stafford, W.H.; Scott-Finnigan, T.J.; Grainger, M.; Ogun, S.A.; Taylor, W.R.; Holder, A.A. The merozoite surface protein 6 gene codes for a 36 kDa protein associated with the Plasmodium falciparum merozoite surface protein-1 complex. Mol. Biochem. Parasitol. 2001, 112, 91–101. [Google Scholar] [CrossRef]
  21. Holder, A.A.; Blackman, M.J.; Burghaus, P.A.; Chappel, J.A.; Ling, I.T.; McCallum-Deighton, N.; Shai, S. A malaria merozoite surface protein (MSP1)-structure, processing and function. Mem. Inst. Oswaldo. Cruz. 1992, 87, 37–42. [Google Scholar] [CrossRef]
  22. Blackman, M.J.; Dennis, E.D.; Hirst, E.M.A.; Kocken, C.H.; Scott-Finnigan, T.J.; Thomas, A.W. Plasmodium knowlesi: Secondary processing of the malaria merozoite surface protein-1. Exp. Parasitol. 1996, 83, 229–239. [Google Scholar] [CrossRef]
  23. Holder, A.A. The carboxy-terminus of merozoite surface protein 1: Structure, specific antibodies and immunity to malaria. Parasitology 2009, 136, 1445–1456. [Google Scholar] [CrossRef] [PubMed]
  24. Bergmann-Leitner, E.S.; Duncan, E.H.; Angov, E. MSP-1p42-specific antibodies affect growth and development of intra-erythrocytic parasites of Plasmodium falciparum. Malar. J. 2009, 8, 183. [Google Scholar] [CrossRef] [PubMed][Green Version]
  25. Wilson, D.W.; Fowkes, F.J.; Gilson, P.R.; Elliott, S.R.; Tavul, L.; Michon, P.; Dabod, E.; Siba, P.M.; Mueller, I.; Crabb, B.S.; et al. Quantifying the importance of MSP1-19 as a target of growth-inhibitory and protective antibodies against Plasmodium falciparum in humans. PLoS ONE 2011, 6, e27705. [Google Scholar] [CrossRef] [PubMed][Green Version]
  26. Yap, N.J.; Vythilingam, I.; Hoh, B.P.; Goh, X.T.; Muslim, A.; Ngui, R.; Rajoo, Y.; Choy, S.H.; William, T.; Yeo, T.W.; et al. Genetic polymorphism and natural selection in the C-terminal 42 kDa region of merozoite surface protein-1 (MSP-1) among Plasmodium knowlesi samples from Malaysia. Parasites Vectors 2018, 11, 626. [Google Scholar] [CrossRef][Green Version]
  27. Ahmed, M.A.; Chu, K.B.; Vythilingam, I.; Quan, F.S. Within-population genetic diversity and population structure of Plasmodium knowlesi merozoite surface protein 1 gene from geographically distinct regions of Malaysia and Thailand. Malar. J. 2018, 17, 442. [Google Scholar] [CrossRef][Green Version]
  28. Viriyakosol, S.; Siripoon, N.; Petcharapirat, C.; Petcharapirat, P.; Jarra, W.; Thaithong, S.; Brown, K.N.; Snounou, G. Genotyping of Plasmodium falciparum isolates by the polymerase chain reaction and potential uses in epidemiological studies. Bull. World Health Organ. 1995, 73, 85–95. [Google Scholar]
  29. Ntoumi, F.; Ngoundou-Landji, J.; Luty, A.J.; Dubreuil, G.; Millet, P. Allelic polymorphism of Plasmodium falciparum MSP-2 gene in blood samples from Gabonese children. Bull. Soc. Pathol. Exot. 2001, 94, 183–187. [Google Scholar]
  30. Opute, A.O.; Akinkunmi, J.A.; Funsho, A.O.; Obaniyi, A.K.; Anifowoshe, A.T. Genetic diversity of Plasmodium falciparum isolates in Nigeria. A review. Egypt J. Med. Hum. Genet. 2022, 23, 129. [Google Scholar] [CrossRef]
  31. Snounou, G.; Zhu, X.; Siripoon, N.; Jarra, W.; Thaithong, S.; Brown, K.N.; Viriyakosol, S. Biased distribution of msp1 and msp2 allelic variants in Plasmodium falciparum populations in Thailand. Trans. R Soc. Trop. Med. Hyg. 1999, 93, 369–374. [Google Scholar] [CrossRef]
  32. Soares, L.A.; Evangelista, J.; Orlandi, P.P.; Almeida, M.E.; de Sousa, L.P.; Chaves, Y.; Barbosa-Filho, R.; Lacerda, M.V.; Mariuba, L.A.; Nogueira, P.A. Genetic diversity of MSP1 Block 2 of Plasmodium vivax isolates from manaus (Central Brazilian Amazon). J. Immunol. Res. 2014, 2014, 14–16. [Google Scholar] [CrossRef][Green Version]
  33. Fola, A.A.; Harrison, G.L.A.; Hazairin, M.H.; Barnadas, C.; Hetzel, M.W.; Iga, J.; Siba, P.M.; Mueller, I.; Barry, A.E. Higher complexity of infection and genetic diversity of Plasmodium vivax than Plasmodium falciparum across all malaria transmission zones of Papua New Guinea. Am. J. Trop. Med. Hyg. 2017, 96, 630–641. [Google Scholar] [CrossRef][Green Version]
  34. Abukari, Z.; Okonu, R.; Nyarko, S.B.; Lo, A.C.; Dieng, C.C.; Salifu, S.P.; Gyan, B.A.; Lo, E.; Amoah, L.E. The diversity, multiplicity of infection and population structure of P. falciparum parasites circulating in asymptomatic carriers living in high and low malaria transmission settings of Ghana. Genes 2019, 10, 434. [Google Scholar] [CrossRef][Green Version]
  35. Putaporntip, C.; Thongaree, S.; Jongwutiwes, S. Differential sequence diversity at merozoite surface protein-1 locus of Plasmodium knowlesi from humans and macaques in Thailand. Infect. Genet. Evol. 2013, 18, 213–219. [Google Scholar] [CrossRef]
  36. Snounou, G.; Viriyakosol, S.; Jarra, W.; Thaithong, S.; Brown, K. Identification of the four human malaria parasite species in field samples by the polymerase chain reaction and detection of a high prevalence of mixed infections. Mol. Biochem. Parasitol. 1993, 58, 283–292. [Google Scholar] [CrossRef]
  37. Imwong, M.; Tanomsing, N.; Pukrittayakamee, S.; Day, N.P.J.; White, N.J.; Snounou, G. Spurious amplification of a Plasmodium vivax small-subunit RNA gene by use of primers currently used to detect P. knowlesi. J. Clin. Microbiol. 2009, 47, 4173–4175. [Google Scholar] [CrossRef][Green Version]
  38. Nei, M.; Gojobori, T. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol. Biol. Evol. 1986, 3, 418–426. [Google Scholar]
  39. Hudson, D.H.; Bryant, D. Application of phylogenetic networks in evolutionary studies. Mol. Biol. Evol. 2006, 23, 254–267. [Google Scholar] [CrossRef]
  40. Sondo, P.; Derra, K.; Rouamba, T.; Nakanabo Diallo, S.; Taconet, P.; Kazienga, A.; Ilboudo, H.; Tahita, M.C.; Valéa, I.; Sorgho, H. Determinants of Plasmodium falciparum multiplicity of infection and genetic diversity in Burkina Faso. Parasites Vectors 2020, 13, 427. [Google Scholar] [CrossRef]
  41. Somé, A.F.; Bazié, T.; Zongo, I.; Yerbanga, R.S.; Nikiéma, F.; Neya, C.; Taho, L.K.; Ouédraogo, J.B. Plasmodium falciparum msp1 and msp2 genetic diversity and allele frequencies in parasites isolated from symptomatic malaria patients in Bobo-Dioulasso, Burkina Faso. Parasites Vectors 2018, 11, 323. [Google Scholar] [CrossRef][Green Version]
  42. Usman-Yamman, H.; Omalu, C.J.I.; Abubakar, A.; Abolarinwa, S.O.; Eke, S.S.; Otuu, C.A. Genetic diversity of Plasmodium falciparum isolates in Minna, North Central Nigeria inferred by PCR genotyping of merozoite surface protein 1 and 2. Infect. Genet. Evol. 2021, 96, 105143. [Google Scholar] [CrossRef]
  43. Jamil, K.F.; Pratama, N.R.; Marantina, S.S.; Harapan, H.; Kurniawan, M.R.; Zanaria, T.M.; Hutagalung, J.; Rozi, I.E.; Asih, P.B.S.; Supargiyono; et al. Allelic diversity of merozoite surface protein genes (msp1 and msp2) and clinical manifestations of Plasmodium falciparum malaria cases in Aceh, Indonesia. Malar. J. 2021, 20, 182. [Google Scholar] [CrossRef] [PubMed]
  44. Ahmed, M.A.; Lau, Y.L.; Quan, F.S. Diversity and natural selection on the thrombospondin-related adhesive protein (TRAP) gene of Plasmodium knowlesi in Malaysia. Malar. J. 2018, 17, 274. [Google Scholar] [CrossRef][Green Version]
  45. Chua, C.Y.; Lee, P.C.; Lau, T.Y. Analysis of polymorphisms and selective pressures on ama1 gene in Plasmodium knowlesi isolates from Sabah, Malaysia. J. Genet. 2017, 96, 653–663. [Google Scholar] [CrossRef] [PubMed]
  46. Fong, M.Y.; Lau, Y.L.; Jelip, J.; Ooi, C.H.; Cheong, F.W. Genetic characterisation of the erythrocyte-binding protein (PkβII) of Plasmodium knowlesi isolates from Malaysia. J. Genet. 2019, 98, 64. [Google Scholar] [CrossRef] [PubMed]
  47. Fong, M.Y.; Rashdi, S.A.A.; Yusof, R.; Lau, Y.L. Genetic diversity, natural selection and haplotype grouping of Plasmodium knowlesi gamma protein region II (PkγRII): Comparison with the Duffy binding protein (PkDBPαRII). PLoS ONE 2016, 11, e0155627. [Google Scholar] [CrossRef][Green Version]
  48. Fong, M.Y.; Lau, Y.L.; Chang, P.Y.; Anthony, C.N. Genetic diversity, haplotypes and allele groups of Duffy binding protein (PkDBPαII) of Plasmodium knowlesi clinical isolates from Peninsular Malaysia. Parasites Vectors 2014, 7, 161. [Google Scholar] [CrossRef][Green Version]
  49. Ng, Y.L.; Lau, Y.L.; Hamid, M.H.A.; Jelip, J.; Ooi, C.H.; Mudin, R.N.; Jaimin, J.J.; Fong, M.Y. Genetic polymorphism of the thrombospondin-related apical merozoite protein (TRAMP) of Plasmodium knowlesi in Malaysia. Parasitol Res. 2023, 122, 195–200. [Google Scholar] [CrossRef]
  50. Azlan, U.W.; Lau, Y.L.; Hamid, M.H.A.; Jelip, J.; Ooi, C.H.; Mudin, R.N.; Jaimin, J.J.; Fong, M.Y. Genetic diversity of secreted protein with an altered thrombospondin repeat (SPATR) of Plasmodium knowlesi clinical isolates from Malaysia. Trop. Biomed. 2022, 39, 504–510. [Google Scholar]
  51. Azlan, U.W.; Lau, Y.L.; Fong, M.Y. Genetic diversity and clustering of the rhoptry associated protein-1 of Plasmodium knowlesi from Peninsular Malaysia and Malaysian Borneo. Korean J. Parasitol. 2022, 60, 393–400. [Google Scholar] [CrossRef]
  52. Pongvongsa, T.; Culleton, R.; Ha, H.; Thanh, L.; Phongmany, P.; Marchand, R.P.; Kawai, S.; Moji, K.; Nakazawa, S.; Maeno, Y. Human infection with Plasmodium knowlesi on the Laos-Vietnam border. Trop. Med. Health 2018, 46, 33. [Google Scholar] [CrossRef][Green Version]
  53. Divis, P.C.; Lin, L.C.; Rovie-Ryan, J.J.; Kadir, K.A.; Anderios, F.; Hisam, S.; Sharma, R.S.; Singh, B.; Conway, D.J. Three divergent subpopulations of the malaria parasite Plasmodium knowlesi. Emerg. Infect. Dis. 2017, 23, 616–624. [Google Scholar] [CrossRef][Green Version]
  54. Ahmed, M.A.; Fong, M.Y.; Lau, Y.L.; Yusof, R. Clustering and genetic differentiation of the normocyte binding protein (nbpxa) of Plasmodium knowlesi clinical isolates from Peninsular Malaysia and Malaysia Borneo. Malar. J. 2016, 15, 241. [Google Scholar] [CrossRef][Green Version]
  55. Ng, Y.L.; Fong, M.Y.; Lau, Y.L. Genetic diversity of the full length apical membrane antigen-1 of Plasmodium knowlesi clinical isolates from peninsular Malaysia. Trop. Biomed. 2021, 38, 159–164. [Google Scholar]
  56. Ng, Y.L.; Lee, W.C.; Lau, Y.L.; Fong, M.Y. The impact of geographical variation in Plasmodium knowlesi apical membrane protein 1 (PkAMA-1) on invasion dynamics of P. knowlesi. Trop. Med. Infect. Dis. 2023, 8, 56. [Google Scholar] [CrossRef]
  57. Muh, F.; Lee, S.K.; Hoque, M.R.; Han, J.H.; Park, J.H.; Firdaus, E.R.; Moon, R.W.; Lau, Y.L.; Han, E.T. In vitro invasion inhibition assay using antibodies against Plasmodium knowlesi Duffy binding protein alpha and apical membrane antigen protein 1 in human erythrocyte-adapted P. knowlesi A1-H.1 strain. Malar. J. 2018, 17, 272. [Google Scholar] [CrossRef][Green Version]
  58. WHO. Malaria vaccine: WHO position paper-March 2022. Wkly. Epidemiol. Rec. 2022, 9, 76. [Google Scholar]
  59. Rogers, W.O.; Baird, J.K.; Kumar, A.; Tine, J.A.; Weiss, W.; Aguiar, J.C.; Gowda, K.; Gwadz, R.; Kumar, S.; Gold, M.; et al. Multistage multiantigen heterologous prime boost vaccine for Plasmodium knowlesi malaria provides partial protection in rhesus macaques. Infect. Immun. 2001, 69, 5565–5572. [Google Scholar] [CrossRef][Green Version]
  60. Nageswari, G.; Gnanadesigan, M.; Kiruthika, R. Polymeric particles as a delivery agent for malarial vaccines. In Applications of Nanobiotechnology for Neglected Tropical Diseases; Formiga, F.R., Inamudin, Severino, P., Eds.; Academic Press: Cambridge, MA, USA, 2021; pp. 47–67. [Google Scholar]
  61. Kale, S.; Yadav, C.P.; Rao, P.N.; Shalini, S.; Eapen, A.; Srivasatava, H.C.; Sharma, S.K.; Pande, V.; Carlton, J.M.; Singh, O.P.; et al. Antibody responses within two leading Plasmodium vivax vaccine candidate antigens in three geographically diverse malaria-endemic regions of India. Malar. J. 2019, 18, 425. [Google Scholar] [CrossRef]
  62. Anand, G.; Biswas, S.; Yadav, N.; Mukherjee, P.; Chauhan, V.S. Production and immunogenicity of a tag-free recombinant chimera based on pfmsp-1 and pfmsp-3 using alhydrogel and dipeptide-based hydrogels. Vaccines 2021, 9, 782. [Google Scholar] [CrossRef]
  63. Cheong, F.W.; Fong, M.Y.; Lau, Y.L. Identification and characterization of epitopes on Plasmodium knowlesi merozoite surface protein-142 (MSP-142) using synthetic peptide library and phage display library. Acta Trop. 2016, 154, 89–94. [Google Scholar] [CrossRef]
  64. Goh, X.T.; Chua, K.H.; Kee, B.P.; Lim, Y.A.L. Identification of Plasmodium knowlesi Merozoite Surface Protein-119 (PkMSP-119) novel binding peptides from a phage display library. Trop. Med. Int. Health 2020, 25, 172–185. [Google Scholar] [CrossRef] [PubMed][Green Version]
Figure 1. Sliding window plot (based on nucleotide diversity) of pkmsp-1 with a window length of 100 bp and step size of 25 bp using DnaSP ver 6.12.
Figure 1. Sliding window plot (based on nucleotide diversity) of pkmsp-1 with a window length of 100 bp and step size of 25 bp using DnaSP ver 6.12.
Tropicalmed 08 00285 g001
Figure 2. Neighbour-joining tree of 65 pkmsp-1 sequences with 1000 bootstraps. The numbers next to the nodes represent the percentages that support the bifurcation for 1000 bootstrap replicates. The pfmsp-1 was utilized as the outgroup.
Figure 2. Neighbour-joining tree of 65 pkmsp-1 sequences with 1000 bootstraps. The numbers next to the nodes represent the percentages that support the bifurcation for 1000 bootstrap replicates. The pfmsp-1 was utilized as the outgroup.
Tropicalmed 08 00285 g002
Figure 3. Neighbour-net tree of the same 65 sequences used in the neigbour-joining tree with a sum of differences goodness of fit = 99.89%. Three clusters were formed, and this corroborates with the clusters formed via the neighbour-joining method. Each cluster is denoted by a coloured bubble.
Figure 3. Neighbour-net tree of the same 65 sequences used in the neigbour-joining tree with a sum of differences goodness of fit = 99.89%. Three clusters were formed, and this corroborates with the clusters formed via the neighbour-joining method. Each cluster is denoted by a coloured bubble.
Tropicalmed 08 00285 g003
Figure 4. (a) Neighbour-joining tree of 65 sequences based on block II of pkmsp-1 gene with 1000 bootstraps. The numbers next to the nodes represent the percentages that support the bifurcation for 1000 bootstrap replicates. (b) Neighbour-net tree of the same 65 sequences used in the neigbour-joining tree with a sum of differences goodness of fit = 99.96%. Three clusters were formed and corroborate with the clusters formed via the neighbour-joining method. Each cluster is denoted by a coloured bubble. Overall, three clusters are observed within block II.
Figure 4. (a) Neighbour-joining tree of 65 sequences based on block II of pkmsp-1 gene with 1000 bootstraps. The numbers next to the nodes represent the percentages that support the bifurcation for 1000 bootstrap replicates. (b) Neighbour-net tree of the same 65 sequences used in the neigbour-joining tree with a sum of differences goodness of fit = 99.96%. Three clusters were formed and corroborate with the clusters formed via the neighbour-joining method. Each cluster is denoted by a coloured bubble. Overall, three clusters are observed within block II.
Tropicalmed 08 00285 g004
Figure 5. (a) Neighbour-joining tree of 65 sequences based on block IV of pkmsp-1 gene with 1000 bootstraps. The numbers next to the nodes represent the percentages that support the bifurcation for 1000 bootstrap replicates. (b) Neighbour-net tree of the same 65 sequences used in the neighbour-joining tree with a sum of differences goodness of fit = 99.97%. Two clusters were formed and corroborate with the clusters formed via the neighbour-joining method. Each cluster is denoted by a coloured bubble. Overall, two clusters are observed within block IV.
Figure 5. (a) Neighbour-joining tree of 65 sequences based on block IV of pkmsp-1 gene with 1000 bootstraps. The numbers next to the nodes represent the percentages that support the bifurcation for 1000 bootstrap replicates. (b) Neighbour-net tree of the same 65 sequences used in the neighbour-joining tree with a sum of differences goodness of fit = 99.97%. Two clusters were formed and corroborate with the clusters formed via the neighbour-joining method. Each cluster is denoted by a coloured bubble. Overall, two clusters are observed within block IV.
Tropicalmed 08 00285 g005
Figure 6. (a) Neighbour-joining tree of 65 sequences based on block VI of pkmsp-1 gene with 1000 bootstraps. The numbers next to the nodes represent the percentages that support the bifurcation for 1000 bootstrap replicates. (b) Neighbour-net tree of the same 65 sequences used in the neigbour-joining tree with a sum of differences goodness of fit = 99.12%. Three clusters were formed and corroborate with the clusters formed via the neighbour-joining method. Each cluster is denoted by a coloured bubble. Overall, three clusters are observed within block VI.
Figure 6. (a) Neighbour-joining tree of 65 sequences based on block VI of pkmsp-1 gene with 1000 bootstraps. The numbers next to the nodes represent the percentages that support the bifurcation for 1000 bootstrap replicates. (b) Neighbour-net tree of the same 65 sequences used in the neigbour-joining tree with a sum of differences goodness of fit = 99.12%. Three clusters were formed and corroborate with the clusters formed via the neighbour-joining method. Each cluster is denoted by a coloured bubble. Overall, three clusters are observed within block VI.
Tropicalmed 08 00285 g006
Figure 7. (a) Neighbour-joining tree of 65 sequences based on block VIII of pkmsp-1 gene with 1000 bootstraps. The numbers next to the nodes represent the percentages that support the bifurcation for 1000 bootstrap replicates. (b) Neighbour-net tree of the same 65 sequences used in the neighbour-joining tree with a sum of differences goodness of fit = 99.96%. Four clusters were formed and corroborate with the clusters formed via the neighbour-joining method. Each cluster is denoted by a coloured bubble. Overall, four clusters are observed within block VIII.
Figure 7. (a) Neighbour-joining tree of 65 sequences based on block VIII of pkmsp-1 gene with 1000 bootstraps. The numbers next to the nodes represent the percentages that support the bifurcation for 1000 bootstrap replicates. (b) Neighbour-net tree of the same 65 sequences used in the neighbour-joining tree with a sum of differences goodness of fit = 99.96%. Four clusters were formed and corroborate with the clusters formed via the neighbour-joining method. Each cluster is denoted by a coloured bubble. Overall, four clusters are observed within block VIII.
Tropicalmed 08 00285 g007
Table 1. Primers used to sequence the pkmsp-1 gene.
Table 1. Primers used to sequence the pkmsp-1 gene.
PrimerSequence 5′ to 3′Annealing Temperature (°C)
PkMSP-1_F1CGTTGGCCACTTTTAAG56
PkMSP-1_R1GCTTCCAACAAGGGTGTTGTCT
PkMSP-1_F2CCGGATAATGGAAGGCAACCAA58
PkMSP-1_R2AGGTCGTTGATCATGGTGTC
PkMSP-1_F3CTACTGAAGCAGTACGCAC58
PkMSP-1_R3CGTCTTCATCATTGCCGAACAG
PkMSP-1_F4TGAAGCAGAACCAGCAAC56
PkMSP-1_R4AATGTGCAGCCAAAGCC
Table 2. Estimates of genetic diversity indices and natural selection of pkmsp-1.
Table 2. Estimates of genetic diversity indices and natural selection of pkmsp-1.
BlockSNPsIndelsNo. of HaplotypesDiversitydN − dSTajima’s DFu and Li’s D *Fu and Li’s F *
Nucleotide (π)Haplotype (Hd)
I100440.0140.969−1.46 **−0.083−0.173−0.166
II4674530.1621.0000.341.6561.708 *2.019 *
III375490.0140.988−4.17 **−0.793−1.535−1.489
IV231326550.1741.0000.980.5451.1051.057
V120360.0120.971−0.56−1.190−1.778−1.861
VI112147490.0510.9420.860.6360.8260.389
VII259490.0180.987−3.82 **−0.250−1.114−0.930
VIII138244510.1001.0003.19 **0.4951.4621.314
IX290480.0090.988−4.81 **−1.085−1.468−1.580
Full length640805570.0260.996−5.87 **−0.093−0.193−0.183
Note: * indicates p < 0.02 and ** indicates p < 0.0001.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Noordin, N.R.; Lau, Y.L.; Cheong, F.W.; Fong, M.Y. Inter-Population Genetic Diversity and Clustering of Merozoite Surface Protein-1 (pkmsp-1) of Plasmodium knowlesi Isolates from Malaysia and Thailand. Trop. Med. Infect. Dis. 2023, 8, 285. https://doi.org/10.3390/tropicalmed8050285

AMA Style

Noordin NR, Lau YL, Cheong FW, Fong MY. Inter-Population Genetic Diversity and Clustering of Merozoite Surface Protein-1 (pkmsp-1) of Plasmodium knowlesi Isolates from Malaysia and Thailand. Tropical Medicine and Infectious Disease. 2023; 8(5):285. https://doi.org/10.3390/tropicalmed8050285

Chicago/Turabian Style

Noordin, Naqib Rafieqin, Yee Ling Lau, Fei Wen Cheong, and Mun Yik Fong. 2023. "Inter-Population Genetic Diversity and Clustering of Merozoite Surface Protein-1 (pkmsp-1) of Plasmodium knowlesi Isolates from Malaysia and Thailand" Tropical Medicine and Infectious Disease 8, no. 5: 285. https://doi.org/10.3390/tropicalmed8050285

APA Style

Noordin, N. R., Lau, Y. L., Cheong, F. W., & Fong, M. Y. (2023). Inter-Population Genetic Diversity and Clustering of Merozoite Surface Protein-1 (pkmsp-1) of Plasmodium knowlesi Isolates from Malaysia and Thailand. Tropical Medicine and Infectious Disease, 8(5), 285. https://doi.org/10.3390/tropicalmed8050285

Article Metrics

Back to TopTop