Next Article in Journal
Effect of Dietary Short-Chain Fatty Acids on the Immune Status and Disease Resistance of European Seabass Juveniles
Next Article in Special Issue
Effects of Dietary Protein and Lipid Levels on the Growth Performance and Serum Biochemical Indices of Juvenile Furong Crucian Carp
Previous Article in Journal
Socially Acceptable Feed Formulations May Impact the Voluntary Feed Intake and Growth, but Not Robustness of Nile Tilapia (Oreochromis niloticus)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 9
Issue 9
10.3390/fishes9090362
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Low-Proportion Replacement of Dietary Fishmeal with Neanthes japonica Meal on Growth Performance, Body Composition, Muscle Texture, Serum Biochemistry, Digestive Enzymes and Gene Expression in Juvenile Tiger Puffer Takifugu rubripes

by
Qingyan Gao
1,2,
Yuhan Fan
2,
Renxiao Zhang
2,
Jinghui Fang
2,
Qiang Ma
2,
Yuliang Wei
2,
Mengqing Liang
2,
Feng Liu
3,* and
Houguo Xu
2,*
1
College of Fisheries and Life Science, Dalian Ocean University, Dalian 116023, China
2
State Key Laboratory of Mariculture Biobreeding and Sustainable Goods, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China
3
Yantai Institute, China Agricultural University, Yantai 264670, China
*
Authors to whom correspondence should be addressed.
Fishes 2024, 9(9), 362; https://doi.org/10.3390/fishes9090362
Submission received: 7 August 2024 / Revised: 14 September 2024 / Accepted: 15 September 2024 / Published: 17 September 2024
(This article belongs to the Special Issue Development of Low-Crop, Low-Fishmeal or Low-Fish Oil Feeds for Aquaculture)
Browse Figures
Versions Notes

Abstract

The polychaeta Neanthes japonica is a common by-product in mariculture ponds. It is rich in essential nutrients, but has not been well-explored. Therefore, this 56-day experiment investigated the effects of substituting N. japonica meal for dietary fishmeal on juvenile tiger puffer (15.49 ± 0.02 g, n = 450 fish). The control diet (CON) contained 40% fishmeal. Freeze-dried N. japonica meal (FNM) was supplemented into CON at the levels of 3% (FNM3), 6% (FNM6), and 9% (FNM9), replacing fishmeal. The fifth diet contained 6% oven-dried N. japonica meal (ONM6), replacing fishmeal. The results indicated that no significant difference was observed in growth, feed efficiency, and somatic index among all the treatment groups. The feed intake of the FNM6 group was significantly higher compared to CON. No significant difference was detected in fish proximate composition, as well as the fatty acid composition, amino acid composition, and muscle texture. The supplementation of N. japonica meal decreased the activities of intestinal lipase and α-amylase. The addition of freeze-dried N. japonica meal significantly up-regulated the expression of the intestinal amino-glycine transporter pat1. It was concluded that adding 9% N. japonica meal to the feed had no significant effect on the growth performance and body composition of juvenile tiger puffer.
Keywords:
feed ingredient; functional feed; sustainable aquaculture; cyclic utilization; marine fish
Key Contribution: The addition of 3–9% of N. japonica meal in the diet exerted no adverse influence on the growth performance and proximate composition of tiger puffer.

1. Introduction

In 2022, the total world aquaculture production has reached approximately 130.9 million tons, a historically high production, which accounts for 59% of the global fishery and aquaculture production. Even for aquatic animals alone, the aquaculture production surpassed the capture fishery for the first time [1]. However, with rapid aquaculture growth, the gap in aquafeed ingredients, especially fishmeal and fish oil, is widening. Meeting the demand for aquafeed ingredients is becoming a big challenge, threatening the sustainability of aquaculture development. Therefore, exploring new ingredients is an urgent and important task.
Plant-based protein sources like soybean meal, rapeseed meal, peanut meal, cottonseed meal, corn gluten meal, and wheat flour are commonly used substitutes for fishmeal in the aquafeeds due to their wide availability, reasonable price, and stable supply [2,3,4]. However, these ingredients often have big defects such as amino acid imbalance and anti-nutritional factors, hindering the nutrient digestion or absorption in aquatic animals and thus resulting in low utilization for many farmed species, especially carnivorous ones [5,6,7,8,9,10,11,12]. Animal processing by-products, like poultry by-product meal and meat and bone meal, have also been used in fish feeds, but they also have imbalanced amino acids and unstable nutrition compositions, which are easily affected by factors such as raw material type, processing method, and freshness [13,14,15,16]. Some other more novel feed raw materials, such as insect, algae, and microbial protein, although having been demonstrated to be highly effective, are still limited by small-scale production and high costs [17,18,19,20].
Marine polychaetes, represented by nereis, are natural feeds for aquatic animals. They possess excellent palatability and balanced nutritional compositions [21,22]. Some species contain up to 55–60% protein (on a dry matter basis) and 12–20% lipids (on a dry matter basis), along with high levels of polyunsaturated fatty acids (PUFA) [23,24,25]. Polychaetes can serve as superior sources of protein and lipids in the feeds of fish and crustaceans [26,27], particularly at certain life stages such as broodstock and larval stages [28,29]. Polychaetes can be produced as by-products of multi-level integrated aquaculture. Typically, in pond aquaculture, the excessive feeds and feces of farmed aquatic animals (such as fish or shrimp) deposit at the bottom of the pond, which nourishes the polychaetes [30]. In this model, along with the production of polychaetes, the excess organic matter in the entire aquaculture water environment can be removed and thus the influence of aquaculture activities on the environment can be reduced [31,32,33,34,35,36]. Therefore, developing polychaetes as substitutes for fishmeal in aqua-feeds also has considerable environmental benefits. However, to date, very few studies have investigated the comprehensive use of polychaetes in aquaculture ponds.
Tiger puffer Takifugu rubripes is an important marine carnivorous fish species in Asia. The consumption of tiger puffer had been restricted due to the existence of tetrodotoxin. However, nowadays, the tetrodotoxin is no longer detectable in most farmed tiger puffer, accelerating the farming of this species [37,38,39,40]. Despite the fact that Neanthes japonica is a by-product of pond aquaculture, there is currently no mechanized and low-cost harvesting technique available. The costs, mainly labor, during the harvesting process remain relatively high. This experiment aimed to investigate the potential functional effects of N. japonica as a minor ingredient in juvenile tiger puffer; for instance, the feeding attracting function. Different drying methods were also compared, in order to evaluate the potential effects of drying temperature on biological efficacy of N. japonica. Results of this study may help motivate the exploration of N. japonica resources in aquaculture ponds.

2. Materials and Methods

2.1. Study Site

The rearing experiment was carried out in an indoor facility in at Huanghai Aquatic Products Co., Ltd. (Yantai, Shandong Province, China; 36°41′11.6″ N and 121°7′5.8″ E). The experimental duration was 56 days. The analysis experiment was carried out at the Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences.

2.2. Formulation and Preparation of Experimental Diets

The N. japonica used in this experiment were collected from white shrimp Litopenaeus vannamei farming ponds in Jimo (Qingdao, China). After the harvest of shrimp, the experimental N. japonica was collected (on 4 December 2022) by draining water during the night and capturing them using nets at the drainage outlet. The collected N. japonica were maintained in water, sealed, and frozen at −20 °C in a refrigerator. In May 2023, the samples were thawed, rinsed with freshwater, and subsequently placed in a vacuum freeze dryer (FDU-1100, EYELA, Tokyo, Japan) for freeze-drying. After being ground with a small grinder, they were vacuum-sealed as freeze-dried N. japonica meal (FNM). Another part of the samples was dried in an electrothermal blast drying oven (Shanghai Yiheng Scientific Instrument Co., Ltd., Shanghai, China) at 105 °C until a constant weight was achieved, in order to prepare the oven-dried N. japonica meal (ONM). The proximate compositions of the experimental N. japonica, fishmeal, FNM, and ONM are presented in Table 1.
The control experimental diet (CON) contained 40% fish meal (of dry matter). The treatment diets were obtained by adding different levels (3%, 6%, and 9%) of FNM or 6% ONM to CON. The treatment diets were named FNM3, FNM6, FNM9, and ONM6, respectively. Feed ingredients were sieved through 80 mesh, and then evenly mixed. Water was then added at 30%. Pellets with a diameter of 2.5 mm were prepared using a laboratory-level pelleter, and then dried in a 55 °C oven to a moisture content of about 6%. After drying and cooling, the pellets were packaged and sealed with double-layer plastic bags. The prepared diets were stored in a cold storage room at −20 °C until they were used. The formulation and proximate composition of the experimental feeds are presented in Table 2, and the fatty acid, total amino acid, and free amino acid compositions of the experimental feeds are depicted in Table 3, Table 4 and Table 5, respectively.

2.3. Experiment Fish and Feeding Management

The juvenile tiger puffer used in this experiment were all procured from Tangshan Haidu Seafood Food Co., Ltd. (Tangshan, China). The juvenile fish were transported to Haiyang Huanghai Aquatic Products Co., Ltd. (Haiyang, China) at 8:00 a.m. on 8 June 2023. Prior to the initiation of the rearing experiment, the fish were subjected to temporary rearing and acclimation with a commercial feed for a period of 30 days. During this interval, the fish teeth were cut to avoid cannibalism. A total of 450 juvenile fish (with an average initial body weight of 15.49 ± 0.02 g), which were free of external injuries on the body surface and of uniform specifications, were selected and randomly assigned to 15 fish tanks (72 × 72 × 50 cm, 200 L). Each experimental group was set up with 3 replicates, with 30 fish per replicate tank. The experimental fish were reared in an indoor flow-through seawater system for 56 days. They were hand-fed to satiation twice a day (07:30 and 18:30). The uneaten feed was removed using a siphoning method, and the quantity of uneaten feed in each fish tank following each feeding was recorded to adjust the data of feed consumption (based on the average weight of each pellet feed). During the experiment, a handheld multiparameter meter (ProQuatro, YSI, Yellow Springs, OH, USA) was used to measure the water quality. The water temperature was maintained within the range of 22–28 °C; the salinity was maintained within 28–32; the pH value was maintained within 7.4–7.8; the dissolved oxygen was greater than 5 mg/L; and the ammonia nitrogen and nitrite were less than 0.5 mg/L and 0.2 mg/L, respectively. The fish rearing handlings, as well as all the sampling handlings in this study, have been reviewed and approved by the Animal Care and Use Committee of the Yellow Sea Fisheries Research Institute (protocol code ACUC202303202514; date of approval, 20 March 2023).

2.4. Measurement of Fish Growth Performance

At the end of the experiment, the fish were first fasted for 24 h, and then the number of surviving fish in each aquaculture tank was counted and the fish weight in each tank was measured. The growth parameters can be calculated through the following equations:
Survival ratio (SR, %) = 100 × Nt/No
Weight gain (WG, %) = 100 × (Wt − Wo)/Wo
Specific growth rate (SGR, %/d) = (lnWt − lnWo)/D × 100
Feed conversion ratio (FCR) = Fd/(Wt − Wo)
Protein efficiency ratio (PER) = (Wt − Wo)/Fp
Protein deposition ratio (PDR, %) = Dp/Fp × 100
Feed intake (FI, %) = Fd/[(Wo + Wt)/2]/D × 100
Condition factor (K, g/cm3) = Wb/Lb3 × 100
Hepatosomatic index (HSI, %) = Wl/Wb × 100
Viserasomatic index (VSI, %) = Wv/Wb × 100
where: Nt is the final fish number; No is the initial fish number; Wt is the final body weight, in grams; Wo is the initial body weight, in grams; D is the experimental duration, in days; Fd is the feed ingestion, in grams; Fp is the ingested protein mass; Dp is the body protein deposition mass, in grams; Wb is the fish body weight, in grams; Lb is the body length, in centimeters; Wl is the liver mass, in grams; Wv is the viscera mass.

2.5. Sample Collection

Seven fish were randomly selected from each tank, and they were anesthetized with eugenol (eugenol: water = 1/10,000) before dissection. Two fish were used for testing the proximate composition of the whole fish. A total of five fish were dissected for tissue collection. Blood was collected from the caudal vein and allowed to clot at 4 °C for 3–4 h. Subsequently, the blood was centrifuged (at 3500 r/min for 10 min at 4 °C) to obtain the serum samples. Tissue samples from the liver, muscle, and midgut were collected after dissection. The collected samples were immediately placed in liquid nitrogen on-site and subsequently transferred to a −80 °C freezer for storage until further use. Following the sampling process, two fish were randomly selected from each tank and stored in a −20 °C freezer as backups.

2.6. Chemical Analysis of Diets and Fish

The crude protein, crude lipid, ash, and moisture content of both the feed and fish body were determined using the AOAC (2005) method [41]. FOSS Soxtec 2050 (Hillerod, Denmark) was used in the determination of crude protein. The gross energy of each of the diets was measured using a Compensated Calorimeter (6100, PARR, Moline, IL, USA).
The fatty acid composition of fishmeal, N. japonica meals, feeds, and muscle was analyzed using a gas chromatograph (GC-2010 Pro, Shimadzu, Kyoto, Japan). Fatty acids were extracted from the samples using a chloroform–methanol method. The fatty acids were saponified and methylated using BF3–methanol and KOH–methanol, respectively. GC conditions: a quartz capillary column (SH-RT-2560, 100 m × 0.25 mm × 0.20 μm, Shimadzu, Kyoto, Japan) and a flame ionization detector. The heating program was as follows: an increase of 15 °C/min from 150 °C to 200 °C, then an increase of 2 °C/min from 200 °C to 250 °C. Results were expressed as % total fatty acids [42].
Amino acid content determination: According to the protein content of fishmeal, N. japonica meals, feeds, and muscle, appropriate amounts of samples were weighed and hydrolyzed with 6 mol/L HCl at 110 °C for 22–24 h. The amino acid content was determined using an amino acid analyzer (L-8900, Hitachi, Kyoto, Japan) [43].
Determination of Free Amino Acids: The fish meal, N. japonica meal, feed, and muscle samples were subjected to deproteinization using trichloroacetic acid (6%), then centrifuged at 10,000× g for 10 min at 4 °C to obtain the supernatant. The content of free amino acids was determined using an amino acid analyzer (L-8900, Hitachi, Kyoto, Japan) [44].

2.7. Muscle Texture Analysis

The texture properties of fish muscle were determined using a texture analyzer (TMS-Pro, FTC, Sterling, VA, USA) equipped with a 25 N gravity sensor. The texture properties measured included hardness, adhesiveness, cohesiveness, springiness, gumminess and chewiness. The test conditions were: ambient temperature of 23 °C; 8 mm round probe; compression rate of 30 mm/min; and a deformation ratio of 30%.

2.8. Analysis of Serum Biochemical Parameters

The serum biochemical indicators were determined using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China): total protein (TP, A045-2), triglycerides (TG, A110-2-1), total cholesterol (TC, A111-2-1), malondialdehyde (MDA, A003-1), lysozyme (LZM, A050-1-1) and albumin (ALB, A028-1-1). The absorbance was measured using a microplate reader (Infinite M200, TECAN, Zurich, Switzerland). The operation was carried out in strict accordance with the instructions during the determination process.

2.9. Digestive Enzyme Activity

The digestive enzyme activities were determined using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China): chymotrypsin (A080-3-1), trypsin (A080-2-2), lipase (A054-1-1) and β-amylase (C016-2-1). The absorbance was measured using a microplate reader (Infinite M200, TECAN, Zurich, Switzerland). The operation was carried out in strict accordance with the instructions during the determination process. The β-amylase activity was calculated by subtracting α-amylase activity from the total amylase activity.

2.10. Analysis of Relative mRNA Expression

RNAiso Plus (TaKaRa, Dalian, China) was used to extract the total RNA from liver and intestine samples. Agarose gel electrophoresis (2%) was used to detect the integrity of the purified RNA (1 μL), and the OD260/280 ratio was determined using a Colibri ultra-micro spectrophotometer (Titerek Berthold, Bad Wildbad, Germany) to assess the purity and concentration of the purified RNA. Evo M-MLV RT and gDNA Clean for qPCR Reverse Transcription Pre-Mix Kit (Acreo Biotech Co., Ltd., Hunan, China) were used to reverse transcribe the RNA into cDNA. Primers for target genes and reference genes were designed based on the sequence in GenBank sequences (Table 6) and synthesized by Qingke Biotechnology Co., Ltd. (Qingdao, China). β-actin and ef1α were used as reference genes. The amplification efficiency of all specific primers was 95–105%. The R2 value of the primer gradient dilution standard curve was all greater than 0.99. The Roche LightCycler 96 (Roche, Basel, Switzerland) was used as the fluorescence quantitative PCR instrument; the SYBR Green Pro Taq HS Pre-Mix Type II qPCR Reagent Kit II (Acreo Biotech Co., Ltd., Hunan, China) was used as the reagent kit. The reaction mixture was prepared as follows: 5 μL SYBR Green Pro Taq HS Premix II, 1 μL cDNA, 0.3 μL upstream primer and downstream primer, and 3.4 μL pure water. The fluorescence quantitative PCR program was set as follows: 95 °C denaturation for 30 s; 40 cycles as follows: 95 °C denaturation for 5 s, 57 °C annealing for 30 s, 72 °C extension for 30 s. Finally, the melting curve (6.4 °C/min from 65 °C to 95 °C) was drawn to determine that the system has a unique PCR specific product. The relative expression level of the gene was calculated using the 2−ΔΔCt method.

2.11. Statistical Methods

All experimental data were analyzed using SPSS 26.0 for one-way ANOVA and Tukey’s test. When p < 0.05, there was a significant difference. The results are expressed as the mean ± standard error.

3. Results

3.1. Growth Performance and Somatic Indices

The addition of N. japonica meal exerted no significant influence on the final body weight (FBW), SR, WG, PER, PDR, FCR, SGR, HSI, VSI, and K of the fish (Table 7, p > 0.05). The FI of the FNM6 group was significantly higher than that of the CON group (p < 0.05), and the FI presented a trend of increasing after the addition of N. japonica meal.

3.2. Chemical Analysis of Fish

3.2.1. Proximate Composition

The addition of N. japonica meal had no significant effects on the crude protein, crude lipid, moisture, and ash content of the whole fish, as well as the crude protein, crude lipid, and moisture content in the muscle and liver (Table 8, p > 0.05).

3.2.2. Fatty Acids Composition in Muscle

The addition of N. japonica meal exerted no significant effect on the fatty acid composition of the muscle (Table 9, p > 0.05).

3.2.3. Amino Acids Composition in Muscle

The addition of N. japonica meal exerted no significant effect on the amino acid composition of the muscle (Table 10, p > 0.05).

3.2.4. Free Amino Acids Composition in Muscle

The addition of N. japonica meal in the feed exerted no influence on the composition of free amino acid composition in the muscle (Table 11, p > 0.05).

3.3. Muscle Texture

The addition of N. japonica meal did not exert significant influences on the muscle hardness, adhesiveness, cohesiveness, springiness, gumminess, and chewiness of the experimental fish (Table 12, p > 0.05).

3.4. Serum Biochemical Parameters

Compared to CON, the serum TP content of ONM6 was significantly higher (Figure 1, p < 0.05). Compared to the CON group, the serum TC content in the FNM3 group was significantly higher (p < 0.05). No significant differences were observed in the serum TG, MDA, LZM, and ALB contents among all treatments (p > 0.05).

3.5. Digestive Enzyme Activities

Compared to CON, the intestinal activities of lipase and α-amylase were reduced in the N. japonica meal-supplemented groups. Specifically, the α-amylase activity in the FNM6, FNM9, and ONM6 groups was significantly lower than that in the CON group (Figure 2, p < 0.05). The lipase activity in the ONM6 group was significantly lower than that in the CON group (p < 0.05). The addition of N. japonica meal exhibited no significant influence on the activities of trypsin, chymotrypsin, total amylase, and β-amylase in the intestine (p > 0.05).

3.6. Relative mRNA Expression

Compared with the CON group, the supplementation of FNM significantly up-regulated the expression of intestinal pat1 (Figure 3A, p < 0.05). The addition of N. japonica meal exerted no significant influence on the expression of intestinal pept-1, eaat3, b0at1, cat1, and y+lat2 (p > 0.05).
Compared with the CON group, the supplementation with N. japonica meal exerted no significant influence on the relative expression of leptin in the liver, as well as the gene expression of jak2, and stat3 in the intestine (Figure 3B, p > 0.05). No leptin expression was detected in the intestine. The relative expression of the intestinal jak2 gene in the FNM6 group was significantly higher than that in the ONM6 group (p < 0.05).

4. Discussion

To date, there have been few studies about the application of polychaete meal in aquafeeds. Limited studies in this area have shown that the sandworm Alitta virens can replace 40% fishmeal in the feed of European seabass Dicentrarchus labrax without affecting the growth and nutrient utilization [41]. Alitta virens can also serve as the main dietary protein source for rainbow trout Oncorhynchus mykiss. The growth performance of rainbow trout fed the diet with 35% A. virens meal was similar to that of fish fed commercial feeds [42]. In Nile tilapia Oreochromis niloticus, supplementation of 51.4% Nereis sp. meal into the feed (containing 40% crude protein) can promote the fish growth and feed efficiency [43]. These studies suggested that polychaetes can be a valuable alternative protein source in aquatic feeds.
In contrast to the aforementioned studies, the dietary proportion of N. japonica meal in this experiment was relatively low, ranging from 3% to 9%. This experimental design primarily took into account the low production of N. japonica at present. The results of this experiment demonstrated that partial replacement of fishmeal by N. japonica meal did not exert a significant influence on the growth performance of juvenile tiger puffer. Notably, the fish weight gain in the group with 3% N. japonica meal was elevated by 9.43% compared to the control group. This indicates that the low-proportion substitution N. japonica meal for fishmeal may have potential fish growth-promoting effects. A longer feeding duration may enlarge this growth-promoting effect. Similar results were observed in studies on European seabass, rainbow trout, and Nile tilapia [45,46,47].
Besides, the supplementation of N. japonica meal enhanced the feed intake of tiger puffer, which validated the experimental hypothesis. The feeding attracting effect of N. japonica meal might be associated with the relatively high content of free amino acids. Free amino acids such as arginine, aspartic acid, glutamic acid, glycine, and alanine are flavor substances [48], and an appropriate amount of these free amino acids could increase the palatability of the feed [49].
Considering that the active substances which determine the function of N. japonica could be susceptible to high drying temperature, in this study different drying methods, namely, freeze-drying and oven-drying, were compared (at the 6% supplementation level). However, the results showed that different drying methods led to no significant difference in terms of the fish growth and physiological parameters. Irrespective of the drying method, dried N. japonica meal had higher contents of nearly all types of free amino acid, except for histidine and taurine. The oven-drying resulted in even higher free amino acids than freeze-drying (increased by 83.24%). This could be attributed to the fact that high temperatures during the oven-drying process facilitated the cleavage of peptide bonds into low-molecular peptides and free amino acids.
Regarding the fish body composition, the addition of N. japonica meal did not exert a significant influence on the proximate composition of whole fish and fish tissues, nor did it have a notable effect on the fatty acid and amino acid profiles of the muscle. Currently, there have been very few studies on the impacts of replacing fishmeal with polychaetes on fish body composition. In the feed of European seabass, the addition of 2.5%, 5%, and 10% of polychaete Alitta virens meal replacing fishmeal also had no significant effects on the proximate composition of fish body [45]. The lack of changes in fish body composition could be due to the fact that the N. japonica meal had very similar compositions to fishmeal, in terms of proximate composition, amino acid composition and fatty acid profiles. In contrast, the use of terrestrially-sourced insects, like black soldier fly Hermetia illucens larvae meal, commonly resulted in changes in fish body composition [50,51]. Marine polychaetes seemed superior to terrestrially-sourced insects in maintaining fish body composition. Consequently, the use of N. japonica meal in fish feeds could exert very minor effects on muscle texture, which was demonstrated in this study.
The serum biochemical indicators of fish reflect, to a certain extent, the physiological and health status of the fish. There is a close correlation between serum protein and the level of protein synthesis in the liver. Consequently, the content of serum protein is also a significant index reflecting protein metabolism, nutrition, and health within the organism [52]. Albumin and globulin are essential components for maintaining cell nutrition and the osmotic pressure balance of blood, and their contents can indirectly indicate the status of protein synthesis in the liver [53]. This study demonstrated that the supplementation of N. japonica meal elevated the content of total serum protein. This indicates that the addition of N. japonica meal may enhance the protein synthesis capacity of the fish liver and facilitate protein metabolism. The cholesterol content in serum can, to a certain extent, reflect the fat metabolism status of the liver. The supplementation of N. japonica meal increased the content of total serum cholesterol, in particular at the 3% supplementation level. This suggested that the N. japonica meal may be capable of regulating the lipid metabolism. Considering that the addition of N. japonica meal in the feed had no significant impact on other serum indicators such as albumin, triglyceride, malondialdehyde, and lysozyme, the precise mechanism by which the N. japonica meal regulated the fish physiological metabolism remains unclear and warrants further studies.
Despite the promising features, the application of N. japonica was by no means devoid of negative consequences. In this study, the supplementation of N. japonica meal in the feed reduced the activities of intestinal lipase and α-amylase. This could potentially be attributed to the existence of chitin in the N. japonica meal. Chitin is a nitrogen-containing polysaccharide, constituted by a majority of N-acetylated D-glucosamine and a minority of D-glucosamine. As a highly insoluble compound, chitin could reduce the water-holding capacity of intestinal chyme. This characteristic not only shortens the transit time of chyme within the intestinal tract but also facilitates fecal expansion, thereby reducing the interaction duration between digestive enzymes and their substrates [54]. The downregulation of digestive enzyme activity by N. japonica may counteract its stimulatory effects on feed intake, consequently leading to no significant disparity in overall growth performance among the experimental groups.
Besides the phenotypic parameters, this study also analyzed the expression of genes related to the absorption and transport of amino acids and peptides. Oligopeptides and amino acids derived from protein degradation in the intestine are transported into cells via transport carriers and subsequently utilized by the organism. The expression of oligopeptide and amino acid transport carriers in the intestinal tract of fish serves as a crucial indicator reflecting the intestinal absorptive capacity for oligopeptides and amino acids [55,56,57]. The expression levels of amino acid transport carriers are prone to regulation by the nutritional status of the feed since the cells of the animal body generate an adaptive response to the ingested feed, and the amino acid transport carriers have the ability to sense amino acid levels. This experiment primarily investigated pept-1 for transporting oligopeptides, eaat3 for transporting acidic amino acids, b0at1 for transporting neutral amino acids, y+lat2 for transporting neutral and basic amino acids, cat1 for transporting basic amino acids, and pat1 for transporting amino-glycine. The supplementation of N. japonica meal significantly up-regulated the relative mRNA expression level of intestinal pat1. The free glycine in the diet increased with the escalating addition level of N. japonica meal, and could subsequently stimulate the pat1 expression. However, the addition of N. japonica meal in the feed did not impact the relative mRNA expression of pept-1, eaat3, b0at1, y+lat2, and cat1 in the intestine. Fish may have the capacity to regulate the expression of oligopeptide and amino acid transport carriers through a feedback mechanism, in order to control the absorption homeostasis of oligopeptides and amino acids in cells [58,59,60].
Since the feed intake of fish in the treatment group was elevated, this experiment also investigated the impact of N. japonica meal on the expression of appetite-related genes. In vertebrates, leptin is predominantly secreted by adipocytes, and functions to inhibit appetite for regulating energy balance and to decrease fat storage in adipocytes [61]. Leptin primarily acts on the hypothalamus via the JAK2/STAT3 signaling pathway, suppressing the secretion of Neuropeptide Y by hunger neurons in the outer nucleus of the hypothalamus, thereby reducing appetite [62,63]. This experiment indicates that the addition of N. japonica meal exerts no significant influence on the mRNA expression of leptin (non-detectable in the intestine), jak2, and stat3 in the liver and intestine. Therefore, the N. japonica meal may regulate feeding activities through alternative pathways.

5. Conclusions

Under the experimental conditions, adding 9% N. japonica meal to the feed had no significant effect on the growth performance and body composition of juvenile tiger puffer. Different drying methods, namely, freeze-drying and oven-drying, had no significant difference in terms of fish performance. The N. japonica meal may be able to promote the feed intake of tiger puffer, but could reduce the activity of intestinal digestive enzymes to a certain extent.

Author Contributions

Q.G. and H.X.: conceptualization; Y.W.: methodology; Q.M. and F.L.: validation; Y.F. and R.Z.: formal analysis; J.F.: investigation; Q.G.: data curation, visualization, writing—original draft; H.X.: writing—review and editing; M.L. and H.X.: resources, project administration, funding acquisition. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Chinese Academy of Fishery Sciences (2024CG01 and 2023TD52), Shandong Province Aquatic Seed Industry Leading Enterprise Project (202351-21), China Agricultural Research System (CARS-47), and the Natural Science Foundation of Shandong Province (ZR2021YQ24).

Institutional Review Board Statement

The animal-study protocol was approved by the Animal Care and Use Committee of Yellow Sea Fisheries Research Institute (protocol code ACUC202303202514; date of approval, 20 March 2023).

Data Availability Statement

The data that support the findings of this study are included in the text and in the tables. Raw data for all figures are available from the corresponding authors upon reasonable request.

Acknowledgments

We thank Chao Chen for his help in fish rearing.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. FAO. The State of World Fisheries and Aquaculture 2024—Blue Transformation in Action; Food and Agriculture Organization of the United Nations: Rome, Italy, 2024. [Google Scholar] [CrossRef]
  2. National Research Council (NRC). Nutrient Requirements of Fish and Shrimp; National Academies: Washington, DC, USA, 2011; ISBN 978-0-309-16338-5. [Google Scholar]
  3. Oliva-Teles, A.; Enes, P.; Peres, H. 8—Replacing fishmeal and fish oil in industrial aquafeeds for carnivorous fish. In Feed and Feeding Practices in Aquaculture; Davis, D.A., Ed.; Woodhead Publishing: Oxford, UK, 2015; pp. 203–233. ISBN 978-0-08-100506-4. [Google Scholar]
  4. Gatlin, D.M., III; Barrows, F.T.; Brown, P.; Dabrowski, K.; Gaylord, T.G.; Hardy, R.W.; Herman, E.; Hu, G.; Krogdahl, Å.; Nelson, R. Expanding the utilization of sustainable plant products in aquafeeds: A review. Aquac. Res. 2007, 38, 551–579. [Google Scholar] [CrossRef]
  5. Li, X.L.; Rezaei, R.; Li, P.; Wu, G.Y. Composition of amino acids in feed ingredients for animal diets. Amino Acids 2011, 40, 1159–1168. [Google Scholar] [CrossRef] [PubMed]
  6. Francis, G.; Makkar, H.P.; Becker, K. Antinutritional factors present in plant-derived alternate fish feed ingredients and their effects in fish. Aquaculture 2001, 199, 197–227. [Google Scholar] [CrossRef]
  7. Blaufuss, P.; Trushenski, J. Exploring Soy-Derived Alternatives to Fish Meal: Using Soy Protein Concentrate and Soy Protein Isolate in Hybrid Striped Bass Feeds. N. Am. J. Aqualcult. 2012, 74, 8–19. [Google Scholar] [CrossRef]
  8. Stone, D.A.J. Dietary Carbohydrate Utilization by Fish. Rev. Fish. Sci. 2003, 11, 337–369. [Google Scholar] [CrossRef]
  9. Fournier, V.; Huelvan, C.; Desbruyeres, E. Incorporation of a mixture of plant feedstuffs as substitute for fish meal in diets of juvenile turbot (Psetta maxima). Aquaculture 2004, 236, 451–465. [Google Scholar] [CrossRef]
  10. Lin, S.-M.; Zhou, X.-M.; Zhou, Y.-L.; Kuang, W.-M.; Chen, Y.-J.; Luo, L.; Dai, F.-Y. Intestinal morphology, immunity and microbiota response to dietary fibers in largemouth bass, Micropterus salmoide. Fish Shellfish Immunol. 2020, 103, 135–142. [Google Scholar] [CrossRef]
  11. Olsen, R.E.; Hansen, A.-C.; Rosenlund, G.; Hemre, G.-I.; Mayhew, T.M.; Knudsen, D.L.; Tufan Eroldoğan, O.; Myklebust, R.; Karlsen, Ø. Total replacement of fish meal with plant proteins in diets for Atlantic cod (Gadus morhua L.) II—Health aspects. Aquaculture 2007, 272, 612–624. [Google Scholar] [CrossRef]
  12. Colombo, S.M.; Roy, K.; Mraz, J.; Wan, A.H.; Davies, S.J.; Tibbetts, S.M.; Øverland, M.; Francis, D.S.; Rocker, M.M.; Gasco, L. Towards achieving circularity and sustainability in feeds for farmed blue foods. Rev. Aquac. 2023, 15, 1115–1141. [Google Scholar] [CrossRef]
  13. Glencross, B.; Ling, X.; Gatlin, D.; Kaushik, S.; Øverland, M.; Newton, R.; Valente, L.M.P. A SWOT Analysis of the Use of Marine, Grain, Terrestrial-Animal and Novel Protein Ingredients in Aquaculture Feeds. Rev. Fish. Sci. Aquac. 2024, 32, 396–434. [Google Scholar] [CrossRef]
  14. Bureau, D.; Harris, A.; Cho, C. Apparent digestibility of rendered animal protein ingredients for rainbow trout (Oncorhynchus mykiss). Aquaculture 1999, 180, 345–358. [Google Scholar] [CrossRef]
  15. Bureau, D.; Harris, A.; Bevan, D.; Simmons, L.; Azevedo, P.; Cho, C. Feather meals and meat and bone meals from different origins as protein sources in rainbow trout (Oncorhynchus mykiss) diets. Aquaculture 2000, 181, 281–291. [Google Scholar] [CrossRef]
  16. Lock, E.-J.; Biancarosa, I.; Gasco, L. Insects as Raw Materials in Compound Feed for Aquaculture. In Edible Insects in Sustainable Food Systems; Halloran, A., Flore, R., Vantomme, P., Roos, N., Eds.; Springer International Publishing: Cham, Switzerland, 2018; pp. 263–276. ISBN 978-3-319-74010-2. [Google Scholar]
  17. Basto, A.; Matos, E.; Valente, L.M. Nutritional value of different insect larvae meals as protein sources for European sea bass (Dicentrarchus labrax) juveniles. Aquaculture 2020, 521, 735085. [Google Scholar] [CrossRef]
  18. Tibbetts, S.M.; Mann, J.; Dumas, A. Apparent digestibility of nutrients, energy, essential amino acids and fatty acids of juvenile Atlantic salmon (Salmo salar L.) diets containing whole-cell or cell-ruptured Chlorella vulgaris meals at five dietary inclusion levels. Aquaculture 2017, 481, 25–39. [Google Scholar] [CrossRef]
  19. Jones, S.W.; Karpol, A.; Friedman, S.; Maru, B.T.; Tracy, B.P. Recent advances in single cell protein use as a feed ingredient in aquaculture. Curr. Opin. Biotechnol. 2020, 61, 189–197. [Google Scholar] [CrossRef]
  20. Xiong, H.; Xu, H. How Current Global Aqua-Nutrition Research Matches the New Industry and Market Demands. Fishes 2024, 9, 259. [Google Scholar] [CrossRef]
  21. Watson, G.J.; Murray, J.M.; Schaefer, M.; Bonner, A. Bait worms: A valuable and important fishery with implications for fisheries and conservation management. Fish Fish. 2017, 18, 374–388. [Google Scholar] [CrossRef]
  22. Velez, Z.; Hubbard, P.C.; Hardege, J.D.; Barata, E.N.; Canário, A.V. The contribution of amino acids to the odour of a prey species in the Senegalese sole (Solea senegalensis). Aquaculture 2007, 265, 336–342. [Google Scholar] [CrossRef]
  23. Narciso, L.; da Fonseca, L.C. Growth, survival and fatty acid profile of Nereis diversicolor (OF Müller, 1776) fed on six different diets. Bull. Mar. Sci. 2000, 67, 337–343. [Google Scholar]
  24. Meunpol, O.; Meejing, P.; Piyatiratitivorakul, S. Maturation diet based on fatty acid content for male Penaeus monodon (Fabricius) broodstock. Aquac. Res. 2005, 36, 1216–1225. [Google Scholar] [CrossRef]
  25. Techaprempreecha, S.; Khongchareonporn, N.; Chaicharoenpong, C.; Aranyakananda, P.; Chunhabundit, S.; Petsom, A. Nutritional composition of farmed and wild sandworms, Perinereis nuntia. Anim. Feed. Sci. Technol. 2011, 169, 265–269. [Google Scholar] [CrossRef]
  26. García-Alonso, J.; Müller, C.T.; Hardege, J. Influence of food regimes and seasonality on fatty acid composition in the ragworm. Aquat. Biol. 2008, 4, 7–13. [Google Scholar] [CrossRef]
  27. Arias, A.; Richter, A.; Anadón, N.; Glasby, C.J. Revealing polychaetes invasion patterns: Identification, reproduction and potential risks of the Korean ragworm, Perinereis linea (Treadwell), in the Western Mediterranean. Estuar. Coast. Shelf. Sci. 2013, 131, 117–128. [Google Scholar] [CrossRef]
  28. Chimsung, N. Maturation diets for black tiger shrimp (Penaeus monodon) broodstock: A review. Songklanakarin J. Sci. Technol. 2014, 36, 265–273. [Google Scholar]
  29. Leelatanawit, R.; Uawisetwathana, U.; Khudet, J.; Klanchui, A.; Phomklad, S.; Wongtripop, S.; Angthoung, P.; Jiravanichpaisal, P.; Karoonuthaisiri, N. Effects of polychaetes (Perinereis nuntia) on sperm performance of the domesticated black tiger shrimp (Penaeus monodon). Aquaculture 2014, 433, 266–275. [Google Scholar] [CrossRef]
  30. Carvalho, S.; Barata, M.; Gaspar, M.B.; Pousão-Ferreira, P.; Cancela da Fonseca, L. Enrichment of aquaculture earthen ponds with Hediste diversicolor: Consequences for benthic dynamics and natural productivity. Aquaculture 2007, 262, 227–236. [Google Scholar] [CrossRef]
  31. Brown, N.; Eddy, S.; Plaud, S. Utilization of waste from a marine recirculating fish culture system as a feed source for the polychaete worm, Nereis virens. Aquaculture 2011, 322, 177–183. [Google Scholar] [CrossRef]
  32. Bischoff, A.A.; Fink, P.; Waller, U. The fatty acid composition of Nereis diversicolor cultured in an integrated recirculated system: Possible implications for aquaculture. Aquaculture 2009, 296, 271–276. [Google Scholar] [CrossRef]
  33. Palmer, P.J. Polychaete-assisted sand filters. Aquaculture 2010, 306, 369–377. [Google Scholar] [CrossRef]
  34. Honda, H.; Kikuchi, K. Nitrogen budget of polychaete Perinereis nuntia vallata fed on the feces of Japanese flounder. Fish. Sci. 2002, 68, 1304–1308. [Google Scholar] [CrossRef]
  35. Wang, H.; Seekamp, I.; Malzahn, A.; Hagemann, A.; Carvajal, A.K.; Slizyte, R.; Standal, I.B.; Handå, A.; Reitan, K.I. Growth and nutritional composition of the polychaete Hediste diversicolor (OF Müller, 1776) cultivated on waste from land-based salmon smolt aquaculture. Aquaculture 2019, 502, 232–241. [Google Scholar] [CrossRef]
  36. Luis, O.J.; Passos, A.M. Seasonal changes in lipid content and composition of the polychaete Nereis (Hediste) diversicolor. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 1995, 111, 579–586. [Google Scholar] [CrossRef]
  37. Noguchi, T.; Arakawa, O.; Takatani, T. Toxicity of pufferfish Takifugu rubripes cultured in netcages at sea or aquaria on land. Comp. Biochem. Physiol. Part D Genom. Proteom. 2006, 1, 153–157. [Google Scholar] [CrossRef]
  38. Lim, S.-J.; Kim, S.-S.; Ko, G.-Y.; Song, J.-W.; Oh, D.-H.; Kim, J.-D.; Kim, J.-U.; Lee, K.-J. Fish meal replacement by soybean meal in diets for Tiger puffer, Takifugu rubripes. Aquaculture 2011, 313, 165–170. [Google Scholar] [CrossRef]
  39. Guo, Q.; Wang, Y.; Li, N.; Li, T.; Guan, Y.; Wang, Y.; Zhang, P.; Li, Z.; Liu, H. Effects of dietary carbohydrate levels on growth performance, feed utilization, liver histology and intestinal microflora of juvenile tiger puffer, Takifugu rubripes. Aquac. Rep. 2024, 36, 102035. [Google Scholar] [CrossRef]
  40. Liao, K.; Lou, X.; Yang, Z.; Zhang, D.; Su, P. Comparative analysis of the economic feasibility of Tiger puffer (Takifugu rubripes) aquaculture in China. Aquac. Int. 2024, 32, 939–961. [Google Scholar] [CrossRef]
  41. AOAC. Official Methods of Analysis of AOAC International, 18th ed.; AOAC International: Gaithersburg, MD, USA, 2005; ISBN 0-935584-77-3. [Google Scholar]
  42. Liu, J.; Zhang, F.; Ma, Q.; Wei, Y.; Liang, M.; Xu, H. Sex Differences in Fatty Acid Composition of Chinese Tongue Sole (Cynoglossus semilaevis) Tissues. Fishes 2023, 8, 421. [Google Scholar] [CrossRef]
  43. Wei, Y.; Liang, M.; Xu, H.; Zheng, K. Taurine alone or in combination with fish protein hydrolysate affects growth performance, taurine transport and metabolism in juvenile turbot (Scophthalmus maximus L.). Aquac. Nutr. 2019, 25, 396–405. [Google Scholar] [CrossRef]
  44. Zhao, L.; Li, L.; Zhang, F.; Li, P.; Li, Y.; Liu, J.; Wei, Y.; Liang, M.; Ma, Q.; Xu, H. Combined Replacement of Fishmeal and Fish Oil by Poultry Byproduct Meal and Mixed Oil: Effects on the Growth Performance, Body Composition, and Muscle Quality of Tiger Puffer. Aquac. Nutr. 2024, 2024, 1402602. [Google Scholar] [CrossRef]
  45. Monteiro, M.; Costa, R.S.; Sousa, V.; Marques, A.; Sá, T.; Thoresen, L.; Aldaghi, S.A.; Costamagna, M.; Perucca, M.; Kousoulaki, K.; et al. Towards sustainable aquaculture: Assessing polychaete meal (Alitta virens) as an effective fishmeal alternative in European seabass (Dicentrarchus labrax) diets. Aquaculture 2024, 579, 740257. [Google Scholar] [CrossRef]
  46. Thum, G.; Cappai, M.G.; Bochert, R.; Schubert, H.; Wolf, P. Nutrient Profile of Baltic Coastal Red Algae (Delesseria sanguinea), Baltic Blue Mussel (Mytilus spp.) and King Ragworm (Alitta virens) as Potential Feed Material in the Diet of Rainbow Trout (Oncorhynchus mykiss Walbaum, 1792): A Preliminary Assessment. Agriculture 2022, 12, 196. [Google Scholar] [CrossRef]
  47. Ahmad, K.; Yuliana; Amin, R.; Syazili, A.; Surahman. Increasing growth and survival rate of tilapia larvae (Oreochromis niloticus) by adding polychaeta Nereis sp dry meal into feed formulation. In IOP Conference Series: Earth and Environmental Science; IOP Publishing: Bristol, UK, 2021; Volume 890, p. 012027. [Google Scholar] [CrossRef]
  48. Wei, L.; Dai, K.; Qiao, Z.; Qi, X.; Song, Z.; Gu, J.; Lu, Q.; Wang, X.; Yin, M. Comparative analysis of nutritional and non-volatile taste components of the Chinese mitten crab (Eriocheir sinensis). J. Food. Compos. Anal. 2024, 133, 106373. [Google Scholar] [CrossRef]
  49. Grey, M.; Forster, I.; Dominy, W.; Ako, H.; Giesen, A.F. Validation of a feeding stimulant bioassay using fish hydrolysates for the Pacific white shrimp, Litopenaeus vannamei. J. World Aquac. Soc. 2009, 40, 547–555. [Google Scholar] [CrossRef]
  50. Karapanagiotidis, I.T.; Daskalopoulou, E.; Vogiatzis, I.; Rumbos, C.; Mente, E.; Athanassiou, C. Substitution of fishmeal by fly Hermetia illucens prepupae meal in the diet of gilthead seabream (Sparus aurata). In Proceedings of the 1st International Congress of Applied Ichthyology & Aquatic Environment (HydroMedit 2014), Volos, Greece, 13–15 November 2014; pp. 110–114. [Google Scholar]
  51. Hu, J.; Wang, G.; Mo, W.; Huang, Y.; Li, G.; Li, Z.; Sun, Y.; Zhao, H. Effects of fish meal replacement by black soldier fly (Hermetia illucens L.) larvae meal on growth performance, body composition, plasma biochemical indexes and tissue structure of juvenile Lateolabrax japonicas. Chin. J. Anim. Nutr. 2018, 30, 613–623. [Google Scholar]
  52. Wiegertjes, G.F.; Stet, R.M.; Parmentier, H.K.; van Muiswinkel, W.B. Immunogenetics of disease resistance in fish: A comparative approach. Dev. Comp. Immunol. 1996, 20, 365–381. [Google Scholar] [CrossRef] [PubMed]
  53. Kong, C.; Hua, X.; Yang, L.; Liu, T.; Yang, J.; Wang, T.; Wang, G.; Wu, Z.; Shi, Y.; Shui, C. Nutritional physiological effects of soybean meal substituting for fish meal in the feed of obscure puffer (Takifugu fasciatus) and its relationship with soybean antigenic proteins. J. Fish. China 2017, 41, 734–745. [Google Scholar] [CrossRef]
  54. Kokou, F.; Fountoulaki, E. Aquaculture waste production associated with antinutrient presence in common fish feed plant ingredients. Aquaculture 2018, 495, 295–310. [Google Scholar] [CrossRef]
  55. Shiraga, T.; Miyamoto, K.-I.; Tanaka, H.; Yamamoto, H.; Taketani, Y.; Morita, K.; Tamai, I.; Tsuji, A.; Takeda, E. Cellular and molecular mechanisms of dietary regulation on rat intestinal H+/peptide transporter PepT1. Gastroenterology 1999, 116, 354–362. [Google Scholar] [CrossRef]
  56. Spanier, B.; Rohm, F. Proton coupled oligopeptide transporter 1 (PepT1) function, regulation, and influence on the intestinal homeostasis. Compr. Physiol. 2011, 8, 843–869. [Google Scholar] [CrossRef]
  57. Bröer, S.; Fairweather, S.J. Amino Acid Transport Across the Mammalian Intestine. Compr. Physiol. 2018, 9, 343–373. [Google Scholar] [CrossRef]
  58. Gilbert, E.; Wong, E.; Webb Jr, K. Board-invited review: Peptide absorption and utilization: Implications for animal nutrition and health. J. Anim. Sci. 2008, 86, 2135–2155. [Google Scholar] [CrossRef] [PubMed]
  59. Palii, S.S.; Chen, H.; Kilberg, M.S. Transcriptional control of the human sodium-coupled neutral amino acid transporter system A gene by amino acid availability is mediated by an intronic element. J. Biol. Chem. 2004, 279, 3463–3471. [Google Scholar] [CrossRef] [PubMed]
  60. Martínez-Alvarez, O.; Chamorro, S.; Brenes, A. Protein hydrolysates from animal processing by-products as a source of bioactive molecules with interest in animal feeding: A review. Food. Res. Int. 2015, 73, 204–212. [Google Scholar] [CrossRef]
  61. Machleidt, F.; Lehnert, H. Die Rolle des Gehirns in der Regulation des Stoffwechsels. DMW-Dtsch. Med. Wochenschr. 2011, 136, 541–545. [Google Scholar] [CrossRef] [PubMed]
  62. Liu, H.; Du, T.; Li, C.; Yang, G. STAT3 phosphorylation in central leptin resistance. Nutr. Metab. 2021, 18, 39. [Google Scholar] [CrossRef] [PubMed]
  63. Murashita, K.; Uji, S.; Yamamoto, T.; Rønnestad, I.; Kurokawa, T. Production of recombinant leptin and its effects on food intake in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2008, 150, 377–384. [Google Scholar] [CrossRef] [PubMed]
Fishes 09 00362 g001
Figure 1. Effects of dietary N. japonica meal on the total protein (TP, (A)), triglycerides (TG, (B)), total cholesterol (TC, (C)), malondialdehyde (MDA, (D)), lysozyme (LZM, (E)), and albumin (ALB, (F)) in serum of tiger puffer. Data bars not sharing the same letter are significantly different (p < 0.05).
Figure 1. Effects of dietary N. japonica meal on the total protein (TP, (A)), triglycerides (TG, (B)), total cholesterol (TC, (C)), malondialdehyde (MDA, (D)), lysozyme (LZM, (E)), and albumin (ALB, (F)) in serum of tiger puffer. Data bars not sharing the same letter are significantly different (p < 0.05).
Fishes 09 00362 g001
Fishes 09 00362 g002
Figure 2. Effects of dietary N. japonica meal on the trypsin (A), chymotrypsin (B), lipase (C), total amylase (D), β-amylase (E), and α-amylase (F) activity in the intestine of tiger puffer. Data bars not sharing the same letter are significantly different (p < 0.05).
Figure 2. Effects of dietary N. japonica meal on the trypsin (A), chymotrypsin (B), lipase (C), total amylase (D), β-amylase (E), and α-amylase (F) activity in the intestine of tiger puffer. Data bars not sharing the same letter are significantly different (p < 0.05).
Fishes 09 00362 g002
Fishes 09 00362 g003
Figure 3. Effects of dietary N. japonica meal on the gene expression of peptide and amino acid transporters in the intestine of tiger puffer (A). Effects of dietary N. japonica meal on the gene expression of leptin and JAK-STAT signaling pathway in the liver and intestine of tiger puffer (B). Data bars not sharing the same letter are significantly different (p < 0.05).
Figure 3. Effects of dietary N. japonica meal on the gene expression of peptide and amino acid transporters in the intestine of tiger puffer (A). Effects of dietary N. japonica meal on the gene expression of leptin and JAK-STAT signaling pathway in the liver and intestine of tiger puffer (B). Data bars not sharing the same letter are significantly different (p < 0.05).
Fishes 09 00362 g003
Table 1. Proximate composition of N. japonica, fishmeal, FNM, and ONM used in this study (% dry matter).
Table 1. Proximate composition of N. japonica, fishmeal, FNM, and ONM used in this study (% dry matter).
IngredientMoistureCrude ProteinCrude LipidAsh
Fresh N. japonica88.77 (% wet weight)73.085.669.34
Fishmeal—71.049.04—
FNM—72.227.46—
ONM—72.317.62—
Table 2. Formulation and proximate composition of the five experimental diets (% dry matter).
Table 2. Formulation and proximate composition of the five experimental diets (% dry matter).
IngredientDiet
CONFNM3FNM6FNM9ONM6
Fishmeal 14037343134
Soybean meal 11212121212
Canola meal 255555
Cottonseed meal 255555
Brewer’s yeast 155555
FNM03690
ONM00006
Wheat flour 124.8824.8824.8824.8824.88
Mineral premix 10.50.50.50.50.5
Vitamin premix 111111
Monocalcium phosphate11111
Vitamin C0.20.20.20.20.2
Choline chloride0.20.20.20.20.2
Ethoxyquinoline0.020.020.020.020.02
Yttrium oxide0.10.10.10.10.1
Calcium propionate0.10.10.10.10.1
Fish oil22222
Soybean oil22222
Soybean lecithin 311111
Total100100100100100
Proximate composition
Crude protein41.1941.0941.2141.3541.20
Crude lipid6.116.436.626.355.93
Moisture4.536.396.006.857.22
Ash10.8610.6110.4110.1210.29
Gross energy MJ/kg21.9621.9222.2622.0822.21
1 Fish meal, soybean meal, brewer’s yeast, wheat flour, mineral premix, vitamin premix, were procured from Qingdao Surgreen Ocean Biological Feed Co., Ltd. (Qingdao, China). Generally, the vitamin premix contained retinyl acetate, vitamin D3, DL-α-tocopherol acetate, menadione nicotinamide bisulfite, thiamine, riboflavin, vitamin B6, cyanocobalamin, D-calcium pantothenate, niacinamide, folic acid, D-biotin, L-ascorbate-2-phosphate, inositol, betaine hydrochloride, yeast hydrolysate, and rice hull powder; the mineral premix contained ferrous sulfate, zinc sulfate, manganese sulfate, cupric sulfate, cobaltous chloride, sodium selenite, calcium iodate, and zeolite powder. 2 Canola meal and cottonseed meal were acquired from Qingdao Qihao Nutrition Technology Co., Ltd. (Qingdao, China). 3 The purity is 50%.
Table 3. Fatty acids composition of the five experimental diets, fishmeal, and N. japonica meals (% total fatty acids).
Table 3. Fatty acids composition of the five experimental diets, fishmeal, and N. japonica meals (% total fatty acids).
Fatty AcidDietIngredient
CONFNM3FNM6FNM9ONM6FMFNMONM
12:00.060.050.050.050.050.100.250.10
14:03.903.753.663.343.738.280.790.68
16:019.519.119.118.718.922.217.616.1
18:04.094.084.054.054.014.336.786.61
20:00.020.030.030.030.030.240.000.00
SFA27.527.126.926.226.735.125.423.5
16:1n-73.683.603.573.453.536.874.564.19
17:1n-70.280.290.270.250.270.430.230.22
18:1n-915.715.415.415.515.38.596.265.94
24:1n-90.030.030.030.030.030.070.711.18
MUFA19.719.319.319.219.116.011.811.5
18:2n-623.423.724.224.524.11.712.051.57
20:2n-60.210.270.260.260.290.291.341.52
20:4n-60.230.240.230.260.280.580.560.61
n-6 PUFA23.924.324.725.024.72.573.953.70
18:3n-32.482.532.512.492.490.721.170.85
20:5n-35.845.975.926.016.0913.56.2511.9
22:5n-30.760.820.880.930.901.711.572.75
22:6n-37.887.757.337.247.7116.41.582.12
n-3 PUFA17.017.116.716.717.232.310.617.6
n-3/n-60.710.700.670.670.7012.52.684.77
SFA: saturated fatty acids; MUFA: mono-unsaturated fatty acids; PUFA: poly-unsaturated fatty acids.
Table 4. Total amino acids composition of the five experimental diets, fishmeal and N. japonica meals (g/100 g, dry matter).
Table 4. Total amino acids composition of the five experimental diets, fishmeal and N. japonica meals (g/100 g, dry matter).
Amino AcidDietIngredient
CONFNM3FNM6FNM9ONM6FMFNMONM
Arginine2.182.542.482.623.133.474.304.33
Histidine1.311.351.221.361.312.581.231.23
Isoleucine1.571.631.601.701.672.652.472.60
Leucine2.752.892.822.892.904.484.244.30
Lysine2.612.692.622.682.695.074.204.23
Methionine0.740.690.680.700.691.531.231.24
Phenylalanine1.811.711.761.882.092.452.402.56
Threonine1.531.611.571.591.562.722.682.76
Valine1.811.851.811.901.862.992.572.72
EAA16.317.016.617.317.927.925.326.0
Alanine2.122.212.152.232.223.933.763.90
Aspartate3.483.663.583.653.615.665.615.94
Cysteine0.650.660.650.780.820.941.301.23
Glutamate6.426.846.696.886.798.269.459.86
Glycine2.022.152.112.172.163.654.064.06
Proline1.831.791.771.891.762.392.062.21
Serine1.541.631.581.581.552.252.612.61
Taurine0.740.690.690.820.620.940.420.46
Tyrosine1.271.301.241.361.491.942.172.21
NEAA20.120.920.521.421.030.031.532.5
TAA36.437.937.038.738.957.956.858.5
EAA: essential amino acids; NEAA: non-essential amino acids; TAA: total amino acids.
Table 5. Free amino acids composition of the five experimental diets, fishmeal and N. japonica meals (mg/100 g, dry matter).
Table 5. Free amino acids composition of the five experimental diets, fishmeal and N. japonica meals (mg/100 g, dry matter).
Amino AcidDiet Ingredient
CONFNM3FNM6FNM9ONM6FMFNMONM
Arginine80.3874.3382.3690.94156.986.82171.01200
Histidine203.8181.9165.5168.8187.9593.197.06124.7
Isoleucine27.0727.0429.3835.5640.9187.24179.7344.7
Leucine49.8750.2352.3562.7979.07151.2278.7658.4
Lysine53.7858.0465.5283.58118.5120.3441.6840.9
Methionine11.249.68012.6414.5616.5616.02113.9255.2
Phenylalanine63.9860.3461.9271.34109.6169.0210.8548.2
Threonine29.9530.6831.7338.0240.3769.22184.6285.2
Valine40.1341.8043.4252.9657.71121.2254.4436.1
EAA560.2534.1544.8618.6807.6141419324693
Alanine75.8380.7284.69101.9100.4207.1515.8698.9
Aspartate31.6733.2434.9544.6046.2935.63198.2333.4
Cysteine19.1517.9921.0623.9822.640.0000.0000.000
Glutamate86.1092.8793.90114.3108.3144.2483.5533.9
Glycine22.2626.9332.0841.2334.4466.52341.4353.0
Proline30.7934.3132.6938.6034.8060.49151.5141.5
Serine19.5722.8625.8733.9733.7349.70207.3296.7
Taurine274.9254.4226.1239.4246.4558.5206.3278.2
Tyrosine20.5218.5623.6127.8135.8973.90186.3374.5
NEAA580.8581.9574.9665.9662.9119622903010
TFAA114111161120128414712610 42227703
EAA: essential amino acids; NEAA: non-essential amino acids; TFAA: total free amino acids.
Table 6. Primer sequences used in this experiment.
Table 6. Primer sequences used in this experiment.
GenesPrimer Sequences (5′–3′)GenBank
pept-1F: CTATGGAATGCGAACCGTGCXM_029840270.180
R: GGTAGATGGTGGTGGCGAAA
eaat3F: CAGCATTACCGCAACAGTXM_011606495.2129
R: TCCACAGCCATTATCAGAGT
b0at1F: TGAGGGAGTGGAGGGAACGXM_003977426.3106
R: GAGCAGCATAACGAAGAAGAGG
pat1F: CAAGTGTTCCCACCATCTCAXM_029847254.1133
R: CAAGTTCACCGTCTGTTTCC
cat1F: TGGAAGGAGAGTCGTGGCTATXM_003967472.3174
R: TCTCTCTGGGATTCGCTCAC
y+lat2F: GGCATCTTTGTCTCCCCCAAXM_029846026.1144
R: CCCCGACTTGGTGATAGTGG
leptinF: GCTCGAACACCACTAAGGAAGNM_001032725.1
R: TCTCCACGTCCATTGCATCC
jak2F: AATGCTGGAGCAGCAACCTAXM_029837217.1
R: GAGTGACCAATCACGTCGCT
stat3F: CCCAAAGAGGAAGCGTTTGGXM_003964795.3
R: TCCCAGAGTTTGTGGGGGTA
ef1αF: TTGGAGGCATTGGAACTGTNM_001037873.186
R: GTTGACGGGAGCAAAGGT
β-actinF: GAGAGGGAAATCGTGCGTGAXM_003964421.3186
R: GAAGGATGGCTGGAAGAGGG
pept-1: oligopeptide transporter 1; eaat3: excitatory amino acid transporter 3; b0at1: neutral amino acid transporter; pat1: proton-coupled amino acid transporter 1; cat1: cationic amino acid transporter 1; y+lat2: neutral and basic amino acid transporter; jak2: Janus kinase 2; stat3: signal transducer and activator of transcription 3; ef1α: elongation factor 1 alpha; β-actin: beta actin; F: forward primer; R: reverse primer.
Table 7. Effects of dietary N. japonica meal on growth performance and somatic indices of juvenile tiger puffer.
Table 7. Effects of dietary N. japonica meal on growth performance and somatic indices of juvenile tiger puffer.
ParametersTreatmentp
CONFNM3FNM6FNM9ONM6
IBW (g)15.5 ± 0.1215.4 ± 0.0315.5 ± 0.0615.5 ± 0.0315.5 ± 0.040.351
FBW (g)62.7 ± 4.0266.6 ± 1.3159.3 ± 1.9364.5 ± 3.9959.2 ± 1.080.335
SR (%)70.0 ± 3.3371.7 ± 1.6776.7 ± 6.9478.9 ± 8.6871.1 ± 7.780.880
WG (%)305 ± 22.9334 ± 7.80282 ± 12.4315 ± 25.5282 ± 6.690.268
PDR (%)28.9 ± 1.4027.9 ± 1.1425.6 ± 1.2429.5 ± 1.6426.8 ± 2.920.566
PER0.73 ± 0.030.71 ± 0.030.64 ± 0.010.75 ± 0.030.69 ± 0.070.449
FI (%)2.45 ± 0.03 b2.65 ± 0.07 ab2.86 ± 0.02 a2.61 ± 0.05 ab2.57 ± 0.09 ab0.018
FCR1.41 ± 0.071.47 ± 0.081.66 ± 0.031.44 ± 0.061.59 ± 0.150.370
SGR (%/d)2.50 ± 0.102.62 ± 0.032.39 ± 0.062.54 ± 0.112.39 ± 0.030.262
HSI (%)10.3 ± 0.218.76 ± 0.959.65 ± 0.399.02 ± 0.439.86 ± 0.230.254
VSI (%)15.9 ± 0.6014.1 ± 0.9115.0 ± 0.3514.4 ± 0.4315.6 ± 0.460.172
K (g/cm3)5.03 ± 0.364.33 ± 0.124.66 ± 0.384.50 ± 0.144.68 ± 0.120.532
IBW: initial body weight. FBW: final body weight. Data in the same row not sharing the same superscript letter were significantly different (p < 0.05).
Table 8. Effects of dietary N. japonica meal on the proximate composition of juvenile tiger puffer liver and muscle (% wet weight).
Table 8. Effects of dietary N. japonica meal on the proximate composition of juvenile tiger puffer liver and muscle (% wet weight).
ParametersTreatmentp
CONFNM3FNM6FNM9ONM6
Whole fish
Crude protein16.1 ± 0.1116.1 ± 0.1016.2 ± 0.2616.1 ± 0.1815.9 ± 0.160.772
Crude lipid4.73 ± 0.424.18 ± 0.685.25 ± 0.385.25 ± 0.574.94 ± 0.800.695
Moisture76.0 ± 0.4776.4 ± 0.4775.5 ± 0.4776.1 ± 0.3176.0 ± 0.340.723
Crude ash2.31 ± 0.052.26 ± 0.052.22 ± 0.062.24 ± 0.062.20 ± 0.040.603
Muscle
Crude protein21.6 ± 2.0919.0 ± 0.2118.9 ± 0.1319.1 ± 0.1018.8 ± 0.060.254
Crude lipid2.44 ± 0.242.22 ± 0.032.09 ± 0.032.15 ± 0.052.17 ± 0.040.303
Moisture76.3 ± 2.3478.8 ± 0.2979.1 ± 0.1479.0 ± 0.1879.1 ± 0.190.330
Liver
Crude protein6.22 ± 0.295.88 ± 0.176.22 ± 0.216.15 ± 0.315.75 ± 0.140.527
Crude lipid47.0 ± 1.9444.0 ± 1.2747.4 ± 1.3747.6 ± 2.9147.5 ± 3.140.756
Moisture30.6 ± 1.2030.2 ± 2.5731.2 ± 1.1330.8 ± 0.9128.7 ± 0.880.788
Table 9. Effects of dietary N. japonica meal on the muscle fatty acids composition of tiger puffer (% total fatty acids).
Table 9. Effects of dietary N. japonica meal on the muscle fatty acids composition of tiger puffer (% total fatty acids).
Fatty AcidTreatmentp
CONFNM3FNM6FNM9ONM6
12:00.10 ± 0.000.08 ± 0.010.08 ± 0.010.10 ± 0.000.10 ± 0.000.069
14:00.51 ± 0.020.56 ± 0.020.53 ± 0.020.50 ± 0.040.57 ± 0.030.379
16:022.5 ± 0.3122.9 ± 0.1622.7 ± 0.4322.1 ± 0.5822.4 ± 0.170.584
18:07.74 ± 0.167.84 ± 0.137.90 ± 0.227.75 ± 0.237.65 ± 0.060.867
20:00.21 ± 0.010.21 ± 0.000.22 ± 0.010.48 ± 0.290.21 ± 0.010.533
SFA31.0 ± 0.4931.6 ± 0.2931.4 ± 0.5930.9 ± 0.6130.9 ± 0.170.762
16:1n-70.97 ± 0.041.01 ± 0.020.98 ± 0.050.98 ± 0.061.02 ± 0.010.861
17:1n-70.26 ± 0.000.27 ± 0.010.26 ± 0.010.32 ± 0.050.28 ± 0.000.423
18:1n-911.9 ± 0.1012.0 ± 0.0912.2 ± 0.3512.0 ± 0.3711.8 ± 0.090.873
24:1n-90.17 ± 0.020.15 ± 0.010.18 ± 0.000.19 ± 0.040.18 ± 0.010.676
MUFA13.3 ± 0.0613.5 ± 0.0913.6 ± 0.3813.5 ± 0.2613.3 ± 0.080.828
18:2n-618.0 ± 0.4918.6 ± 0.4118.0 ± 0.2817.9 ± 0.4018.9 ± 0.150.273
20:2n-60.83 ± 0.040.87 ± 0.010.88 ± 0.030.88 ± 0.030.94 ± 0.020.128
20:4n-60.18 ± 0.000.19 ± 0.010.17 ± 0.010.43 ± 0.240.18 ± 0.010.436
n-6 PUFA19.0 ± 0.5219.6 ± 0.4219.1 ± 0.3019.2 ± 0.4520.0 ± 0.160.351
18:3n-30.60 ± 0.040.70 ± 0.010.64 ± 0.050.67 ± 0.010.68 ± 0.060.433
20:5n-34.96 ± 0.104.84 ± 0.054.92 ± 0.174.77 ± 0.155.02 ± 0.040.544
22:5n-32.97 ± 0.102.92 ± 0.052.99 ± 0.103.00 ± 0.182.93 ± 0.050.975
22:6n-318.3 ± 0.7116.6 ± 0.417.4 ± 0.7916.7 ± 0.8916.7 ± 0.430.397
n-3 PUFA26.8 ± 0.5425.0 ± 0.4126.0 ± 1.0225.1 ± 1.0925.4 ± 0.450.478
n-3/n-61.42 ± 0.071.28 ± 0.051.36 ± 0.061.31 ± 0.071.27 ± 0.030.363
SFA: saturated fatty acids; MUFA: mono-unsaturated fatty acids; PUFA: poly-unsaturated fatty acids.
Table 10. Effects of dietary N. japonica meal on the muscle amino acid composition of tiger puffer (g/100 g, dry matter).
Table 10. Effects of dietary N. japonica meal on the muscle amino acid composition of tiger puffer (g/100 g, dry matter).
Amino AcidTreatmentp
CONFNM3FNM6FNM9ONM6
Arginine4.26 ± 0.404.43 ± 0.704.07 ± 0.184.43 ± 0.353.83 ± 0.460.851
Histidine1.50 ± 0.031.77 ± 0.211.44 ± 0.051.49 ± 0.081.68 ± 0.100.277
Isoleucine3.72 ± 0.044.07 ± 0.233.77 ± 0.113.68 ± 0.084.14 ± 0.400.472
Leucine5.55 ± 0.046.22 ± 0.515.42 ± 0.055.38 ± 0.086.15 ± 0.570.299
Lysine6.09 ± 0.086.76 ± 0.516.06 ± 0.025.93 ± 0.156.44 ± 0.280.259
Methionine2.00 ± 0.212.79 ± 0.312.16 ± 0.162.16 ± 0.042.56 ± 0.450.290
Phenylalanine5.68 ± 0.133.95 ± 0.364.78 ± 0.255.00 ± 0.444.23 ± 0.640.082
Threonine2.61 ± 0.033.03 ± 0.282.69 ± 0.212.53 ± 0.013.12 ± 0.310.249
Valine4.84 ± 0.044.35 ± 0.104.39 ± 0.354.33 ± 0.394.38 ± 0.410.739
EAA36.2 ± 0.6137.4 ± 2.1834.8 ± 0.7634.9 ± 1.3336.5 ± 1.980.719
Alanine4.15 ± 0.014.42 ± 0.254.05 ± 0.044.01 ± 0.024.68 ± 0.540.398
Aspartate6.02 ± 0.056.54 ± 0.476.04 ± 0.275.87 ± 0.036.75 ± 0.410.265
Cysteine0.00 ± 0.001.35 ± 0.741.14 ± 1.141.27 ± 1.271.93 ± 0.970.694
Glutamate9.23 ± 0.0710.7 ± 0.989.40 ± 0.299.03 ± 0.0611.0 ± 1.010.180
Glycine3.54 ± 0.023.91 ± 0.233.51 ± 0.133.51 ± 0.034.54 ± 0.670.180
Proline1.95 ± 0.042.46 ± 0.421.96 ± 0.021.98 ± 0.052.21 ± 0.100.334
Serine2.26 ± 0.022.69 ± 0.222.28 ± 0.122.18 ± 0.042.68 ± 0.270.141
Taurine0.86 ± 0.021.09 ± 0.100.91 ± 0.070.84 ± 0.080.99 ± 0.110.268
Tyrosine3.16 ± 0.063.68 ± 0.512.79 ± 0.093.01 ± 0.104.19 ± 0.460.061
NEAA31.2 ± 0.0736.8 ± 3.6332.1 ± 1.9431.7 ± 1.2338.9 ± 4.210.226
TAA67.4 ± 0.6874.2 ± 5.6966.9 ± 1.3966.6 ± 0.8475.5 ± 4.880.252
EAA: essential amino acids; NEAA: non-essential amino acids; TAA: total amino acids.
Table 11. Effects of dietary N. japonica meal on the muscle free amino acids composition of tiger puffer (mg/100 g, dry matter).
Table 11. Effects of dietary N. japonica meal on the muscle free amino acids composition of tiger puffer (mg/100 g, dry matter).
Amino AcidTreatmentp
CONFNM3FNM6FNM9ONM6
Arginine66.6 ± 14.175.6 ± 6.9088.0 ± 14.276.6 ± 13.475.3 ± 4.530.772
Histidine10.7 ± 1.4111.8 ± 1.3711.6 ± 1.4512.0 ± 2.7911.4 ± 0.390.980
Isoleucine7.42 ± 0.387.30 ± 0.927.75 ± 0.807.14 ± 0.447.15 ± 0.180.948
Leucine9.67 ± 0.189.55 ± 0.8410.1 ± 0.549.62 ± 0.489.26 ± 0.450.888
Lysine256 ± 35.7289 ± 15.1296 ± 15.3274 ± 39.3256 ± 15.60.739
Methionine23.4 ± 0.1223.7 ± 0.9825.9 ± 0.8925.2 ± 0.6123.4 ± 0.030.070
Phenylalanine13.7 ± 0.8315.7 ± 1.3513.1 ± 1.1311.9 ± 0.9711.6 ± 1.230.151
Threonine62.2 ± 10.472.2 ± 6.9762.8 ± 5.7963.9 ± 4.9868.0 ± 4.500.821
Valine28.5 ± 2.8328.8 ± 1.1627.2 ± 5.2426.9 ± 1.5727.0 ± 2.560.985
EAA478 ± 63.4534 ± 30.5543 ± 37.0508 ± 49.5489 ± 14.90.782
Alanine120 ± 6.27112 ± 14.0110 ± 1.79118 ± 9.64124 ± 9.010.831
Aspartate16.8 ± 2.0519.0 ± 2.5916.3 ± 1.1516.2 ± 0.6517.0 ± 1.270.768
Cysteine14.9 ± 0.5714.7 ± 2.1815.9 ± 1.0315.1 ± 0.8315.3 ± 1.810.978
Glutamate28.8 ± 4.2431.3 ± 2.2833.9 ± 1.1930.4 ± 3.1134.8 ± 1.670.533
Glycine191 ± 10.0163 ± 4.63193 ± 5.62207 ± 27.6189 ± 6.430.323
Proline33.4 ± 8.7853.2 ± 11.236.3 ± 5.4638.2 ± 8.1040.3 ± 7.540.542
Serine17.3 ± 1.2212.4 ± 0.3613.7 ± 1.2217.7 ± 3.6514.2 ± 2.380.360
Taurine1085 ± 12.41053 ± 34.41043 ± 6.121029 ± 52.1966.0 ± 50.20.284
Tyrosine7.60 ± 0.417.05 ± 0.897.28 ± 0.708.09 ± 0.557.05 ± 0.700.780
NEAA1515 ± 6.191466 ± 41.91470 ± 5.601479 ± 19.51408 ± 29.30.115
TFAA1993 ± 62.92000 ± 45.72012 ± 37.11987 ± 60.51897 ± 27.70.498
EAA: essential amino acids; NEAA: non-essential amino acids; TFAA: total free amino acids.
Table 12. Effects of dietary N. japonica meal on the muscle texture of juvenile tiger puffer.
Table 12. Effects of dietary N. japonica meal on the muscle texture of juvenile tiger puffer.
ParametersTreatmentp
CONFNM3FNM6FNM9ONM6
Hardness (N)3.36 ± 0.852.85 ± 0.412.91 ± 0.663.12 ± 0.073.04 ± 0.770.978
Adhesiveness (mJ)0.03 ± 0.010.03 ± 0.000.03 ± 0.000.03 ± 0.000.03 ± 0.000.968
Cohesiveness (Ratio)0.40 ± 0.020.36 ± 0.040.40 ± 0.020.37 ± 0.010.36 ± 0.040.737
Springiness (mm)1.17 ± 0.051.31 ± 0.041.13 ± 0.141.18 ± 0.131.35 ± 0.070.466
Gumminess (N)1.33 ± 0.311.00 ± 0.161.19 ± 0.281.18 ± 0.071.13 ± 0.360.924
Chewiness (mJ)1.63 ± 0.451.3 ± 0.231.52 ± 0.511.48 ± 0.211.71 ± 0.700.974
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gao, Q.; Fan, Y.; Zhang, R.; Fang, J.; Ma, Q.; Wei, Y.; Liang, M.; Liu, F.; Xu, H. Effect of Low-Proportion Replacement of Dietary Fishmeal with Neanthes japonica Meal on Growth Performance, Body Composition, Muscle Texture, Serum Biochemistry, Digestive Enzymes and Gene Expression in Juvenile Tiger Puffer Takifugu rubripes. Fishes 2024, 9, 362. https://doi.org/10.3390/fishes9090362

AMA Style

Gao Q, Fan Y, Zhang R, Fang J, Ma Q, Wei Y, Liang M, Liu F, Xu H. Effect of Low-Proportion Replacement of Dietary Fishmeal with Neanthes japonica Meal on Growth Performance, Body Composition, Muscle Texture, Serum Biochemistry, Digestive Enzymes and Gene Expression in Juvenile Tiger Puffer Takifugu rubripes. Fishes. 2024; 9(9):362. https://doi.org/10.3390/fishes9090362

Chicago/Turabian Style

Gao, Qingyan, Yuhan Fan, Renxiao Zhang, Jinghui Fang, Qiang Ma, Yuliang Wei, Mengqing Liang, Feng Liu, and Houguo Xu. 2024. "Effect of Low-Proportion Replacement of Dietary Fishmeal with Neanthes japonica Meal on Growth Performance, Body Composition, Muscle Texture, Serum Biochemistry, Digestive Enzymes and Gene Expression in Juvenile Tiger Puffer Takifugu rubripes" Fishes 9, no. 9: 362. https://doi.org/10.3390/fishes9090362

APA Style

Gao, Q., Fan, Y., Zhang, R., Fang, J., Ma, Q., Wei, Y., Liang, M., Liu, F., & Xu, H. (2024). Effect of Low-Proportion Replacement of Dietary Fishmeal with Neanthes japonica Meal on Growth Performance, Body Composition, Muscle Texture, Serum Biochemistry, Digestive Enzymes and Gene Expression in Juvenile Tiger Puffer Takifugu rubripes. Fishes, 9(9), 362. https://doi.org/10.3390/fishes9090362

Article Metrics

Back to TopTop