Trichomonas tenax: A Neglected Protozoan Infection in the Oral Cavities of Humans and Dogs—A Scoping Review
Abstract
1. Introduction
2. Materials and Methods
2.1. Data Search Strategy
2.2. Study Inclusion and Exclusion Criteria
2.3. Data Extraction
3. Results
3.1. History
3.2. Morphology and Reproduction
3.3. Host
3.4. Culture
3.5. Molecular Diagnosis
3.6. Prevalence
3.6.1. Humans
3.6.2. Domestic Dogs
3.7. Pathogenesis and Virulence Factors
3.8. Control and Prevention
4. Discussion
5. Conclusions
| Method | Target Gene | Primers | Expected Amplicon Size (bp) | Limit of Detection | References |
|---|---|---|---|---|---|
| PCR | 18S rRNA | 5′AGTTCCATCGATGCCATTC3′ 5′GCATCTAAGGACTTAGACG3′ | 862 | 100 fg or 5 cells | [1] |
| PCR | ITS1-5.8S rRNA-ITS2 | 5′GAGAAGTCGTAACAAGGTACG3′ 5′ATGCTTCAGTTCAGCGGGTCT3′ | 368 | N/A | [4] |
| PCR | rpb1 gene | 5′GCTGTCATCTCTTGTGGGGCTG3′ 5′AAACTCATGGGAGCTGCTGGTTC3′ | 3048 | N/A | [59] |
| PCR | Beta-tubulin gene | 5′ATACTCTATCGTCCCATCTC3′ 5′GCCATCATGTTCTTGTTATCG3′ | 405 | N/A | [60] |
| LAMP | ITS1-5.8S rRNA-ITS2 | 5′GTCATGATGTATGCAACTCCGG-TCCTCACACGATGAAGAACG3′ 5′GGTTAATCTTTGAATGCAAATTGCG-TGTACTGTTACACGCATGCTTCT3′ 5′ACATTATGCCACGTTCTTCATCG3′ 5′TGCGCTAAACTTGGCTTCGG3′ 5′AGCAATGGATGTCTTGGC3′ 5′GCAGACAACGTAAGTTTGT3′ | N/A | 10 fg or 1 cell | [52] |
| Periodontitis Patients | Healthy Individuals | |||||
|---|---|---|---|---|---|---|
| Country or Region | No. Tested (Positive) | Prevalence (%) | No. Tested (Positive) | Prevalence (%) | Method * (M, PCR) | References |
| America | ||||||
| Brazil | 100 (51) | 51 | N/A | N/A | M | [21] |
| Chile | 30 (21) | 70 | N/A | N/A | PCR | [60] |
| USA | 350 (315) | 90 | N/A | N/A | M | [38] |
| Asia | ||||||
| Indonesia | 373 (19) | 5.1 | N/A | N/A | M | [95] |
| Iran | 50 (3) | 6 | 50 (0) | 0% | M | [56] |
| Iran Iran | 160 (34) | 21 | 160 (3) | 2 | PCR | [57] |
| 52 (14) | 19 | 52 (5) | 3 | PCR | [58] | |
| Iraq Iraq | 143 (12) | 8 | 271 (11) | 4 | M | [23] |
| 383 (31) | 8 | N/A | N/A | M | [55] | |
| Japan | 9 (5) | 56 | N/A | N/A | PCR | [1] |
| Turkey Turkey | 220 (2) | 1 | N/A | N/A | M | [22] |
| 107 (3) | 3 | N/A | N/A | M | [54] | |
| Thailand | 90(23) | 25.6 | 94(3) | 3.2 | PCR | [96] |
| Europe | ||||||
| Croatia | 51 (18) | 36 | N/A | N/A | M | [53] |
| France | 106 (37) | 35 | 85 (16) | 19 | PCR | [59] |
| Poland | 192 (26) | 14 | 226 (33) | 15 | PCR | [4] |
| Periodontitis Patients | Healthy Individuals | |||||
|---|---|---|---|---|---|---|
| Country or Region | No. Tested (positive) | Prevalence (%) | No. Tested (positive) | Prevalence (%) | Method * (M, PCR) | References |
| Czechia | 111 (9) | 8 | N/A | N/A | PCR | [3] |
| Poland | 142 (7) | 5 | N/A | N/A | PCR | [28] |
| UK | 92 (52) | 56 | 20 (4) | 20 | PCR | [29] |
| USA | 23 (22) | 96 | N/A | N/A | M | [62] |
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kikuta, N.; Yamamoto, A.; Fukura, K.; Goto, N. Specific and sensitive detection of Trichomonas tenax by the polymerase chain reaction. Lett. Appl. Microbiol. 1997, 24, 193–197. [Google Scholar] [CrossRef] [PubMed]
- Kucknoor, A.S.; Mundodi, V.; Alderete, J.F. Genetic identity and differential gene expression between Trichomonas vaginalis and Trichomonas tenax. BMC Microbiol. 2009, 9, 58. [Google Scholar] [CrossRef] [PubMed]
- Kellerová, P.; Tachezy, J. Zoonotic Trichomonas tenax and a new trichomonad species, Trichomonas brixi n. sp., from the oral cavities of dogs and cats. Int. J. Parasitol. 2017, 47, 247–255. [Google Scholar] [CrossRef]
- Dybicz, M.; Perkowski, K.; Sędzikowska, A.; Baltaza, W.; Chomicz, L. Studies on prevalence of infection with Trichomonas tenax identified by molecular techniques—In respect to oral health of patients with various systemic disease requiring immunosuppressive therapy. Ann. Parasitol. 2018, 64, 193–197. [Google Scholar] [PubMed]
- Duboucher, C.; Caby, S.; Chabé, M.; Gantois, N.; Delgado-Viscogliosi, P.; Pierce, R.; Capron, M.; Dei-Cas, E.; Viscogliosi, E. Human pulmonary trichomonoses. Press Med. 2007, 36, 835–839. [Google Scholar] [CrossRef]
- Tricco, A.C.; Lillie, E.; Zarin, W.; O’Brien, K.K.; Colquhoun, H.; Levac, D.; Moher, D.; Peters, M.D.J.; Horsley, T.; Weeks, L.; et al. PRISMA extension for scoping reviews (PRISMA-ScR): Checklist and explanation. Ann. Intern. Med. 2018, 169, 467–473. [Google Scholar] [CrossRef]
- Mehlhorn, H. Human Parasites: Diagnosis, Treatment, Prevention; Springer: New York, NY, USA, 2016. [Google Scholar] [CrossRef]
- Hamadto, H.H.A.; El Hayawan, I.A.H.; Abdallah, K.F.; Abd El-Maboud, A.I.; Mohammed, O.I.; Omar, G.H.E. Relation between Trichomonas tenax and pulmonary diseases. Egypt J. Med. Sci. 2014, 35, 633–652. [Google Scholar]
- Honigberg, B.M.; Lee, J.J. Structure and division of Trichomonas tenax (O. F. Müller). Am. J. Epidemiol. 1959, 69, 177–201. [Google Scholar] [CrossRef]
- Dobell, C. The common flagellate of the human mouth, Trichomonas tenax (O.F.M.): Its discovery and its nomenclature. Parasitology 1939, 31, 138–146. [Google Scholar] [CrossRef]
- Goodey, T.; Wellings, A.W. Observations on Entamoeba gingivalis from the human mouth, with a note on the trichomonad flagellate Tetratrichomonas buccalis n. sp. Parasitology 1917, 9, 537–559. [Google Scholar] [CrossRef]
- Wenrich, D.H. Comparative morphology of the trichomonad flagellates of man. Am. J. Trop. Med. Hyg. 1944, 24, 39–51. [Google Scholar] [CrossRef]
- Mehlhorn, H. Trichomonas tenax. In Encyclopedia of Parasitology; Mehlhorn, H., Ed.; Springer: Berlin/Heidelberg, Germany, 2015. [Google Scholar] [CrossRef]
- Marty, M.; Lemaitre, M.; Kémoun, P.; Morrier, J.J.; Monsarrat, P. Trichomonas tenax and periodontal diseases: A concise review. Parasitology 2017, 144, 1417–1425. [Google Scholar] [CrossRef]
- Kofoid, C.A.; Hinshaw, H.C.; Johnstone, H.G. Animal parasites of the mouth and their relation to dental disease**from the protozoological section of the California Stomatological Research Group and the Department of Zoology of the University of California, under the direction of Prof. Charles A. Kof. J. Am. Dent. Assoc. 1929, 16, 1436–1455. [Google Scholar] [CrossRef]
- Ribaux, C.L.; Joffre, A.; Magloire, H. Trichomonas tenax: Ultrastructure of giant forms. J. Biol. Buccale 1988, 16, 19–23. [Google Scholar] [PubMed]
- Ribeiro, L.C.; Santos, C.; Benchimol, M. Is Trichomonas tenax a parasite or a commensal? Protist 2015, 166, 196–210. [Google Scholar] [CrossRef] [PubMed]
- Petrin, D.; Delgaty, K.; Bhatt, R.; Garber, G. Clinical and microbiological aspects of Trichomonas vaginalis. Clin. Microbiol. Rev. 1998, 11, 300–317. [Google Scholar] [CrossRef]
- Yao, C.; Ketzis, J.K. Aberrant and accidental trichomonad flagellate infections: Rare or underdiagnosed? Trans. R. Soc. Trop. Med. Hyg. 2018, 112, 64–72. [Google Scholar] [CrossRef]
- Atwood Kofoid, C. The protozoa of the human mouth. J. Parasitol. 1929, 15, 151–174. [Google Scholar] [CrossRef]
- Norberg, C.M.B.M. Entamoeba Gingivalis (Gros, 1849) and Trichomonas Tenax (Muller, 1773) oral infections in patients from Baixada Fluminense, Province of Rio de Janeiro, Brazil. Sci. J. Public Health 2014, 2, 288–292. [Google Scholar] [CrossRef]
- Özçelik, S.; Gedik, T.; Gedik, R.; Malatyali, E. Investigation of the relationship between oral and dental health and presence of Entamoeba gingivalis and Trichomonas tenax. Turk. Parazitol. Derg. 2010, 34, 155–159. [Google Scholar] [CrossRef]
- Mahdi, N.K.; al-Saeed, A.T. Trichomonas tenax in Basrah, Iraq. J. Pak. Med. Assoc. 1993, 43, 261–262. [Google Scholar]
- Hegner, R.; Ratcliffe, H. Trichomonads from the vagina of the monkey, from the mouth of the cat and man, and from the intestine of the monkey, Opossum and Prairie-dog. J. Parasitol. 1927, 14, 27. [Google Scholar] [CrossRef]
- Fedorych, P.V.; Mavrov, G.I.; Osinska, T.V.; Shcherbakova, Y.V. Protozoan genital invasions caused by the representatives of trichomonas and giardia. Wiad. Lek. 2020, 73, 380–383. [Google Scholar] [CrossRef]
- Brosh-Nissimov, T.; Hindiyeh, M.; Azar, R.; Smollan, G.; Belausov, N.; Mandelboim, M.; Rahav, G.; Keller, N.; Gefen-Halevi, S. A false-positive Trichomonas vaginalis result due to Trichomonas tenax presence in clinical specimens may reveal a possible T. tenax urogenital infection. Clin. Microbiol. Infect. 2019, 25, 123–124. [Google Scholar] [CrossRef]
- Crucitti, T.; Jespers, V.; Mulenga, C.; Khondowe, S.; Vandepitte, J.; Buvé, A. Trichomonas vaginalis is highly prevalent in adolescent girls, pregnant women, and commercial sex workers in Ndola, Zambia. Sex. Transm. Dis. 2010, 37, 223–227. [Google Scholar] [CrossRef]
- Dybicz, M.; Perkowski, K.; Baltaza, W.; Padzik, M.; Sędzikowska, A.; Chomicz, L. Molecular identification of trichomonas tenax in the oral environment of domesticated animals in poland—Potential effects of host diversity for human health. Ann. Agric. Environ. Med. 2018, 25, 464–468. [Google Scholar] [CrossRef] [PubMed]
- Patel, N.; Colyer, A.; Harris, S.; Holcombe, L.; Andrew, P. The prevalence of canine oral protozoa and their association with periodontal disease. J. Eukaryot. Microbiol. 2017, 64, 286–292. [Google Scholar] [CrossRef] [PubMed]
- Martínez-Herrero, M.C.; Garijo-Toledo, M.M.; Liebhart, D.; Ganas, P.; Martínez-Díaz, R.A.; Ponce-Gordo, F.; Carrero-Ruiz, A.; Hess, M.; Gómez-Muñoz, M.T. Novel avian oropharyngeal trichomonads isolated from European turtle doves (Streptopelia turtur) and racing pigeons (Columba livia): Genetic and morphometric characterisation of clonal cultures. Infect. Genet. Evol. 2017, 55, 93–103. [Google Scholar] [CrossRef] [PubMed]
- Landman, W.J.M.; Gantois, N.; Sawant, M.; Majoor, F.A.; van Eck, J.H.H.; Viscogliosi, E. Prevalence of trichomonads in the cloaca of wild wetland birds in the Netherlands. Avian Pathol. 2021, 50, 465–476. [Google Scholar] [CrossRef]
- Jiang, X.; Sun, J.; Wang, F.; Li, H.; Zhao, X. Prevalence of Trichomonas spp. in domestic pigeons in Shandong Province, China, and genotyping by restriction fragment length polymorphism. Vet. J. 2016, 211, 88–93. [Google Scholar] [CrossRef]
- Lennon, R.J.; Dunn, J.C.; Stockdale, J.E.; Goodman, S.J.; Morris, A.J.; Hamer, K.C. Trichomonad parasite infection in four species of Columbidae in the UK. Parasitology 2013, 140, 1368–1376. [Google Scholar] [CrossRef]
- Grabensteiner, E.; Bilic, I.; Kolbe, T.; Hess, M. Molecular analysis of clonal trichomonad isolates indicate the existence of heterogenic species present in different birds and within the same host. Vet. Parasitol. 2010, 172, 53–64. [Google Scholar] [CrossRef]
- Gerhold, R.W.; Yabsley, M.J.; Smith, A.J.; Ostergaard, E.; Mannan, W.; Cann, J.D.; Fischer, J.R. Molecular characterization of the Trichomonas gallinae morphologic complex in the United States. J. Parasitol. 2008, 94, 1335–1341. [Google Scholar] [CrossRef]
- Lynch, K. Trichomoniasis of the vagina and the mouth. Cultivation of the causative organism and experimental infection. (A Preliminary Communication). Am. J. Trop. Dis. Prev. Med. 1915, 2, 627–634. [Google Scholar]
- Ohira, T.; Noguchi, H. The cultivation of trichomonas of the human mouth (Tetratrichomonas hominis). J. Exp. Med. 1917, 25, 341–347. [Google Scholar] [CrossRef]
- Hinshaw, H.C. Correlation of protozoan infections of human mouth with extent of certain lesions in pyorrhea alveolaris. Proc. Soc. Exp. Biol. Med. 1926, 24, 71–73. [Google Scholar] [CrossRef]
- Hogue, M.J. Studies on Trichomonas buccalis. Am. J. Trop. Med. Hyg. 1926, s1-6, 75–89. [Google Scholar] [CrossRef]
- Diamond, L.S.; Bartgis, I.L. Axenic cultivation of Trichomonas tenax, the oral flagellate of man I. Establishment of cultures. J. Protozool. 1962, 9, 442–444. [Google Scholar] [CrossRef] [PubMed]
- Wantland, W.W.; Wantland, E.M.; Winquist, D.L. Collection, identification, and cultivation of oral protozoa. J. Dent. Res. 1963, 42, 1234–1241. [Google Scholar] [CrossRef] [PubMed]
- Asai, S.; Hayashi, A.; Nakamura, Y.; Kato, M.; Sato, M.; Nitta, H.; Namikawa, I. Growth of Trichomonas tenax in tissue culture medium containing complement and antiserum to the accompanying bacteria. Jpn. J. Oral Biol. 1986, 28, 731–736. [Google Scholar] [CrossRef]
- Pardi, G.; Perrone, M.; Mazzali de Ilja, R. Incidencia de Trichomonas tenax en pacientes con periodontitis marginal crónica. Acta Odontológica Venez. 2002, 40, 152–159. [Google Scholar]
- Lin, C.; Ying, F.; Lai, Y.; Li, X.; Xue, X.; Zhou, T.; Hu, D. Use of nested PCR for the detection of trichomonads in bronchoalveolar lavage fluid. BMC Infect. Dis. 2019, 19, 512. [Google Scholar] [CrossRef]
- Szczepaniak, K.; Łojszczyk-Szczepaniak, A.; Tomczuk, K.; Skrzypek, T.; Lisiak, B.; Abd-Al-Hammza Abbass, Z. Canine Trichomonas tenax mandibular gland infestation. Acta Vet. Scand. 2016, 58, 15. [Google Scholar] [CrossRef]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef]
- Lenkowski, M.; Nijakowski, K.; Kaczmarek, M.; Surdacka, A. The loop-mediated isothermal amplification technique in periodontal diagnostics: A systematic review. J. Clin. Med. 2021, 10, 1189. [Google Scholar] [CrossRef]
- Kato, H.; Yoshida, A.; Ansai, T.; Watari, H.; Notomi, T.; Takehara, T. Loop-mediated isothermal amplification method for the rapid detection of Enterococcus faecalis in infected root canals. Oral Microbiol. Immunol. 2007, 22, 131–135. [Google Scholar] [CrossRef] [PubMed]
- de Lira Nunes, M.; Mendes-Marques, C.L.; de Almeida, A.M.P.; Leal, N.C. The development of a Loop-mediated isothermal amplification (LAMP) procedure for plague diagnostic. Am. J. Anal. Chem. 2014, 05, 1069–1077. [Google Scholar] [CrossRef]
- Reyes, J.C.B.; Solon, J.A.A.; Rivera, W.L. Development of a loop-mediated isothermal amplification assay for detection of Trichomonas vaginalis. Diagn. Microbiol. Infect. Dis. 2014, 79, 337–341. [Google Scholar] [CrossRef]
- Li, W.; Lee, S.Y.; Back, C.G.; Ten, L.N.; Jung, H.Y. Loop-mediated isothermal amplification for the detection of Xanthomonas arboricola pv. Pruni in peaches. Plant Pathol. J. 2019, 35, 635–643. [Google Scholar] [CrossRef]
- Matthew, M.A.; Christie, J.; Yang, N.; Yao, C. A Loop-mediated isothermal amplification (LAMP) assay specific to Trichomonas tenax is suitable for use at point-of-care. Microorganisms 2022, 10, 594. [Google Scholar] [CrossRef]
- Potočki-Tukša, K.; Granić, J.; Šegović, S.; Buntak-Kobler, D. Trichomonas Tenax in human oral cavity. Acta Stomatol. Croat. 1993, 27, 255–261. [Google Scholar]
- Yazar, S.; Çetinkaya, Ü.; Hamamcı, B.; Alkan, A.; Şişman, Y.; Esen, Ç.; Kolay, M. Investigation of Entamoeba gingivalis and Trichomonas tenax in periodontitis or gingivitis patients in Kayseri. Turk. Parazitolojii Derg. 2016, 40, 17. [Google Scholar] [CrossRef]
- Ali Mohammed, S.A.; Mohsen Alwaaly, A.B. Prevalence Trichomonas tenax in Karbala Governorate. J. Phys. Conf. Ser. 2019, 1294, 062030. [Google Scholar] [CrossRef]
- Ghabanchi, J.; Zibaei, M.; Afkar, M.D.; Sarbazie, A.H. Prevalence of oral Entamoeba gingivalis and Trichomonas tenax in patients with periodontal disease and healthy population in Shiraz, southern Iran. Indian J. Dent. Res. 2010, 21, 89. [Google Scholar] [CrossRef] [PubMed]
- Athari, A.; Soghandi, L.; Haghighi, A.; Kazemi, B. Prevalence of oral trichomoniasis in patients with periodontitis and gingivitis using PCR and direct smear. Iran J. Public Health 2007, 36, 33–37. [Google Scholar]
- Mehr, A.K.; Zarandi, A.; Anush, K. Prevalence of oral Trichomonas tenax in periodontal lesions of down syndrome in Tabriz, Iran. J. Clin. Diagn. Res. 2015, 9, ZC88. [Google Scholar] [CrossRef] [PubMed]
- Benabdelkader, S.; Andreani, J.; Gillet, A.; Terrer, E.; Pignoly, M.; Chaudet, H.; Aboudharam, G.; La Scola, B. Specific clones of Trichomonas tenax are associated with periodontitis. PLoS ONE 2019, 14, e0213338. [Google Scholar] [CrossRef]
- Bracamonte-Wolf, C.; Orrego, P.R.; Muñoz, C.; Herrera, D.; Bravo, J.; Gonzalez, J.; Varela, H.; Catalán, A.; Araya, J.E. Observational cross-sectional study of Trichomonas tenax in patients with periodontal disease attending a Chilean university dental clinic. BMC Oral Health 2019, 19, 207. [Google Scholar] [CrossRef]
- Azadbakht, K.; Baharvand, P.; Artemes, P.; Niazi, M.; Mahmoudvand, H. Prevalence and risk factors of oral cavity parasites in pregnant women in Western Iran. Parasite Epidemiol. Control 2022, 19, e00275. [Google Scholar] [CrossRef]
- Hegner, R.; Ratcliffe, H. Trichomonads from the mouth of the dog. J. Parasitol. 1927, 14, 51. [Google Scholar] [CrossRef]
- Eslahi, A.V.; Olfatifar, M.; Abdoli, A.; Houshmand, E.; Johkool, M.G.; Zarabadipour, M.; Abadi, P.A.; Ghorbani, A.; Mirzadeh, M.; Badri, M. The neglected role of Trichomonas tenax in oral diseases: A systematic review and meta-analysis. Acta Parasitol. 2021, 66, 715–732. [Google Scholar] [CrossRef]
- Bisson, C.; Dridi, S.M.; Machouart, M. Assessment of the role of Trichomonas tenax in the etiopathogenesis of human periodontitis: A systematic review. PLoS ONE 2019, 14, e0226266. [Google Scholar] [CrossRef] [PubMed]
- Bózner, P.; Demeš, P. Cell-associated and extracellular proteolytic activity of an oral flagellate, Trichomonas tenax. Arch. Oral Biol. 1991, 36, 77–83. [Google Scholar] [CrossRef] [PubMed]
- Ribaux, C.L. Study of an oral protozoan Trichomonas tenax using scanning and transmission electron microscopy. J. Biol. Buccale 1979, 7, 157–168. [Google Scholar] [PubMed]
- Ribaux, C.L.; Magloire, H.; Joffre, A.; Morrier, J.J. Immunohistochemical localization of fibronectin-like protein on the cell surface of the oral flagelatte Trichomonas tenax. J. Biol. Buccale 1983, 11, 41–51. [Google Scholar]
- Bózner, P.; Demeš, P. Degradation of collagen types I, III, IV and V by extracellular proteinases of an oral flagellate Trichomonas tenax. Arch. Oral Biol. 1991, 36, 765–770. [Google Scholar] [CrossRef]
- Nagao, E.; Yamamoto, A.; Igarashi, T.; Goto, N.; Sasa, R. Two distinct hemolysins in Trichomonas tenax ATCC 30207. Oral Microbiol. Immunol. 2000, 15, 355–359. [Google Scholar] [CrossRef]
- El Sibaei, M.M.; Abdel-Fattah, N.S.; Ahmed, S.A.; Abou-Seri, H.M. Growth kinetics, antigen profiling, and proteinase activity of Egyptian Trichomonas tenax isolates derived from patients having oral infections. Exp. Parasitol. 2012, 130, 416–422. [Google Scholar] [CrossRef]
- Neale, K.A.; Alderete, J.F. Analysis of the proteinases of representative Trichomonas vaginalis isolates. Infect. Immun. 1990, 58, 157–162. [Google Scholar] [CrossRef]
- Nawaz, M.; Malik, M.I.; Hameed, M.; Zhou, J. Research progress on the composition and function of parasite-derived exosomes. Acta Trop. 2019, 196, 30–36. [Google Scholar] [CrossRef]
- Twu, O.; de Miguel, N.; Lustig, G.; Stevens, G.C.; Vashisht, A.A.; Wohlschlegel, J.A.; Johnson, P.J. Trichomonas vaginalis exosomes deliver cargo to host cells and mediate host:parasite interactions. PLoS Pathog. 2013, 9, 22–24. [Google Scholar] [CrossRef] [PubMed]
- Marshall, S.; Kelly, P.H.; Singh, B.K.; Pope, R.M.; Kim, P.; Zhanbolat, B.; Wilson, M.E.; Yao, C. Extracellular release of virulence factor major surface protease via exosomes in Leishmania infantum promastigotes. Parasites Vectors 2018, 11, 355. [Google Scholar] [CrossRef] [PubMed]
- Schwebke, J.R.; Burgess, D. Trichomoniasis. Clin. Microbiol. Rev. 2004, 17, 794–803. [Google Scholar] [CrossRef] [PubMed]
- Cudmore, S.L.; Garber, G.E. Prevention or treatment: The benefits of Trichomonas vaginalis vaccine. J. Infect. Public Health 2010, 3, 47–53. [Google Scholar] [CrossRef]
- Rashidi Maybodi, F.; Haerian Ardakani, A.; Fattahi Bafghi, A.; Haerian Ardakani, A.; Zafarbakhsh, A. The effect of nonsurgical periodontal therapy on Trichomonas tenax and Entamoeba gingivalis in patients with chronic periodontitis. J. Dent. 2016, 17, 171–176. [Google Scholar]
- Moroz, J.; Kurnatowska, A.J.; Kurnatowski, P. The in vitro activity of selected mouthrinses on the reference strains of Trichomonas tenax and Entamoeba gingivalis. Ann. Parasitol. 2019, 65, 257–265. [Google Scholar] [CrossRef]
- Bouchemal, K.; Bories, C.; Loiseau, P.M. Strategies for prevention and treament of Trichomonas vaginalis infections. Am. Soc. Microbiol. 2017, 30, 811–825. [Google Scholar] [CrossRef]
- Shiota, T.; Arizono, N.; Morimoto, T.; Shimatsu, A.; Nakao, K. Trichomonas tenax empyema in an immunocompromised patient with advanced cancer. Parasite 1998, 5, 375–377. [Google Scholar] [CrossRef]
- Prieto-Prieto, J.; Calvo, A. Microbiological basis of oral infections and sensitivity to antibiotics. Med. Oral Patol. Oral Cir. Bucal 2004, 9 (Suppl. S15-8), 11–14. [Google Scholar]
- Wu, Y.; Ye, Y.; Yang, Y.; Yang, W.; Lin, J.; Cao, K. Pyopneumothorax from coinfection by Trichomonas tenax and Geotrichum capitatum in a child from China: A case report. BMC Infect. Dis. 2021, 21, 842. [Google Scholar] [CrossRef]
- Dimasuay, K.G.B.; Rivera, W.L. First report of Trichomonas tenax infections in the Philippines. Parasitol. Int. 2014, 63, 400–402. [Google Scholar] [CrossRef] [PubMed]
- Mahmoud, M.S.E.; Rahman, G.A. Pulmonary trichomoniasis: Improved diagnosis by using polymerase chain reaction targeting Trichomonas tenax 18S rRNA gene in sputum specimens. J. Egypt. Soc. Parasitol. 2004, 34, 197–211. [Google Scholar]
- Hersh, S.M. Pulmonary trichomoniasis and Trichomonas tenax. J. Med. Microbiol. 1985, 20, 1–10. [Google Scholar] [CrossRef]
- Duboucher, C.; Farto-Bensasson, F.; Chéron, M.; Peltier, J.Y.; Beaufils, F.; Périé, G. Lymph node infection by Trichomonas tenax: Report of a case with co-infection by Mycobacterium tuberculosis. Hum. Pathol. 2000, 31, 1317–1321. [Google Scholar] [CrossRef]
- Jakobsen, E.B.; Friis-Møller, A.; Friis, J. Trichomonas species in a subhepatic abscess. Eur. J. Clin. Microbiol. 1987, 6, 296–297. [Google Scholar] [CrossRef]
- Maritz, J.M.; Land, K.M.; Carlton, J.M.; Hirt, R.P. What is the importance of zoonotic trichomonads for human health? Trends Parasitol. 2014, 30, 333–341. [Google Scholar] [CrossRef] [PubMed]
- Martin-Garcia, D.F.; Sallam, M.; Garcia, G.; Santi-Rocca, J. Parasites in periodontal health and disease: A systematic review and meta-analysis. Adv. Exp. Med. Biol. 2022, 1373, 95–111. [Google Scholar] [CrossRef] [PubMed]
- Arpag, O.F.; Kaya, O.M. Presence of Trichomonas tenax and Entamoeba gingivalis in peri-implantitis lesions. Quintessence Int. 2020, 51, 212–218. [Google Scholar] [CrossRef]
- Dubar, M.; Zaffino, M.L.; Remen, T.; Thilly, N.; Cunat, L.; Machouart, M.C.; Bisson, C. Protozoans in subgingival biofilm: Clinical and bacterial associated factors and impact of scaling and root planing treatment. J. Oral Microbiol. 2020, 12, 12. [Google Scholar] [CrossRef]
- Yamamoto, A.; Asaga, E.; Nagao, E.; Igarashi, T.; Goto, N. Characterization of the cathepsin B-like proteinases of Trichomonas tenax ATCC 30207. Oral Microbiol. Immunol. 2000, 15, 360–364. [Google Scholar] [CrossRef]
- Yang, N.; Christine, J.; Keen, H.L.; Matthew, M.A.; Yao, C. Draft genome sequence of Trichomonas tenax strain Hs-4:NIH. Microbiol. Resour. Announc. 2022, 11, e00157-22. [Google Scholar] [CrossRef] [PubMed]
- Nazir, M.; Al-Ansari, A.; Al-Khalifa, K.; Alhareky, M.; Gaffar, B.; Almas, K. Global prevalence of periodontal disease and lack of its surveillance. Sci. World J. 2020, 2020. [Google Scholar] [CrossRef]
- Palmieri, J.R.; Halverson, B.A.; Sudjadi, S.T.; Purnomo; Masbar, S. Parasites found in the mouths of inhabitants of three villages of South Kalimantan (Borneo), Indonesia. Trop. Geogr. Med. 1984, 36, 57–59. [Google Scholar] [PubMed]
- Yaseen, A.; Mahafzah, A.; Dababseh, D.; Taim, D.; Hamdan, A.A.; Al-Fraihat, E.; Hassona, Y.; Şahin, G.Ö.; Santi-Rocca, J.; Sallam, M. Oral colonization by Entamoeba gingivalis and Trichomonas tenax: A PCR-based study in health, gingivitis, and periodontitis. Front. Cell. Infect. Microbiol. 2021, 1204. [Google Scholar] [CrossRef] [PubMed]

| Database | Search Terms | Results |
|---|---|---|
| PubMed | Trichomonas tenax Trichomonas elongata | 138 5 |
| Google Scholar | Trichomonas tenax Trichomonas elongata | 153 25 |
| Trichomonas vaginalis | Trichomonas tenax | Pentatrichomonas hominis | Tritrichomonas foetus | Tetratrichomonas gallinarum | Trichomonas gallinae | |
|---|---|---|---|---|---|---|
| Definitive host | Humans | Humans, dogs, etc. | Humans, cattle, etc. | Cattle | Bird | Bird |
| Predilection site | Urogenital tract | Mouth cavity | Intestine | Urogenital tract | Intestine | Intestine |
| Shape | Piriform | Oblong | Pear-shaped to round | Spindle to pear-shaped | Fusiform to round | Pear-shaped to round |
| Size (µm) | 7–32 × 5–12 | 5–16 × 2–15 | 8–20 × 3–14 | 10–25 × 3–15 | 6–15 | 12.5–20 |
| Anterior flagella | Four | Four | Five | Three | Four | Four |
| Recurrent flagellum | Extends about 2/3 of the body | Ending posterior to the middle of the body | Entire length of the cell and beyond | Entire length of the body and beyond | Entire length of the cell and beyond | Almost the entire length of the body |
| Free posterior flagellum | N | N | Y | Y | Y | N |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Matthew, M.A.; Yang, N.; Ketzis, J.; Mukaratirwa, S.; Yao, C. Trichomonas tenax: A Neglected Protozoan Infection in the Oral Cavities of Humans and Dogs—A Scoping Review. Trop. Med. Infect. Dis. 2023, 8, 60. https://doi.org/10.3390/tropicalmed8010060
Matthew MA, Yang N, Ketzis J, Mukaratirwa S, Yao C. Trichomonas tenax: A Neglected Protozoan Infection in the Oral Cavities of Humans and Dogs—A Scoping Review. Tropical Medicine and Infectious Disease. 2023; 8(1):60. https://doi.org/10.3390/tropicalmed8010060
Chicago/Turabian StyleMatthew, Maurice A., Nawu Yang, Jennifer Ketzis, Samson Mukaratirwa, and Chaoqun Yao. 2023. "Trichomonas tenax: A Neglected Protozoan Infection in the Oral Cavities of Humans and Dogs—A Scoping Review" Tropical Medicine and Infectious Disease 8, no. 1: 60. https://doi.org/10.3390/tropicalmed8010060
APA StyleMatthew, M. A., Yang, N., Ketzis, J., Mukaratirwa, S., & Yao, C. (2023). Trichomonas tenax: A Neglected Protozoan Infection in the Oral Cavities of Humans and Dogs—A Scoping Review. Tropical Medicine and Infectious Disease, 8(1), 60. https://doi.org/10.3390/tropicalmed8010060

