Next Article in Journal
When the Light Goes Out: Distribution and Sleeping Habitat Use of Parrotfishes at Night
Next Article in Special Issue
Dietary β-1,3-Glucan Promotes Growth Performance and Enhances Non-Specific Immunity by Modulating Pattern Recognition Receptors in Juvenile Oriental River Prawn (Macrobrachium nipponense)
Previous Article in Journal
Correction: Osorio et al. Parasitic Copepods as Biochemical Tracers of Foraging Patterns and Dietary Shifts in Whale Sharks (Rhincodon typus Smith, 1828). Fishes 2023, 8, 261
Previous Article in Special Issue
Effects of Soybean Isoflavones on the Growth Performance and Lipid Metabolism of the Juvenile Chinese Mitten Crab Eriocheir sinensis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 9
Issue 9
10.3390/fishes9090369
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Dietary Copper on Growth Performance, Antioxidant Capacity, and Immunity in Juvenile Largemouth Bass (Micropterus salmoides)

by
John Cosmas Kayiira
1,2,
Haifeng Mi
3,
Hualiang Liang
1,2,
Mingchun Ren
1,2,
Dongyu Huang
1,*,
Lu Zhang
3,* and
Tao Teng
3
1
Key Laboratory of Integrated Rice-Fish Farming Ecology, Ministry of Agriculture and Rural Affairs, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, China
2
Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China
3
Tongwei Agricultural Development Co., Ltd., Key Laboratory of Nutrition and Healthy Culture of Aquatic Livestock and Poultry, Ministry of Agriculture and Rural Affairs, Healthy Aquaculture Key Laboratory of Sichuan Province, Chengdu 610093, China
*
Authors to whom correspondence should be addressed.
Fishes 2024, 9(9), 369; https://doi.org/10.3390/fishes9090369
Submission received: 11 August 2024 / Revised: 18 September 2024 / Accepted: 20 September 2024 / Published: 23 September 2024
(This article belongs to the Special Issue Effect of Dietary Supplementation on the Growth and Immunity of Fish and Shellfish—2nd Edition)
Browse Figures
Versions Notes

Abstract

This study evaluated the optimal dietary copper (Cu) levels and their effects on growth performance, body composition, and antioxidant capacity in juvenile largemouth bass (Micropterus salmoides). A total of 360 fish (initial average weight (1.67 ± 0.01 g) and initial average length (2.5 ± 0.2 cm)) were randomly assigned to 18 tanks, each containing 20 fish and six dietary Cu concentrations: 2.13 (control), 3.00, 3.66, 4.58, 4.64, and 5.72 mg/kg. The results indicated that fish receiving 3.00 mg/kg of Cu exhibited the best final body weight (FBW), weight gain rate (WGR), and specific growth rate (SGR), with a significantly reduced feed conversion ratio (FCR). While body composition (moisture, protein, lipid, and ash) remained consistent across groups, plasma total protein (TP) levels increased with Cu supplementation. Elevated triglycerides (TG) and albumin (ALB) were noted at 4.64 and 5.72 mg/kg, respectively, while glucose (GLU) levels decreased with an increase in dietary Cu. Antioxidant capacity, assessed via hepatic glutathione (GSH) and the activities of catalase (CAT), and showed significant improvements at 3.00 and 3.66 mg/kg Cu, while superoxide dismutase (SOD) showed the highest activity at a dietary Cu level of 5.72 mg/kg. Additionally, the expressions of tgf-β and tnf-α genes were significantly upregulated at a dietary Cu level of 5.72 mg/kg, while il-8 and il-10 genes were upregulated at dietary 3.66 mg/kg. The expression of nrf2 was significantly upregulated in response to a dietary Cu level of 3.66 mg/kg compared to the control group, and the expression of the keap1 gene was significantly upregulated in the fish fed with 5.72 mg/kg of dietary Cu. The results indicated that appropriate dietary supplementation could promote the growth performance and improve the antioxidant status the immunity of largemouth bass, and the optimal Cu requirement for FCR and SGR were approximately 3.10 mg/kg and 3.00 mg/kg, respectively.
Keywords:
largemouth bass; copper requirement; plasma biochemistry; Nrf2 signaling pathway; NF-κb signaling pathway
Key Contribution: dietary Cu enhances growth performance and immune and antioxidant capacity of largemouth bass.

Graphical Abstract

1. Introduction

The global demand for fresh and nutrient-rich fish products has promoted the growth of aquaculture, providing food, nourishment, revenue, and improved quality of life for communities worldwide [1,2]. Minerals including copper (Cu) play crucial roles in diverse bodily processes, such as the formation of skeletal structure, maintenance of colloidal systems, generation of membrane potential, and acid–base balance control [3].
Fish require Cu, an essential trace element. Cu is a cofactor for several proteins that perform essential tasks for development and growth [4]. Dietary copper supplementation increased growth performance in genetically improved farmed tilapia (GIFT) (Oreochromis niloticus) [5]. For grouper (Epinephelus malabaricus), a diet deficient in Cu results in stunted growth and low feed efficiency (FE) [6]. Growth results from the utilization of feed, which is associated with the capacity for digestion and absorption [7]. Cu is an essential cofactor for key enzymes involved in metabolism, including tyrosinase, dopamine hydroxylase, ceruloplasmin, lysyl oxidase, superoxide dismutase (SOD), and cytochrome oxidase [8,9]. In healthy humans, the majority of Cu is either linked to proteins or coupled with enzyme prosthetic groups, with the highest proportion in the liver and brain [10,11]. However, excess levels of Cu may lead to oxidation of proteins and lipids, emphasizing the need for optimal dietary Cu intake and homeostasis to maintain cell viability and optimal fish development [12]. Enough dietary Cu can enhance the antioxidative or general immune functions of fish and shrimp, such as in large yellow croaker (Larimichthys croceus) [13]. But Cu as a heavy metal as well as Cu ion and its complexes can result in the production of reactive oxygen species (ROS), which can lead to oxidative stress-related harm to cells, organs, lipids, proteins, and DNA [14]. Cu ions play significant physiological roles, but when they accumulate at high tissue concentrations, they can also be toxic [15]. Excessive dietary Cu in aquatic animals frequently results in tissue damage, especially ionic and osmotic regulation disruption [16], oxidative stress, loss of cell membrane selective permeability, and enzyme inhibition [17,18].
Micronutrient consumption is closely linked to the immune system and general health of aquatic animals, highlighting the importance of supplementing fish feed with mineral nutrients [19]. Notably, insufficient Cu levels in fish-rearing water are unable to meet the fish’s physiological demands [20]. Various fish species have specific dietary Cu requirements, including rainbow trout (Oncorhynchus mykiss) [21], carp (Cyprinus carpio) [21], blunt snout bream (Megalobrama amblycephala) [22], grouper [6], Atlantic salmon (Salmo salar) [23,24], abalone (Haliotis discus hannai Ino) [25], and channel catfish (Ictalurus punctatus) [26].
Largemouth bass (Micropterus salmoides) is a predatory freshwater species indigenous to North America, known for its fast growth rate, wide temperature tolerance, adaptability to different climatic conditions, and value as a food source [27]. Fish such as largemouth bass can experience stress in aquatic settings due to various factors, such as high temperatures, low oxygen levels, changes in social interactions, and limited range of motion [28]. The cellular defense against oxidative stress is predominantly governed by the nuclear factor erythroid 2-related factor 2 (Nrf2) and nuclear factor kappa B (NF-κB) pathways [29,30]. However, the impact of Cu on the Nrf2 and NF-κB signaling pathways in largemouth bass has not been investigated. This research endeavor aimed to investigate the effects of dietary Cu on the growth efficiency, body composition, antioxidant capability, and immune response of largemouth bass. The findings will provide supplementary materials for the development of cost-effective, environmentally friendly, and efficacious feed formulations for carnivorous fish.

2. Materials and Methods

2.1. Experimental Diet

The dietary components are presented in Table 1. We designed five addition levels of 0, 1, 2, 3, 4, 5, and 6 mg/kg in the diet with reference to the copper requirement (3.5 mg/kg) of Lateolabrax japonicus [31], which belongs to the order Perciformes with the largemouth bass, a closely related species. Then, six diets were formulated by supplementing copper sulfate pentahydrate (CuSO4·5H2O) to achieve varying levels of dietary copper (Cu) (final measured values): 2.13 (control group), 3.00, 3.66, 4.58, 4.64, and 5.72 mg/kg. The ingredients were crushed through an 80-mesh sieve, weighed, and thoroughly mixed for feed formulation, followed by the addition of water (23%, 25%, mass fraction) and oil. Concurrently, CuSO4·5H2O was dissolved in water and incorporated into the mixture, and then, the mixture was processed into 2 mm diameter granules using a meat grinder (SJPS56×2; Jiangsu Muyang Holdings Co., LTD, Yangzhou, China) and then air-dried and stored at −20 °C until used.

2.2. Experimental Procedures

A total of 360 largemouth bass were obtained from Zhengda Aquatic Products Co., LTD (Huzhou, China) and acclimated to the control diet and indoor environment for two weeks before the feeding trial. Prior to stocking, the fish were fasted for 24 h and weighed. Fish with a uniform average weight of 1.67 ± 0.01 g and average length of 2.5 ± 0.2 cm were placed in 18 circular tanks, each containing 20 fish and a water capacity of 300 L. The tanks were randomly divided into six groups, with three tanks representing triplicates for each group. The tanks were connected to a share water reservoir, forming a closed recirculating system with biofilters to eliminate impurities and reduce ammonia concentrations. The six experimental diets were administered to the respective groups twice daily (at 7:30 and 18:00 h), and no remnants of food were observed in the tanks after each feeding session. Feed intake was monitored daily, and waste was promptly removed using a plastic pipe. The mortality rate was monitored daily, and water parameters were maintained by Octadem Multi-Parameter Water Quality Analyser (Type OCT-A) (Wuxi Octadem Biotechnology Co., LTD, Wuxi, China) within the specified range (pH 7.5–8.0, dissolved oxygen > 7.0 mg/L, temperature 30 ± 2 °C, ammonia nitrogen and nitrite ranged between 0–0.2 mg/L and <0.01 mg/L, and copper ion content < 0.01 mg/L, respectively).

2.3. Sample Collection Analytical Methods

After 8 weeks, the fish were fasted for 24 h to eliminate the impact of feed on their weight and then sedated using 150 mg/L of MS-222. The total count and weight of fish in each tank were recorded to calculate the growth performance, including final body weight (FBW), weight gain rate (WGR), specific growth rate (SGR), and feed conversion ratio (FCR). The formulas for calculating the parameters are as follows:
Final body weight (FBW, g) = Final body total weight at the end (g)/number of fish
Weight gain rate (WGR, %) = 100 × (Final body weight (g) − Initial body weight (g))/Initial body weight (g)
Specific growth rate (SGR, %/day) = 100 × [ln(Final body weight) − ln(Initial body weight)]/duration (days)
Feed conversion ratio (FCR) = dry feed fed (g)/(Final body weight (g) − Initial body weight (g)
Three fish were randomly selected from each tank for blood sample collection from the caudal vessels. The blood samples were centrifuged at 3000 rpm for 10 min at 4 °C (Eppendorf 5424R centrifuge, Leipzig, Germany) to collect the plasma, which was immediately stored at −20 °C for subsequent analysis. Afterwards, 300 µL plasma of each was placed on the Mindray BS-400 Automatic Biochemical Analyser for testing. From the same fish, the liver tissues were removed and frozen in liquid nitrogen to estimate the antioxidant and immune parameters. Additionally, six fish from each tank were randomly selected and stored at −20 °C to determine the overall body composition.

2.4. Chemical Analysis

The proximate composition of the diets and fish body, including lipids, proteins, ash, and moisture, were determined in triplicate using standard methods [32]. The specific details of the analytical methods and instrumentation employed in the biochemical testing are provided in Table 2.

2.5. Real-Time PCR Analysis

The total RNA from the liver tissues was isolated using the RNA extraction reagent (Vazyme, Nanjing, China), followed by the qualitative and quantitative analysis using a NanoDrop 2000 spectrophotometer, and the A260/280 value of 1.8–2.0 served as a standard. The qPCR analysis employed the CFX96 Touch system (Bio-Rad, Hercules, CA, USA), and the reagents were obtained from Vazyme. GAPDH served as the housekeeping gene or standard, and mRNA levels were determined by the relative standard curve method. The PCR primers were designed according to their nucleic acid sequences and retrieved from the National Center for Biotechnology Information (NCBI; Bethesda, MD, USA) via Primer Premier 6.0 (https://primer-premier.software.informer.com/6.1/, accessed on 29 May 2024). Table 3 presents the primer details for real-time qPCR analysis.

2.6. Statistical Analysis

The data were processed and analyzed using SPSS version 23.0 software. One-way analysis of variance (ANOVA) was used to assess the significant differences between the means, and Duncan’s multiple range test was applied for post hoc comparisons. The results are presented as the mean ± standard error of the mean (SEM), and p-values < 0.05 were considered statistically significant. The broken-line regression model was selected to determine the optimum dietary copper requirement by comparing the estimation coefficient (R2) among the linear regression model (SGR, 0.191; FCR, 0.370), quadratic regression model (SGR, 0.321; FCR, 0.601), and broken-linear regression model (SGR, 0.542; FCR, 0.722).

3. Results

3.1. Growth Performance

Table 4 shows the growth performance results: Fish fed diets containing 3.00–5.72 mg/kg of Cu exhibited a significantly higher weight gain rate (WGR) compared to the control group with 2.13 mg/kg of Cu (p < 0.05). Additionally, a significant increase in the final body weight (FBW) and specific growth rate (SGR) was observed in the experimental groups relative to the control (p < 0.05). The diet containing 3.00 mg/kg of Cu displayed the highest values for both FBW and SGR. Furthermore, the experimental groups demonstrated a significantly reduced feed conversion ratio (FCR) compared to the control group (p < 0.05). The broken-line regression analysis based on SGR and FCR indicated the optimal dietary Cu requirement to be 3.00 and 3.10 mg/kg, respectively (Figure 1).

3.2. Whole Body Composition

The results of the whole body composition analysis are presented in Table 5. No statistically significant difference was observed in the moisture, crude protein, crude lipid, and ash content of the whole body (p > 0.05).

3.3. Plasma Biochemical Parameters

The results of the biochemical analyses of the plasma samples are presented in Table 6. Dietary treatments did not affect the AST and ALT activities (p > 0.05). However, the TP levels were significantly increased with higher dietary Cu levels when compared to the control group (p < 0.05). Conversely, the GLU levels showed a significant decrease with increasing dietary Cu concentrations compared to the control group (p < 0.05). Furthermore, 4.64 and 5.72 mg/kg of Cu significantly increased the ALB and TG levels compared to the control group (p < 0.05). Additionally, the TC levels were significantly elevated in the diets with 3.00–5.72 mg/kg of Cu (p < 0.05).

3.4. The Antioxidant Parameters of Liver

Table 7 presents the results of the liver antioxidant parameters. The levels of T-AOC, GPx, and MDA were not affected by the different dietary Cu levels (p > 0.05). However, the GSH level increased significantly at 3.00 mg/kg of dietary Cu relative to the control group (p < 0.05). Moreover, diets supplemented with 3.00–3.66 mg/kg of Cu significantly elevated the CAT levels (p < 0.05). Similarly, fish fed dietary Cu levels ranging from 3.00 to 4.58 mg/kg exhibited a significant difference in SOD levels (p < 0.05), with the highest activity observed at 5.72 mg/kg.

3.5. The Gene Expressions of the NF-κB Signaling Pathway in Liver

Figure 2 showed that the gene expression pattern exhibited significant differences induced by the various dietary Cu levels. Specifically, the expressions of tgf-β and tnf-α genes were significantly upregulated at a dietary Cu level of 5.72 mg/kg (p < 0.05). Similarly, the expressions of il-8 and il-10 genes were significantly upregulated at 3.66 mg/kg of Cu (p < 0.05). However, no significant difference was observed in the gene expression of nf-κb (p > 0.05).

3.6. The Core Gene Expressions of Nrf2 Signaling Pathway

Figure 3 shows that the expression of nrf2 was significantly upregulated in response to a dietary Cu level of 3.66 mg/kg compared to the control group (p < 0.05); however, it declined with further increases in Cu levels. Additionally, the expression of the keap1 gene was significantly upregulated in the fish fed with 5.72 mg/kg of dietary Cu relative to the control group (p < 0.05). Furthermore, no significant differences were observed in the expressions of cat, sod, and gpx genes among all the groups (p > 0.05).

4. Discussion

Cu is crucial for all living organisms, including fish, as it plays a significant role in various physiological processes [35]. Promoting the growth of the aquaculture industry is essential for improving the productivity and profitability [36]. In this study, increased dietary Cu levels significantly improved WGR and SGR compared to the control group, consistent with the juvenile beluga survey (Huso huso) [37]. Additionally, the optimal dietary Cu levels for juvenile largemouth bass were estimated to be 3.00–3.10 mg/kg based on the broken-line regression analysis, which was supported by earlier studies on various fish species. Variations in fish species, size, feeding schedule, and experimental conditions contribute to different optimal Cu levels for different fish [38]. Additionally, the study highlighted the effect of dietary Cu on decreasing the FCR while improving the growth performance, as observed in fish fed with the optimal dietary Cu levels. Previous studies have also shown that decreased FCR was associated with improved growth performance in fish fed with optimal dietary Cu [19,37].
Blood-based biomarkers provide valuable insights into fish physiology and stress responses [39]. This experiment demonstrated that increased dietary Cu levels could significantly increase the TP and TC levels at all Cu concentrations (3.00–5.72 mg/kg) relative to the control group. Notably, 4.64 and 5.72 mg/kg of Cu could increase the levels of ALB and TG remarkably. These results are consistent with the earlier observations in snow trout (Schizothorax zarudnyi) [40] and red sea bream (Pagrus major), where Cu supplementation increased the total serum protein levels [41]. Moreover, our study also indicated that increased dietary Cu levels enhanced the innate immunity of largemouth bass. ALT is a cytosolic enzyme found in the liver, whereas AST is a mitochondrial enzyme found in the heart, skeletal muscle, kidney, and liver [42,43]. Our results found no significant differences in the activities of these enzymes, suggesting that different dietary Cu levels had no adverse effect on liver health. Another measure of fish stress is the GLU concentration in the plasma since its elevated levels often correspond to higher levels of stress in fish [44]. In the present study, increased dietary Cu levels could significantly reduce plasma GLU levels. Similar results were observed in snow trout [45], where elevated dietary Cu levels were associated with reduced plasma GLU levels and improved energy homeostasis. Furthermore, all dietary Cu treatments increased TC levels when compared with the control group, reaching their peak values at 5.72 mg/kg of dietary Cu. However, this finding was different from those observed in juvenile beluga [35], indicating that Cu may have oxidized polyunsaturated fats (PUFA), making them unsuitable for esterification [45].
Cu is a crucial trace element in living organisms, influencing biochemistry, enzyme activity, cellular respiration, free radical defense, neurotransmitter function, and tissue biosynthesis [46]. High dietary Cu levels were linked to increased SOD activities, highlighting the importance of its supplementation in improving the antioxidant mechanism in largemouth bass. SOD is responsible for converting two superoxide radicals into oxygen and hydrogen peroxide [47,48], which are then used as substrates by the CAT and GPx enzymes to remove harmful reactive oxygen species (ROS) from the cellular environment [49,50]. Our research revealed that SOD activities significantly increased as dietary Cu increased, demonstrating the importance of dietary Cu in boosting the antioxidant system in largemouth bass. Similar findings of increased SOD activities upon dietary copper supplementation have been documented in Russian sturgeon (Acipenser gueldenstaedtii) [51] and blunt snout bream [22]. SOD is not the same as their trend, probably because SOD is a copper-containing enzyme, and reduced dietary Cu-Zn SOD proprotein and insufficient concentrations of cofactor/chaperone proteins to saturate Cu-Zn SOD proprotein [5] may have allowed SOD activity to consistently increase with increasing dietary copper levels. Moreover, fish fed with 3.00 to 3.66 mg/kg of dietary Cu levels exhibited elevated levels of GSH and increased activities of CAT, thereby improving the antioxidant defense mechanisms. Similar results were reported in Pacific white shrimp (Litopenaeus vannamei) and freshwater fish Channa punctatus [52,53]. However, excessive copper negatively impacts these enzymes’ abilities, which then suppresses the antioxidant capacity. Similar results have been documented for the crucian carp (Carassius carassius) [54], grass carp (Ctenopharyngodon Idella) [55], and Russian sturgeon [51]. MDA is an important marker of peroxidation [53], which directly affects cell membrane fluidity and integrity [56]. No significant difference in MDA levels was found in all groups in this study, suggesting that dietary Cu supplementation had no adverse effects on juvenile largemouth bass. The mRNA levels of antioxidant enzymes in fish are closely associated with their expression [57]. This experiment revealed that dietary Cu supplementation significantly increased the expression of nrf2 and keap1 genes in largemouth bass, suggesting that it promotes antioxidant activity in the fish. Similar findings were reported in other studies on juvenile blunt snout bream [21]. However, the gene expression of cat, sod, and gpx showed no significant difference in dietary Cu supplementation. These genes do not share the same significance in the expression of their associated enzyme activity, which may be due to the fact that in some cases the enzyme activity may be regulated by post-transcriptional regulation rather than being solely dependent on the level of expression of the gene; the increase in enzyme activity may also be related to changes in substrate concentration, and even if the amount of enzyme decreases, the enzyme activity may increase if the substrate concentration increases [58]. Therefore, optimal dietary Cu levels influence the Nrf2-Keap1 signaling pathway and expression of antioxidant enzyme genes regulated by it to improve the antioxidant capacity of largemouth bass.
The inflammatory response involves both pro- and anti-inflammatory cytokines [59], playing a crucial role in regulating immune responses in aquatic animals [60]. Anti-inflammatory cytokines (tgf-β and il-10) promote the production of non-inflammatory immunoglobulin isotypes IgG4 and IgA while suppressing IgE and effector cells such as mast cells, basophils, and eosinophils, which cause allergic inflammation [61]. In our study, the fish fed with a diet containing 3.66 and 5.72 mg/kg of Cu showed a significantly upregulated expression of il-10 and tgf-β genes, respectively, relative to the control group. Previous studies have also shown that proper nutrient supplementation could enhance the expression of il-10 and tgf-β in blunt snout bream [62]. In addition, our results showed that the dietary Cu intake led to an upregulation of il-8 and tnf-α gene expression in largemouth bass, suggesting that adequate Cu intake might stimulate an immune response and support overall health. Numerous studies suggest that exposure to Cu causes inflammation, and various inflammatory cytokines regulate immune and inflammatory responses [63]. Simultaneously, inflammatory cytokines like il-8 and tnf-α significantly impact the innate immunity in aquatic animals to protect against stress conditions [64].

5. Conclusions

In general, our research indicated that appropriate dietary supplementation (3.00–3.66 mg/kg) could enhance antioxidant capacity and influence relative Nrf2 and NF-κB signaling pathways, hence improving the health and immunity of largemouth bass. According to broken-line regression on SGR and FCR, the optimal dietary Cu requirement of largemouth bass was 3.00 and 3.10 mg/kg, respectively.

Author Contributions

Formal analysis, J.C.K., H.L. and H.M.; writing—original draft preparation, J.C.K.; writing—review and editing, D.H., M.R. and L.Z.; project administration, D.H. and L.Z.; methodology, H.M. and T.T.; investigation, H.L. and T.T. All authors have read and agreed to the published version of the manuscript.

Funding

This study was financially supported by the National Key R & D Program of China (2023YFD2400601), the earmarked fund for CARS (CARS-46), National Natural Science Foundation of China (32102806).

Institutional Review Board Statement

The study was approved by the Laboratory Animal Ethics Committee of the Freshwater Fisheries Research Center (LAECFFRC-2023-05-11).

Informed Consent Statement

Not applicable.

Data Availability Statement

The authors confirm that the data supporting the findings of this study are available within the manuscript, tables, and figures.

Conflicts of Interest

Authors Haifeng Mi, Tao Teng, and Lu Zhang are employed by Tongwei Agricultural Development Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest. Lu Zhang played a major role in the design of the study, writing—review and editing and project administration. Haifeng Mi and Tao Teng played a role in data analysis, methodology and investigation.

References

  1. Boyd, C.E.; McNevin, A.A.; Davis, R.P. The contribution of fisheries and aquaculture to the global protein supply. Food Secur. 2022, 14, 805–827. [Google Scholar] [CrossRef] [PubMed]
  2. Costello, C.; Cao, L.; Gelcich, S.; Cisneros-Mata, M.; Free, C.M.; Froehlich, H.E.; Golden, C.D.; Ishimura, G.; Maier, J.; Macadam-Somer, I.; et al. The future of food from the sea. Nature 2020, 588, 95–100. [Google Scholar] [CrossRef] [PubMed]
  3. Araújo, J.G.; Nebo, C.; Pádua, D.M.C.; Souto, C.N.; Guimarães, I.G. Apparent Digestibility of Minerals from Several Ingredients for Tambaqui, Colossoma macropomum, Juveniles. J. World Aquac. Soc. 2018, 49, 1026–1038. [Google Scholar] [CrossRef]
  4. Uauy, R.; Olivares, M.; Gonzalez, M. Essentiality of copper in humans. Am. J. Clin. Nutr. 1998, 67 (Suppl. S5), 952S–959S. [Google Scholar] [CrossRef] [PubMed]
  5. Zhong, C.C.; Ke, J.; Song, C.C.; Tan, X.Y.; Xu, Y.C.; Lv, W.H.; Song, Y.F.; Luo, Z. Effects of dietary copper (Cu) on growth performance, body composition, mineral content, hepatic histology and Cu transport of the GIFT strain of Nile tilapia (Oreochromis niloticus). Aquaculture 2023, 574, 739638. [Google Scholar] [CrossRef]
  6. Lin, Y.H.; Shie, Y.Y.; Shiau, S.Y. Dietary copper requirements of juvenile grouper, Epinephelus malabaricus. Aquaculture 2008, 274, 161–165. [Google Scholar] [CrossRef]
  7. Perez-Casanova, J.C.; Murray, H.M.; Gallant, J.W.; Ross, N.W.; Douglas, S.E.; Johnson, S.C. Development of the digestive capacity in larvae of haddock (Melanogrammus aeglefinus) and Atlantic cod (Gadus morhua). Aquaculture 2006, 251, 377–401. [Google Scholar] [CrossRef]
  8. Malhotra, N.; Ger, T.R.; Uapipatanakul, B.; Huang, J.C.; Chen, K.H.C.; Der Hsiao, C. Review of copper and copper nanoparticle toxicity in fish. Nanomaterials 2020, 10, 1126. [Google Scholar] [CrossRef]
  9. Luo, J.; Zhu, T.; Wang, X.; Cheng, X.; Yuan, Y.; Jin, M.; Betancor, M.B.; Tocher, D.R.; Zhou, Q. Toxicological mechanism of excessive copper supplementation: Effects on coloration, copper bioaccumulation and oxidation resistance in mud crab Scylla paramamosain. J. Hazard. Mater. 2020, 395, 122600. [Google Scholar] [CrossRef]
  10. Festa, R.A.; Thiele, D.J. Copper: An essential metal in biology. Curr. Biol. 2011, 21, R877–R883. [Google Scholar] [CrossRef]
  11. Gaetke, L.M.; Chow-Johnson, H.S.; Chow, C.K. Copper: Toxicological relevance and mechanisms. Arch. Toxicol. 2014, 88, 1929–1938. [Google Scholar] [CrossRef] [PubMed]
  12. Tang, L.; Huang, K.; Xie, J.; Yu, D.; Sun, L.; Huang, Q.; Bi, Y. Dietary copper affects antioxidant and immune activity in hybrid tilapia (Oreochromis niloticus × Oreochromis aureus). Aquac. Nutr. 2017, 23, 1003–1015. [Google Scholar] [CrossRef]
  13. Cao, J.; Miao, X.; Xu, W.; Li, J.; Zhang, W.; Mai, K. Dietary copper requirements of juvenile large yellow croaker Larimichthys croceus. Aquaculture 2014, 432, 346–350. [Google Scholar] [CrossRef]
  14. Jomova, K.; Valko, M. Advances in metal-induced oxidative stress and human disease. Toxicology 2011, 283, 65–87. [Google Scholar] [CrossRef] [PubMed]
  15. White, S.L.; Rainbow, P.S. Regulation and Accumulation of Copper, Zinc and Cadmium by the Shrimp Palaemon elegans. Mar. Ecol.-Prog. Ser. 1982, 8, 95–101. [Google Scholar] [CrossRef]
  16. Craig, P.M.; Wood, C.M.; Mcclelland, G.B. Water Chemistry Alters Gene Expression and Physiological End Points of Chronic Waterborne Copper Exposure in Zebrafish, Danio rerio. Environ. Sci. Technol. 2010, 44, 2156. [Google Scholar] [CrossRef]
  17. Machado, A.A.; Hoff, M.L.M.; Klein, R.D.; Gordeiro, G.J.; Avila, J.M.L.; Costa, P.G.; Bianchini, A. Oxidative stress and DNA damage responses to phenanthrene exposure in the estuarine guppy Poecilia vivipar. Mar. Environ. Res. 2014, 98, 96–105. [Google Scholar] [CrossRef]
  18. Zimmer, A.M.; Fernanda, I.; Wood, C.M.; Bianchini, A. Waterborne copper exposure inhibits ammonia excretion and branchial carbonic anhydrase activity in euryhaline guppies acclimated to both fresh water and seawater. Aquat. Toxicol. 2012, 122–123, 172–180. [Google Scholar] [CrossRef]
  19. Yuan, Y.; Luo, J.; Zhu, T.; Jin, M.; Jiao, L.; Sun, P.; Ward, T.L.; Ji, F.; Xu, G.; Zhou, Q. Alteration of growth performance, meat quality, antioxidant and immune capacity of juvenile Litopenaeus vannamei in response to different dietary dosage forms of zinc: Comparative advantages of zinc amino acid complex. Aquaculture 2020, 522, 735120. [Google Scholar] [CrossRef]
  20. El Basuini, M.F.; El-Hais, A.M.; Dawood, M.A.O.; Abou-Zeid, A.E.S.; EL-Damrawy, S.Z.; Khalafalla, M.M.E.S.; Koshio, S.; Ishikawa, M.; Dossou, S. Effect of different levels of dietary copper nanoparticles and copper sulfate on growth performance, blood biochemical profiles, antioxidant status and immune response of red sea bream (Pagrus major). Aquaculture 2016, 455, 32–40. [Google Scholar] [CrossRef]
  21. Ogino, C.; Yang, G.Y. Requirements of Carp and Rainbow Trout for Dietary Manganese and Copper. Bull. Jpn. Soc. Sci. Fish 1980, 46, 455–458. [Google Scholar] [CrossRef]
  22. Liang, H.; Ji, K.; Ge, X.; Mi, H.; Xi, B.; Ren, M. Effects of dietary copper on growth, antioxidant capacity and immune responses of juvenile blunt snout bream (Megalobrama amblycephala) as evidenced by pathological examination. Aquac. Rep. 2020, 17, 100296. [Google Scholar] [CrossRef]
  23. Lorentzen, M.; Maage, A.; Julshamn, K. Supplementing copper to a fish meal based diet fed to Atlantic salmon parr affects liver copper and selenium concentrations. Aquac. Nutr. 1998, 4, 67–72. [Google Scholar] [CrossRef]
  24. Lall, S.P.; Hines, J.A. Iron and copper requirement of Atlantic salmon (Salmo salar) grown in sea water. In Proceedings of the International Symposium on Feeding and Nutrition of Fish, Bergen, Norway, 23–27 August 1987. [Google Scholar]
  25. Wang, W.; Mai, K.; Zhang, W.; Ai, Q.; Yao, C.; Li, H.; Liufu, Z. Effects of dietary copper on survival, growth and immune response of juvenile abalone, Haliotis discus hannai Ino. Aquaculture 2009, 297, 122–127. [Google Scholar] [CrossRef]
  26. Gatlin, D.M.; Wilson, R.P. Dietary copper requirement of fingerling channel catfish. Aquaculture 1986, 54, 277–285. [Google Scholar] [CrossRef]
  27. Brown, T.G.; Runciman, B.; Pollard, S.; Grant, A.D.A. (Micropterus salmoides). Lake 2002, 31, 1763–1769. [Google Scholar] [CrossRef]
  28. Wedemeyer, G.A. Physiology of Fish in Intensive Culture Systems; Chapman & Hall: New York, NY, USA, 1996. [Google Scholar] [CrossRef]
  29. Karin, M.; Lin, A. NF-κB at the crossroads of life and death. Nat. Immunol. 2002, 3, 221–227. [Google Scholar] [CrossRef]
  30. Mourente, G.; Diaz-Salvago, E.; Bell, J.; Tocher, D. Increased activities of hepatic antioxidant defence enzymes in juvenile gilthead sea bream. Aquaculture 2002, 214, 343–361. [Google Scholar] [CrossRef]
  31. Wang, L.M.; Wang, J.; Bharadwaj, A.S.; Xue, M.; Qin, Y.C. Effects of dietary copper sources on growth, tissue copper accumulation and physiological responses of Japanese sea bass (Lateolabrax japonicus) (Cuvier, 1828) fed semipurified or practical diets. Aquac. Res. 2015, 46, 1619–1627. [Google Scholar] [CrossRef]
  32. Association of Official Analytical Chemists (AOAC). Official Methods of Analysis of the Association of Official Analytical Chemists, 15th ed.; Association of Official Analytical Chemists Inc.: Arlington, VA, USA, 2003; Volume 1. [Google Scholar]
  33. Gu, J.Z.; Liang, H.L.; Ge, X.P.; Xia, D.; Pan, L.K.; Mi, H.F.; Ren, M.C. A study of the potential effect of yellow mealworm (Tenebrio molitor) substitution for fish meal on growth, immune and antioxidant capacity in juvenile largemouth bass (Micropterus salmoides). Fish & Shellfish Immunology 2022, 120, 214–221. [Google Scholar] [CrossRef]
  34. Yang, P.; Wang, W.Q.; Chi, S.Y.; Mai, K.S.; Song, F.; Wang, L. Effects of dietary lysine on regulating GH-IGF system, intermediate metabolism and immune response in largemouth bass (Micropterus salmoides). Aquaculture Reports 2020, 17, 100323. [Google Scholar] [CrossRef]
  35. Watanabe, T.; Kiron, V.; Satoh, S. Trace minerals in fish nutrition. Aquaculture 1997, 151, 185–207. [Google Scholar] [CrossRef]
  36. Wang, J.L.; Meng, X.L.; Lu, R.H.; Wu, C.; Luo, Y.T.; Yan, X.; Li, X.J.; Kong, X.H.; Nie, G.X. Effects of Rehmannia glutinosa on growth performance, immunological parameters and disease resistance to Aeromonas hydrophila in common carp (Cyprinus carpio L.). Aquaculture 2015, 435, 293–300. [Google Scholar] [CrossRef]
  37. Mohseni, M.; Pourkazemi, M.; Bai, S.C. Effects of dietary inorganic copper on growth performance and immune responses of juvenile beluga, Huso huso. Aquac. Nutr. 2014, 20, 547–556. [Google Scholar] [CrossRef]
  38. Song, J.; Li, L.Y.; Chen, B.B.; Shan, L.L.; Yuan, S.Y.; Yu, H.R. Dietary copper requirements of postlarval coho salmon (Oncorhynchus kisutch). Aquac. Nutr. 2021, 27, 2084–2092. [Google Scholar] [CrossRef]
  39. Shahjahan, M.; Islam, M.J.; Hossain, M.T.; Mishu, M.A.; Hasan, J.; Brown, C. Blood biomarkers as diagnostic tools: An overview of climate-driven stress responses in fish. Sci. Total Environ. 2022, 843, 156910. [Google Scholar] [CrossRef]
  40. Afshari, A.; Sourinejad, I.; Gharaei, A.; Johari, S.A.; Ghasemi, Z. The effects of diet supplementation with inorganic and nanoparticulate iron and copper on growth performance, blood biochemical parameters, antioxidant response and immune function of snow trout Schizothorax zarudnyi (Nikolskii, 1897). Aquaculture 2021, 539, 736638. [Google Scholar] [CrossRef]
  41. Minganti, V.; Drava, G.; De Pellegrini, R.; Siccardi, C. Trace elements in farmed and wild gilthead seabream, Sparus aurata. Mar. Pollut. Bull. 2010, 60, 2022–2025. [Google Scholar] [CrossRef]
  42. Yanpallewar, S.U.; Sen, S.; Tapas, S.; Kumar, M.; Raju, S.S.; Acharya, S.B. Effect of Azadirachta indica on paracetamol-induced hepatic damage in albino rats. Phytomedicine 2003, 10, 391–396. [Google Scholar] [CrossRef]
  43. Chellappan, D.K.; Ganasen, S.; Batumalai, S.; Candasamy, M.; Krishnappa, P.; Dua, K.; Chellian, J.; Gupta, G. The Protective Action of the Aqueous Extract of Auricularia polytricha in Paracetamol Induced Hepatotoxicity in Rats. Recent Pat. Drug Deliv. Formul. 2016, 10, 72–76. [Google Scholar] [CrossRef]
  44. Eslamloo, K.; Falahatkar, B.; Yokoyama, S. Effects of dietary bovine lactoferrin on growth, physiological performance, iron metabolism and non-specific immune responses of Siberian sturgeon Acipenser baeri. Fish Shellfish Immunol. 2012, 32, 976–985. [Google Scholar] [CrossRef] [PubMed]
  45. Hahnel, D.; Huber, T.; Kurze, V.; Beyer, K.; Engelmann, B. Contribution of copper binding to the inhibition of lipid oxidation by plasmalogen phospholipids. Biochem. J. 1999, 340, 377–383. [Google Scholar] [CrossRef] [PubMed]
  46. Hefnawy, A.; Khaiat, H. The Importance of Copper and the Effects of Its Deficiency and Toxicity in Animal Health. Int. J. Livest. Res. 2015, 5, 1–20. [Google Scholar] [CrossRef]
  47. Sevcikova, M.; Modra, H.; Blahova, J.; Dobsikova, R.; Plhalova, L.; Zitka, O.; Hynek, D.; Kizek, R.; Skoric, M.; Svobodova, Z. Biochemical, haematological and oxidative stress responses of common carp (Cyprinus carpio L.) after sub-chronic exposure to copper. Vet. Med. 2016, 61, 35–50. [Google Scholar] [CrossRef]
  48. Saffari, S.; Keyvanshokooh, S.; Zakeri, M.; Johari, S.A.; Pasha-Zanoosi, H. Effects of different dietary selenium sources (sodium selenite, selenomethionine and nanoselenium) on growth performance, muscle composition, blood enzymes and antioxidant status of common carp (Cyprinus carpio). Aquac. Nutr. 2017, 23, 611–617. [Google Scholar] [CrossRef]
  49. Uyisenga, A.; Liang, H.; Ren, M.; Huang, D.; Xue, C.; Yin, H.; Mi, H. The Effects of Replacing Fish Meal with Enzymatic Soybean Meal on the Growth Performance, Whole-Body Composition, and Health of Juvenile Gibel Carp (Carassius auratus gibelio). Fishes 2023, 8, 423. [Google Scholar] [CrossRef]
  50. Musharraf, M.; Khan, M.A. Estimation of dietary copper requirement of fingerling Indian major carp, Labeo rohita (Hamilton). Aquaculture 2022, 549, 737742. [Google Scholar] [CrossRef]
  51. Wang, H.; Li, E.; Zhu, H.; Du, Z.; Qin, J.; Chen, L. Dietary copper requirement of juvenile Russian sturgeon Acipenser gueldenstaedtii. Aquaculture 2016, 454, 118–124. [Google Scholar] [CrossRef]
  52. Shi, B.; Lu, J.; Hu, X.; Betancor, M.B.; Zhao, M.; Tocher, D.R.; Zhou, Q.; Jiao, L.; Xu, F.; Jin, M. Dietary copper improves growth and regulates energy generation by mediating lipolysis and autophagy in hepatopancreas of Pacific white shrimp (Litopenaeus vannamei). Aquaculture 2021, 537, 736505. [Google Scholar] [CrossRef]
  53. Parvez, S.; Sayeed, I.; Pandey, S.; Ahmad, A.; Bin-Hafeez, B.; Haque, R.; Ahmad, I.; Raisuddin, S. Modulatory effect of copper on nonenzymatic antioxidants in freshwater fish Channa punctatus (Bloch.). Biol. Trace Elem. Res. 2003, 93, 237–248. [Google Scholar] [CrossRef]
  54. Jiang, H.; Kong, X.; Wang, S.; Guo, H. Effect of Copper on Growth, Digestive and Antioxidant Enzyme Activities of Juvenile Qihe Crucian Carp, Carassius carassius, during Exposure and Recovery. Bull. Environ. Contam. Toxicol. 2016, 96, 333–340. [Google Scholar] [CrossRef] [PubMed]
  55. Tang, Q.Q.; Feng, L.; Jiang, W.D.; Liu, Y.; Jiang, Y.; Li, S.H.; Kuang, S.Y.; Tang, L.; Zhou, X.Q. Effects of dietary copper on growth, digestive, and brush border enzyme activities and antioxidant defense of hepatopancreas and intestine for young grass carp (Ctenopharyngodon Idella). Biol. Trace Elem. Res. 2013, 155, 370–380. [Google Scholar] [CrossRef] [PubMed]
  56. Dzoyem, J.P.; Kuete, V.; Eloff, J.N. Biochemical Parameters in Toxicological Studies in Africa: Significance, Principle of Methods, Data Interpretation, and Use in Plant Screenings. In Toxicological Survey of African Medicinal Plants; Elsevier Inc.: London, UK, 2014. [Google Scholar] [CrossRef]
  57. Fontagné-Dicharry, S.; Lataillade, E.; Surget, A.; Larroquet, L.; Cluzeaud, M.; Kaushik, S. Antioxidant defense system is altered by dietary oxidized lipid in first-feeding rainbow trout (Oncorhynchus mykiss). Aquaculture 2014, 424–425, 220–227. [Google Scholar] [CrossRef]
  58. Li, X.; Egervari, G.; Wang, Y.; Berger, S.L.; Lu, Z. Regulation of chromatin and gene expression by metabolic enzymes and metabolites. Nat. Rev. Mol. Cell Biol. 2018, 19, 563–578. [Google Scholar] [CrossRef] [PubMed]
  59. Liang, H.; Mokrani, A.; Ji, K.; Ge, X.; Ren, M.; Pan, L.; Sun, A. Effects of dietary arginine on intestinal antioxidant status and immunity involved in Nrf2 and NF-κB signaling pathway in juvenile blunt snout bream, Megalobrama amblycephala. Fish Shellfish Immunol. 2018, 82, 243–249. [Google Scholar] [CrossRef]
  60. Han, J.; Ulevitch, R.J. Limiting inflammatory responses during activation of innate immunity. Nat. Immunol. 2005, 6, 1198–1205. [Google Scholar] [CrossRef]
  61. Taylor, A.; Verhagen, J.; Blaser, K.; Akdis, M.; Akdis, C.A. Mechanisms of immune suppression by interleukin-10 and transforming growth factor-β: The role of T regulatory cells. Immunology 2006, 117, 433–442. [Google Scholar] [CrossRef]
  62. Ji, K.; Liang, H.; Ren, M.; Ge, X.; Liu, B.; Xi, B.; Pan, L.; Yu, H. Effects of dietary tryptophan levels on antioxidant status and immunity for juvenile blunt snout bream (Megalobrama amblycephala) involved in Nrf2 and TOR signaling pathway. Fish Shellfish Immunol. 2019, 93, 474–483. [Google Scholar] [CrossRef]
  63. Zhao, L.; Yuan, B.D.; Zhao, J.L.; Jiang, N.; Zhang, A.Z.; Wang, G.Q.; Li, M.Y. Amelioration of hexavalent chromium-induced bioaccumulation, oxidative stress, tight junction proteins and immune-related signaling factors by Allium mongolicum Regel flavonoids in Ctenopharyngodon idella. Fish Shellfish Immunol. 2020, 106, 993–1003. [Google Scholar] [CrossRef]
  64. Ali, Z.; Khan, I.; Iqbal, M.S.; Zhang, Q.; Ai, X.; Shi, H.; Ding, L.; Hong, M. Toxicological effects of copper on bioaccumulation and mRNA expression of antioxidant, immune, and apoptosis-related genes in Chinese striped-necked turtle (Mauremys sinensis). Front. Physiol. 2023, 14, 1296259. [Google Scholar] [CrossRef]
Fishes 09 00369 g001
Figure 1. Broken-line regression analysis of feed conversion ratio (FCR) and specific growth rate (SGR, %/day) against graded different levels of dietary copper.
Figure 1. Broken-line regression analysis of feed conversion ratio (FCR) and specific growth rate (SGR, %/day) against graded different levels of dietary copper.
Fishes 09 00369 g001
Fishes 09 00369 g002
Figure 2. Gene expression of the NF-κB signaling pathway in the liver of largemouth bass. (A) nf-κb; (B) tnf-α; (C) tgf-β; (D) il-8; (E) il-10. The data values are presented as means ± standard error mean (S.E.M), and significant differences between the six treatments are denoted by different letters (p < 0.05).
Figure 2. Gene expression of the NF-κB signaling pathway in the liver of largemouth bass. (A) nf-κb; (B) tnf-α; (C) tgf-β; (D) il-8; (E) il-10. The data values are presented as means ± standard error mean (S.E.M), and significant differences between the six treatments are denoted by different letters (p < 0.05).
Fishes 09 00369 g002
Fishes 09 00369 g003
Figure 3. Nrf2 signaling pathway gene expression in the liver of largemouth bass. (A) nrf2; (B) keap1; (C) cat; (D) Cu/Zn sod; (E) gpx. The data values are means ± standard error mean (SEM). Significant differences between the six treatments are indicated by different letters (p < 0.05).
Figure 3. Nrf2 signaling pathway gene expression in the liver of largemouth bass. (A) nrf2; (B) keap1; (C) cat; (D) Cu/Zn sod; (E) gpx. The data values are means ± standard error mean (SEM). Significant differences between the six treatments are indicated by different letters (p < 0.05).
Fishes 09 00369 g003
Table 1. Experimental basic formula (%, dry matter).
Table 1. Experimental basic formula (%, dry matter).
IngredientsLevel (%)IngredientsLevel (%)
Fish meal 120Choline chloride0.5
Casein 128Vitamin premix 21
Gelatin 17Mineral premix 3 (no copper)1
Wheat Flour 116Calcium phosphate4
Fish oil4Microcrystalline cellulose14.45
Soybean oil4Vitamin C0.05
Component Analysis
Crude protein (%)46.08 ± 0.21
Crude lipid (%)9.97 ± 0.11
Crude ash (%)4.05 ± 0.24
Crude fiber13.69 ± 0.85
Gross energy (KJ/g)15.35 ± 0.28
Note: 1 Fish meal, crude protein 67.8%, crude lipid 9.3%; casein, crude protein 90.0%; gelatin, crude protein 90.3%; wheat flour, crude protein 13.1%, crude lipid 4.0%; the above ingredients were obtained from Wuxi Tongwei feedstuffs Co., Ltd., Wuxi, China. 2 Vitamin premix (IU or mg/kg of premix, purchased by HANOVE Biotechnology Co., Ltd., Coventry, UK). 3 Mineral premix (no copper) (mg/kg of premix, purchased by HANOVE Biotechnology Co., Ltd., Coventry, UK): manganese sulfate, 31.5 mg; ferrous sulphate, 180.0 mg; zinc sulfate, 75 g; magnesium sulfate, 225.0 mg; sodium selenite, 0.8 mg; calcium iodate, 0.9 mg; cobalt chloride 0.7 mg; zeolite was used as a carrier.
Table 2. Primary methodologies and analytical instruments used.
Table 2. Primary methodologies and analytical instruments used.
ItemsMethodologies
Moisture
Crude protein
 
Lipids
Ash
 

Gross energy
 
Fiber		Dried sample in an oven at 105 °C
Using the Kjeldahl procedure after acid digestion (multiplied by N × 6.25)
Analysed through ether extraction using the Soxhlet system
Examined by combusting at 550 °C for 5 h in an intelligent muffle furnace (model number XL-2A, Hangzhou, China: Zhang Chi Instruments Co., Ltd.)
Examined by combusting in an oxygen bomb calorimeter: IKA C6000 (IKA Works, Guangzhou, China)
Fibercarp method by Fiber analysis system (FiberCap™ 2021, FOSS, Hilleroed, Denmark)
Plasma total protein (TP, Mindray 105-000451-00)
Albumin (ALB, Mindray 105-000450-00)
Total cholesterol (TC, Mindray 105-000448-00)
Glucose (GLU, Mindray 105-000460-00)
Triglyceride (TG, Mindray 105-000449-00)
Aspartate aminotransferase (AST, Mindray, 105-000443-00)
Alanine aminotransferase (ALT, Mindray 105-000442-00)		Measured using a Mindray BS-400 Automatic Biochemical Analyser (Mindray Medical International Ltd., Shenzhen, China)
Malondialdehyde (MDA, A003-1-2)
Glutathione (GSH, A006-2-1)
Glutathione peroxidase (GPx, A005-1-2)
Superoxide dismutase (SOD, A001-3-2)
Total antioxidant capacity (T-AOC, A015-2-1)
Catalase (CAT, A007-1-1)		Determined using biochemical kits from Nanjing Jiancheng Bioengineering Institute, Nanjing, China
Table 3. Primer sequences for real-time quantitative PCR analysis.
Table 3. Primer sequences for real-time quantitative PCR analysis.
Genes Primer Sequence (5′-3′)Reference
gapdhForwardACTGTCACTCCTCCATCTTAZA04761.1
ReverseCACGGTTGCTGTATCCAA
tgf-βForwardGCTCAAAGAGAGCGAGGATG[33]
ReverseTCCTCTACCATTCGCAATCC
il-8ForwardCGTTGAACAGACTGGGAGAGATG[34]
ReverseAGTGGGATGGCTTCATTATCTTGT
il-10ForwardCGGCACAGAAATCCCAGAGC[34]
ReverseCAGCAGGCTCACAAAATAAACATCT
nrf2ForwardAGAGACATTCGCCGTAGANM_212855.2
ReverseTCGCAGTAGAGCAATCCT
keap1ForwardCGTACGTCCAGGCCTTACTCXP_018520553.1
ReverseTGACGGAAATAACCCCCTGC
tnf-αForwardCTTCGTCTACAGCCAGGCATCG[33]
ReverseTTTGGCACACCGACCTCACC
Cu/Zn sodForwardTGGCAAGAACAAGAACCACA[33]
ReverseCCTCTGATTTCTCCTGTCACC
catForwardCTATGGCTCTCACACCTTCMK614708.1
ReverseTCCTCTACTGGCAGATTCT
gpxForwardGAAGGTGGATGTGAATGGAMK614713.1
ReverseCCAACCAGGAACTTCTCAA
nf-κbForwardCCACTCAGGTGTTGGAGCTTXP_027136364.1
ReverseTCCAGAGCACGACACACTTC
Note: gapdh, glyceraldehyde-3-phosphate dehydrogenase; tgf-β, transforming growth factor beta; il-8/10, interleukin 8/10; nrf2, nuclear factor erythroid 2-related factor 2; keap1, kelch-1ike ECH-associated protein l; tnf-α, tumor necrosis factor-α; cat, catalase; Cu/Zn sod, Cu/Zn superoxide dismutase; gpx, glutathione peroxidase; nf-κb, nuclear factor kappa-B.
Table 4. Effects of dietary Cu levels on growth performance of largemouth bass.
Table 4. Effects of dietary Cu levels on growth performance of largemouth bass.
Dietary Cu Levels (mg/kg)Growth Parameters
IBW (g)FBW (g)FCRWGR (%)SGR (%/Day)
2.131.68 ± 0.0117.71 ± 0.04 a0.96 ± 0.01 b953.92 ± 5.47 a4.21 ± 0.01 a
31.68 ± 0.0119.67 ± 0.28 c0.92 ± 0.01 a1075.60 ± 20.53 c4.40 ± 0.03 c
4.581.67 ± 0.0118.73 ± 0.36 b0.92 ± 0.00 a1022.39 ± 17.30 b4.31 ± 0.03 b
4.641.67 ± 0.0119.21 ± 0.27 bc0.92 ± 0.00 a1053.65 ± 17.60 bc4.37 ± 0.03 bc
5.721.67 ± 0.0119.15 ± 0.16 bc0.92 ± 0.00 a1046.59 ± 13.80 bc4.36 ± 0.02 bc
Note: The data values are presented as means ± standard error mean (SEM). Significant differences between the six treatments are indicated by different letters (p < 0.05).
Table 5. Effects of dietary Cu levels on whole body composition of largemouth bass.
Table 5. Effects of dietary Cu levels on whole body composition of largemouth bass.
Dietary Cu levels
(mg/kg)		Body Composition
Moisture (%)Protein (%)Lipid (%)Ash (%)
2.1371.99 ± 0.1314.91 ± 0.766.41 ± 0.463.65 ± 0.07
3.0071.63 ± 0.2215.81 ± 0.147.09 ± 0.353.43 ± 0.14
3.6671.45 ± 0.0416.16 ± 0.096.39 ± 0.073.74 ± 0.11
4.5871.92 ± 0.5615.63 ± 0.357.78 ± 0.373.85 ± 0.13
4.6471.37 ± 0.4616.27 ± 0.476.72 ± 0.593.57 ± 0.06
5.7271.78 ± 0.0416.08 ± 0.136.27 ± 0.293.54 ± 0.19
Note: The data values are means ± standard error mean (SEM).
Table 6. Effects of dietary Cu levels on plasma biochemical indices of largemouth bass.
Table 6. Effects of dietary Cu levels on plasma biochemical indices of largemouth bass.
ParametersDietary Cu Levels (mg/kg)
2.133.003.664.584.645.72
ALT (U/L)15.73 ± 3.3912.03 ± 2.0715.75 ± 2.9820.88 ± 5.4712.30 ± 2.7824.50 ± 5.66
AST (U/L)288.00 ± 59.11251.80 ± 32.56238.68 ± 34.52297.45 ± 40.12202.18 ± 33.62285.55 ± 54.68
TP (g/L)23.01 ± 2.16 a30.24 ± 1.71 b31.47 ± 2.04 b29.06 ± 1.26 b33.87 ± 1.71 b34.04 ± 1.39 b
ALB (g/L)2.30 ± 0.40 a4.03 ± 0.58 ab3.88 ± 0.74 ab4.23 ± 0.45 ab4.98 ± 0.68 b4.88 ± 0.96 b
TC (mmol/L)8.21 ± 0.90 a11.20 ± 0.74 b11.49 ± 0.53 b10.78 ± 0.76 b11.00 ± 1.35 b12.73 ± 0.74 b
TG (mmol/L)10.46 ± 1.24 a14.42 ± 1.20 ab15.02 ± 0.78 ab12.53 ± 2.04 ab17.08 ± 2.33 b17.32 ± 2.10 b
GLU (mmol/L)8.18 ± 0.68 b6.93 ± 0.53 ab5.85 ± 0.37 a7.97 ± 0.41 b6.23 ± 0.65 a5.40 ± 030 a
Note: The data values are presented as means ± standard error mean (SEM). Significant differences between the six treatments are denoted by different letters (p < 0.05).
Table 7. Effects of dietary Cu levels on antioxidant parameters in the liver of largemouth bass.
Table 7. Effects of dietary Cu levels on antioxidant parameters in the liver of largemouth bass.
ParametersDietary Cu Levels (mg/kg)
2.1333.664.584.645.72
CAT (U/mgprot)4.25 ± 2.31 a13.84 ± 1.95 b13.85 ± 2.85 b5.99 ± 1.29 ab9.17 ± 3.91 ab6.18 ± 1.51 ab
SOD18.30 ± 2.81 ab11.30 ± 2.31 a12.07 ± 2.02 a13.23 ± 3.60 a16.16 ± 1.99 ab21.36 ± 1.72 b
(U/mgprot)
T-AOC (mmol/gprot)0.26 ± 0.040.41 ± 0.080.40 ± 0.040.39 ± 0.060.31 ± 0.020.35 ± 0.05
GSH (μmol/gprot)19.38 ± 4.10 ab39.77 ± 6.23 c32.54 ± 5.24 bc14.90 ± 4.46 a27.21 ± 5.91 abc21.92 ± 3.05 ab
GPx 65.36 ± 25.3563.81 ± 23.4639.45 ± 14.3551.56 ± 15.7240.54 ± 13.4536.76 ± 10.27
(U/mgprot)
MDA (nmol/mgprot)2.44 ± 0.482.40 ± 0.563.49 ± 0.542.50 ± 0.434.56 ± 0.974.48 ± 1.01
Note: The data values are means ± standard error mean (SEM). Significant differences between the six treatments are indicated by different letters. Significant differences between the six treatments are indicated by different letters (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kayiira, J.C.; Mi, H.; Liang, H.; Ren, M.; Huang, D.; Zhang, L.; Teng, T. Effect of Dietary Copper on Growth Performance, Antioxidant Capacity, and Immunity in Juvenile Largemouth Bass (Micropterus salmoides). Fishes 2024, 9, 369. https://doi.org/10.3390/fishes9090369

AMA Style

Kayiira JC, Mi H, Liang H, Ren M, Huang D, Zhang L, Teng T. Effect of Dietary Copper on Growth Performance, Antioxidant Capacity, and Immunity in Juvenile Largemouth Bass (Micropterus salmoides). Fishes. 2024; 9(9):369. https://doi.org/10.3390/fishes9090369

Chicago/Turabian Style

Kayiira, John Cosmas, Haifeng Mi, Hualiang Liang, Mingchun Ren, Dongyu Huang, Lu Zhang, and Tao Teng. 2024. "Effect of Dietary Copper on Growth Performance, Antioxidant Capacity, and Immunity in Juvenile Largemouth Bass (Micropterus salmoides)" Fishes 9, no. 9: 369. https://doi.org/10.3390/fishes9090369

APA Style

Kayiira, J. C., Mi, H., Liang, H., Ren, M., Huang, D., Zhang, L., & Teng, T. (2024). Effect of Dietary Copper on Growth Performance, Antioxidant Capacity, and Immunity in Juvenile Largemouth Bass (Micropterus salmoides). Fishes, 9(9), 369. https://doi.org/10.3390/fishes9090369

Article Metrics

Back to TopTop