Anthropophagy and Ecological Bridges: Blood-Meal Patterns of Invasive Aedes albopictus (Skuse, 1894) and Native Aedes aegypti Linnaeus, 1762 and Their Implications for Arbovirus Emergence in Central Africa
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Sites
2.2. Mosquito Collection and Identification
2.3. DNA Extraction, Amplification, and Sequencing of the Cytochrome Oxidase Genes for Blood Meal Identification
2.4. Phylogenetic and Statistical Analysis
3. Results
3.1. Mosquito Abundance
3.2. Abundance of Blood-Fed Aedes spp. Females
3.3. Identification of Blood-Meal Hosts
4. Discussion
Limitations and Methodological Considerations
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- WHO. Surveillance and Control of Arboviral Diseases in the WHO African Region: Assessment of Country Capacities; World Health Organization: Geneva, Switzerland, 2022.
- Gratz, N. Critical review of the vector status of Aedes albopictus. Med. Vet. Entomol. 2004, 18, 215–227. [Google Scholar] [CrossRef]
- Longbottom, J.; Walekhwa, A.W.; Mwingira, V.; Kijanga, O.; Mramba, F.; Lord, J.S. Aedes albopictus invasion across Africa: The time is now for cross-country collaboration and control. Lancet Glob. Health 2023, 11, e623–e628. [Google Scholar] [CrossRef] [PubMed]
- Bhatt, L.; Pandey, D. Review on Dengue Fever. Int. J. Multidiscip. Educ. Res. 2023, 12, 74–86. [Google Scholar]
- Haider, N.; Hasan, M.N.; Onyango, J.; Billah, M.; Khan, S.; Papakonstantinou, D.; Paudyal, P.; Asaduzzaman, M. Global Dengue Epidemic Worsens with Record 14 Million Cases and 9000 Deaths Reported in 2024. Int. J. Infect. Dis. 2025, 158, 107940. [Google Scholar] [CrossRef]
- Paz-Bailey, G.; Adams, L.E.; Deen, J.; Anderson, K.B.; Katzelnick, L.C. Dengue. Lancet 2024, 403, 667–682. [Google Scholar] [CrossRef] [PubMed]
- Simo Tchetgna, H.; Sado Yousseu, F.; Kamgang, B.; Tedjou, A.; McCall, P.J.; Wondji, C.S. Concurrent circulation of dengue serotype 1, 2 and 3 among acute febrile patients in Cameroon. PLoS Neglected Trop. Dis. 2021, 15, e0009860. [Google Scholar] [CrossRef]
- Pereira-dos-Santos, T.; Roiz, D.; Lourenço-de-Oliveira, R.; Paupy, C. A systematic review: Is Aedes albopictus an efficient bridge vector for zoonotic arboviruses? Pathogens 2020, 9, 266. [Google Scholar] [CrossRef]
- Fikrig, K.; Harrington, L.C. Understanding and interpreting mosquito blood feeding studies: The case of Aedes albopictus. Trends Parasitol. 2021, 37, 959–975. [Google Scholar] [CrossRef]
- Reeves, L.E.; Burkett-Cadena, N.D. Amplification and identification of vertebrate host cytochrome c oxidase subunit I (COI) DNA barcoding templates from mosquito blood meals. Cold Spring Harb. Protoc. 2024, 2024, pdb. prot108292. [Google Scholar] [CrossRef] [PubMed]
- Murugan, K.; Vadivalagan, C.; Karthika, P.; Panneerselvam, C.; Paulpandi, M.; Subramaniam, J.; Wei, H.; Aziz, A.T.; Alsalhi, M.S.; Devanesan, S. DNA barcoding and molecular evolution of mosquito vectors of medical and veterinary importance. Parasitol. Res. 2016, 115, 107–121. [Google Scholar] [CrossRef]
- Kamgang, B.; Nchoutpouen, E.; Simard, F.; Paupy, C. Notes on the blood-feeding behavior of Aedes albopictus (Diptera: Culicidae) in Cameroon. Parasites Vectors 2012, 5, 57. [Google Scholar] [CrossRef] [PubMed]
- Sivan, A.; Shriram, A.; Sunish, I.; Vidhya, P. Host-feeding pattern of Aedes aegypti and Aedes albopictus (Diptera: Culicidae) in heterogeneous landscapes of South Andaman, Andaman and Nicobar Islands, India. Parasitol. Res. 2015, 114, 3539–3546. [Google Scholar] [CrossRef]
- Pereira dos Santos, T.; Roiz, D.; Santos de Abreu, F.V.; Luz, S.L.B.; Santalucia, M.; Jiolle, D.; Santos Neves, M.S.A.; Simard, F.; Lourenço-de-Oliveira, R.; Paupy, C. Potential of Aedes albopictus as a bridge vector for enzootic pathogens at the urban-forest interface in Brazil. Emerg. Microbes Infect. 2018, 7, 1–8. [Google Scholar] [CrossRef]
- Pruszynski, C.A.; Stenn, T.; Acevedo, C.; Leal, A.L.; Burkett-Cadena, N.D. Human blood feeding by Aedes aegypti (Diptera: Culicidae) in the Florida Keys and a review of the literature. J. Med. Entomol. 2020, 57, 1640–1647. [Google Scholar] [CrossRef]
- Sene, N.M.; Diouf, B.; Gaye, A.; Ndiaye, E.H.; Ngom, E.H.M.; Gueye, A.; Seck, F.; Diagne, C.T.; Dia, I.; Diallo, D. Blood feeding patterns of Aedes aegypti populations in Senegal. Am. J. Trop. Med. Hyg. 2022, 106, 1402. [Google Scholar] [CrossRef] [PubMed]
- Jupp, P.G.; Kemp, A. Aedes albopictus and other mosquitoes imported in tires into Durban, South Africa. J. Am. Mosq. Control Assoc. 1992, 8, 321–322. [Google Scholar]
- Kamgang, B.; Ngoagouni, C.; Manirakiza, A.; Nakoune, E.; Paupy, C.; Kazanji, M. Temporal patterns of abundance of Aedes aegypti and Aedes albopictus (Diptera: Culicidae) and mitochondrial DNA analysis of Ae. albopictus in the Central African Republic. PLoS Neglected Trop. Dis. 2013, 7, e2590. [Google Scholar] [CrossRef] [PubMed]
- Tedjou, A.N.; Kamgang, B.; Yougang, A.P.; Njiokou, F.; Wondji, C.S. Update on the geographical distribution and prevalence of Aedes aegypti and Aedes albopictus (Diptera: Culicidae), two major arbovirus vectors in Cameroon. PLoS Neglected Trop. Dis. 2019, 13, e0007137. [Google Scholar] [CrossRef]
- Weetman, D.; Kamgang, B.; Badolo, A.; Moyes, C.L.; Shearer, F.M.; Coulibaly, M.; Pinto, J.; Lambrechts, L.; McCall, P.J. Aedes Mosquitoes and Aedes-Borne Arboviruses in Africa: Current and Future Threats. Int. J. Environ. Res. Public Health 2018, 15, 220. [Google Scholar] [CrossRef]
- Delatte, H.; Desvars, A.; Bouétard, A.; Bord, S.; Gimonneau, G.; Vourc’h, G.; Fontenille, D. Blood-feeding behavior of Aedes albopictus, a vector of Chikungunya on La Réunion. J. Vector-Borne Zoonotic Dis. 2010, 10, 249–258. [Google Scholar] [CrossRef]
- Tantely, L.M.; Andriamandimby, S.F.; Ambinintsoa, M.F.; Raharinirina, M.R.; Rafisandratantsoa, J.T.; Ravalohery, J.P.; Harimanana, A.; Ranoelison, N.N.; Irinantenaina, J.; Ankasitrahana, M.F.; et al. An Entomological Investigation during a Recent Rift Valley Fever Epizootic/Epidemic Reveals New Aspects of the Vectorial Transmission of the Virus in Madagascar. Pathogens 2024, 13, 258. [Google Scholar] [CrossRef]
- Egid, B.R.; Coulibaly, M.; Dadzie, S.K.; Kamgang, B.; McCall, P.J.; Sedda, L.; Toe, K.H.; Wilson, A.L. Review of the ecology and behaviour of Aedes aegypti and Aedes albopictus in Western Africa and implications for vector control. Curr. Res. Parasitol. Vector-Borne Dis. 2022, 2, 100074. [Google Scholar] [CrossRef]
- Montgomery, M.J.; Harwood, J.F.; Yougang, A.P.; Wilson-Bahun, T.A.; Tedjou, A.N.; Keumeni, C.R.; Wondji, C.S.; Kamgang, B.; Kilpatrick, A.M. The effects of urbanization, temperature, and rainfall on Aedes aegypti and Aedes albopictus mosquito abundance across a broad latitudinal gradient in Central Africa. Parasites Vectors 2025, 18, 135. [Google Scholar] [CrossRef]
- Paupy, C.; Ollomo, B.; Kamgang, B.; Moutailler, S.; Rousset, D.; Demanou, M.; Hervé, J.-P.; Leroy, E.; Simard, F. Comparative role of Aedes albopictus and Aedes aegypti in the emergence of Dengue and Chikungunya in central Africa. Vector-Borne Zoonotic Dis. 2010, 10, 259–266. [Google Scholar] [CrossRef]
- Grard, G.; Caron, M.; Mombo, I.M.; Nkoghe, D.; Mboui Ondo, S.; Jiolle, D.; Fontenille, D.; Paupy, C.; Leroy, E.M. Zika virus in Gabon (Central Africa)–2007: A new threat from Aedes albopictus? PLoS Neglected Trop. Dis. 2014, 8, e2681. [Google Scholar] [CrossRef] [PubMed]
- Kamgang, B.; Yougang, A.P.; Tchoupo, M.; Riveron, J.M.; Wondji, C. Temporal distribution and insecticide resistance profile of two major arbovirus vectors Aedes aegypti and Aedes albopictus in Yaoundé, the capital city of Cameroon. Parasites Vectors 2017, 10, 469. [Google Scholar] [CrossRef]
- Ebog, E. Attractivité des Animaux Sauvages en Captivité au Jardin Zoo-Botanique de Mvog-Betsi: Cas des Cercopithèques de Brazza. Rapport de stage; Centre de Formation professionnelle aux Métiers de la Foresterie, l’Environnement et l’Agriculture Durable: Le Mont-sur-Lausanne, Switzerland, 2019; 20p. [Google Scholar]
- Yinda, C.K.; Ghogomu, S.M.; Conceição-Neto, N.; Beller, L.; Deboutte, W.; Vanhulle, E.; Maes, P.; Van Ranst, M.; Matthijnssens, J. Cameroonian fruit bats harbor divergent viruses, including rotavirus H, bastroviruses, and picobirnaviruses using an alternative genetic code. Virus Evol. 2018, 4, vey008. [Google Scholar] [CrossRef]
- Hock, J.W. Improved CDC Backpack Aspirator—Model 1412 Instructions; John W. Hock company: Gainesville, FL, USA, 2016; p. 4. [Google Scholar]
- Edwards, J. Mosquitoes of the Ethiopian Region; Oxford University Press: Oxford, UK, 1941; p. 513. [Google Scholar]
- Jupp, P.G. Mosquitoes of Southern Africa: Culicinae and Toxorhynchitinae; Ekogilde: Hartebeespoort, South Africa, 1996; p. 156. [Google Scholar]
- Navia-Gine, W.G.; Loaiza, J.R.; Miller, M.J. Mosquito-host interactions during and after an outbreak of equine viral encephalitis in eastern Panama. PLoS ONE 2013, 8, e81788. [Google Scholar] [CrossRef]
- Parodi, B.; Aresu, O.; Bini, D.; Lorenzini, R.; Schena, F.; Visconti, P.; Cesaro, M.; Ferrera, D.; Andreotti, V.; Ruzzon, T. Species identification and confirmation of human and animal cell lines: A PCR-based method. Biotechniques 2002, 32, 432–440. [Google Scholar] [CrossRef] [PubMed]
- Newell, P.D.; Fricker, A.D.; Roco, C.A.; Chandrangsu, P.; Merkel, S.M. A small-group activity introducing the use and interpretation of BLAST. J. Microbiol. Educ. 2013, 14, 238–243. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Felsenstein, J. Phylogenies and the comparative method. Am. Nat. 1985, 125, 1–15. [Google Scholar] [CrossRef]
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K. Model selection in the estimation of the number of nucleotide substitutions. Mol. Biol. Evol. 1994, 11, 154–157. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kumar, S.; Stecher, G.; Suleski, M.; Sanderford, M.; Sharma, S.; Tamura, K. MEGA12: Molecular Evolutionary Genetic Analysis version 12 for adaptive and green computing. Mol. Biol. Evol. 2024, 41, msae263. [Google Scholar] [CrossRef]
- Kamau, W.W.; Sang, R.; Rotich, G.; Agha, S.B.; Menza, N.; Torto, B.; Tchouassi, D.P. Patterns of Aedes aegypti abundance, survival, human-blood feeding and relationship with dengue risk, Kenya. Front. Trop. Dis. 2023, 4, 1113531. [Google Scholar] [CrossRef]
- Valerio, L.; Marini, F.; Bongiorno, G.; Facchinelli, L.; Pombi, M.; Caputo, B.; Maroli, M.; Della Torre, A. Host-feeding patterns of Aedes albopictus (Diptera: Culicidae) in urban and rural contexts within Rome province, Italy. Vector-Borne Zoonotic Dis. 2010, 10, 291–294. [Google Scholar] [CrossRef]
- Delatte, H.; Paupy, C.; Dehecq, J.S.; Thiria, J.; Failloux, A.B.; Fontenille, D. Aedes albopictus, vector of chikungunya and dengue viruses in Reunion Island: Biology and control. Parasite 2008, 15, 3–13. [Google Scholar] [CrossRef]
- Ponlawat, A.; Harrington, L.C. Blood feeding patterns of Aedes aegypti and Aedes albopictus in Thailand. J. Med. Entomol. 2005, 42, 844–849. [Google Scholar] [CrossRef] [PubMed]
- Richards, S.L.; Ponnusamy, L.; Unnasch, T.R.; Hassan, H.K.; Apperson, C.S. Host-feeding patterns of Aedes albopictus (Diptera: Culicidae) in relation to availability of human and domestic animals in suburban landscapes of central North Carolina. J. Med. Entomol. 2006, 43, 543–551. [Google Scholar] [CrossRef]
- Paupy, C.; Delatte, H.; Bagny, L.; Corbel, V.; Fontenille, D. Aedes albopictus, an arbovirus vector: From the darkness to the light. Microbes Infect. 2009, 11, 1177–1185. [Google Scholar] [CrossRef]
- Tedjou, A.N.; Kamgang, B.; Yougang, A.P.; Wilson-Bahun, T.A.; Njiokou, F.; Wondji, C.S. Patterns of ecological adaptation of Aedes aegypti and Aedes albopictus and Stegomyia indices highlight the potential risk of arbovirus transmission in Yaoundé, the Capital City of Cameroon. Pathogens 2020, 9, 491. [Google Scholar] [CrossRef] [PubMed]
- Kamgang, B.; Happi, J.Y.; Boisier, P.; Njiokou, F.; Hervé, J.P.; Simard, F.; Paupy, C. Geographic and ecological distribution of the dengue and chikungunya virus vectors Aedes aegypti and Aedes albopictus in three major Cameroonian towns. Med. Vet. Entomol. 2010, 24, 132–141. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.; mi Yu, H.; Lim, H.W.; Yang, S.-C.; Roh, J.Y.; Chang, K.S.; Shin, E.-H.; Ju, Y.R.; Lee, W.-G. Host-feeding pattern and dengue virus detection of Aedes albopictus (Diptera: Culicidae) captured in an urban park in Korea. J. Asia-Pac. Entomol. 2017, 20, 809–813. [Google Scholar]
- Zhang, W.; Wang, J.; Liu, Q.; Gong, Z. A review of pathogens transmitted by the container-inhabiting mosquitoes, Aedes albopictus, a global public health threat. China CDC Wkly. 2023, 5, 984. [Google Scholar] [CrossRef]
- Pagès, F.; Peyrefitte, C.N.; Mve, M.T.; Jarjaval, F.; Brisse, S.; Iteman, I.; Gravier, P.; Nkoghe, D.; Grandadam, M. Aedes albopictus mosquito: The main vector of the 2007 Chikungunya outbreak in Gabon. PLoS ONE 2009, 4, e4691. [Google Scholar] [CrossRef]
- Njabo, K.Y.; Smith, T.B.; Yohannes, E. Feeding habits of Culicine mosquitoes in the Cameroon lowland forests based on stable isotopes and blood meal analyses. J. Parasitol. Vector Biol. 2013, 5, 6–12. [Google Scholar]
- Townzen, J.; Brower, A.; Judd, D. Identification of mosquito bloodmeals using mitochondrial cytochrome oxidase subunit I and cytochrome b gene sequences. Med. Vet. Entomol. 2008, 22, 386–393. [Google Scholar] [CrossRef]




| Locations | Time of Collection | Season | Method Applied | Number of Mosquitoes Collected |
|---|---|---|---|---|
| Douala (urban) | December 2023 | Dry | Prokopack aspirator and BioGents-Sentinel trap | 2089 |
| June 2024 | Rainy | |||
| Obala (rural) | June 2023, April 2024 | Rainy | Prokopack aspirator and BioGents-Sentinel trap | 385 |
| Garoua (urban) | September 2024 | Rainy | Prokopack aspirator and BioGents-Sentinel trap | 145 |
| Yaoundé (urban) | December 2023 | Dry | Prokopack aspirator and BioGents-Sentinel trap | 1422 |
| April, June–July 2023 | Rainy | |||
| Yaoundé (Zoo-botanical garden) | November–December 2019 | Dry | CDC Back-pack Aspirator | 960 |
| June–August 2020 | Rainy |
| Primers | Sequences (5′–3′) | Size (bp) | References |
|---|---|---|---|
| COI-forward | ACTTCTGGGTGGCCAAAGAATCAGAA | 748 | [33] |
| COI-reverse | TTCTCCAACCACAAAGACATTGGCAC | ||
| Cyt-b-forward | CGAAGCTTGATATGAAAAACCATCGTTG | 772 | |
| Cyt-b-reverse | TGTAGTTRTCWGGGTCHCCTA | ||
| COXI-forward | TTCGGCGCATGAGCTGGAGTCC | 228 | [34] |
| COX-reverse | TATGCGGGGAAACGCCATATCG |
| Location | Aedes albopictus | Aedes aegypti | Total | |||
|---|---|---|---|---|---|---|
| n | nbf (%) | n | nbf (%) | n | nbf (%) | |
| Douala (urban) | 1625 | 69 (4.24) | 464 | 16 (3.44) | 2089 | 85 (4.06) |
| Obala (rural) | 342 | 0 (0) | 43 | 0 (0) | 385 | 0 (0) |
| Garoua (urban) | 4 | 0 (0) | 141 | 0 (0) | 145 | 0 (0) |
| Yaoundé (urban) | 1240 | 45 (3.62) | 182 | 18 (9.89) | 1422 | 63 (4.43) |
| Yaoundé (zoo-botanical garden) | 960 | 150 (15.62) | 0 | 0 (0) | 960 | 150 (15.62) |
| Total | 4171 | 264 (6.32) | 830 | 34 (4.09) | 5001 | 298 (5.95) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Tedjou, A.N.; Keumeni, C.R.; Yougang, A.P.; Njiokou, F.; Lines, J.; Clarke, S.E.; Wondji, C.S.; Kamgang, B. Anthropophagy and Ecological Bridges: Blood-Meal Patterns of Invasive Aedes albopictus (Skuse, 1894) and Native Aedes aegypti Linnaeus, 1762 and Their Implications for Arbovirus Emergence in Central Africa. Trop. Med. Infect. Dis. 2026, 11, 143. https://doi.org/10.3390/tropicalmed11060143
Tedjou AN, Keumeni CR, Yougang AP, Njiokou F, Lines J, Clarke SE, Wondji CS, Kamgang B. Anthropophagy and Ecological Bridges: Blood-Meal Patterns of Invasive Aedes albopictus (Skuse, 1894) and Native Aedes aegypti Linnaeus, 1762 and Their Implications for Arbovirus Emergence in Central Africa. Tropical Medicine and Infectious Disease. 2026; 11(6):143. https://doi.org/10.3390/tropicalmed11060143
Chicago/Turabian StyleTedjou, Armel N., Christophe R. Keumeni, Aurélie P. Yougang, Flobert Njiokou, Jo Lines, Sian E. Clarke, Charles S. Wondji, and Basile Kamgang. 2026. "Anthropophagy and Ecological Bridges: Blood-Meal Patterns of Invasive Aedes albopictus (Skuse, 1894) and Native Aedes aegypti Linnaeus, 1762 and Their Implications for Arbovirus Emergence in Central Africa" Tropical Medicine and Infectious Disease 11, no. 6: 143. https://doi.org/10.3390/tropicalmed11060143
APA StyleTedjou, A. N., Keumeni, C. R., Yougang, A. P., Njiokou, F., Lines, J., Clarke, S. E., Wondji, C. S., & Kamgang, B. (2026). Anthropophagy and Ecological Bridges: Blood-Meal Patterns of Invasive Aedes albopictus (Skuse, 1894) and Native Aedes aegypti Linnaeus, 1762 and Their Implications for Arbovirus Emergence in Central Africa. Tropical Medicine and Infectious Disease, 11(6), 143. https://doi.org/10.3390/tropicalmed11060143

