Next Article in Journal
Investigations on Target Strength Estimation Methods: A Case Study of Chub Mackerel (Scomber japonicus) in the Northwest Pacific Ocean
Next Article in Special Issue
Effects of Dietary L-glutamic acid on the Growth Performance, Gene Expression Associated with Muscle Growth-Related Gene Expression, and Intestinal Health of Juvenile Largemouth Bass (Micropterus salmoides)
Previous Article in Journal
Blue Economy Financing Solutions for the Fisheries and Aquaculture Sectors of Caribbean Island States
Previous Article in Special Issue
Effect of Dietary Supplementation on the Growth and Immunity of Fish and Shellfish
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Dietary Glutamate on the Growth Performance and Antioxidant Capacity of Juvenile Chinese Mitten Crab (Eriocheir sinensis)

College of Life Science, Huzhou University, Huzhou 313000, China
*
Authors to whom correspondence should be addressed.
Fishes 2024, 9(8), 306; https://doi.org/10.3390/fishes9080306
Submission received: 16 May 2024 / Revised: 19 July 2024 / Accepted: 28 July 2024 / Published: 3 August 2024

Abstract

In order to explore the effects of glutamate on the growth performance, antioxidant capacity and protein metabolism of juvenile Chinese mitten crab, 0%, 1% and 2% glutamate were supplemented to low protein (30%) and normal protein (35%) diets, respectively. There were 5 parallel tanks in each treatment, and the feeding duration was 8 weeks. The results showed that dietary glutamate did not significantly affect the weight gain of Chinese mitten crab. Diets supplemented with 2% glutamate significantly decreased the crude protein of crabs. The T-AOC of crabs fed the 30% protein diets was significantly lower than crabs fed the 35% protein diets. At 30% protein level, the superoxide dismutase (SOD) activity significantly increased with the increase in glutamate content. Dietary glutamate significantly down-regulated the relative expressions of mTOR, PI3K, S6K1 and 4EBP at 35% protein level. In conclusion, dietary glutamate cannot significantly increase the growth of Chinese mitten crab, but it can improve the antioxidant capacity in Chinese mitten crab under low protein conditions.
Key Contribution: Dietary glutamate can improve the antioxidant capacity in Chinese mitten crab fed with low protein diet.

1. Introduction

Glutamate is a functional amino acid, which plays an important physiological role in the growth of animals [1,2,3]. Glutamate is the main source of energy for animals as it is an intermediate in the metabolism of amino acids [4,5]. Therefore, dietary supplementation with glutamate can improve the growth performance of animals. It has been reported that 1.5% dietary glutamate effectively improved the weight gain of Atlantic salmon [6]. Some similar studies were widely reported in tilapia and salmon, or other fish species [7,8]. In addition, glutamate can promote protein synthesis, thereby improving the efficiency of protein utilization in animals [9,10]. It has been reported that dietary glutamate improved the protein retention in godhead bream [11]. Glutamate occupies a central position in the metabolism of amino acids, although it is a non-essential amino acid [12,13]. Diets supplemented with an appropriate amount of non-essential amino acids can save the catabolism of some essential amino acids and improve feed utilization [14]. When there is insufficient protein in the diet or amino acid imbalance, alanine, glutamate, glutamine and aspartate in the gut of mice are preferentially used as energy substrates [15,16]. For example, juvenile herring preferentially use glutamate as an energy substrate, thereby saving the consumption of essential amino acids for protein synthesis [4]. Therefore, dietary supplementation with glutamate can improve growth performance and save dietary protein in fish and mammals.
Glutamate is also the metabolic precursor of glutathione, which is the biologically active molecule [3], so it plays an important role in antioxidant capacity [17]. Some studies have reported that dietary glutamate can provide materials for glutathione synthesis [18,19]. In addition, glutamine-derived glutamate can be converted to glutamate-γ-semialdehyde under the catalysis of dihydropyrrole-5-carboxylic acid synthase, which spontaneously generates dihydropyrrole-5-carboxylic acid and degrades to proline [20]. Proline has been reported to eliminate free radicals, which can improve the antioxidant capacity of animals [21]. Moreover, glutamate can increase the activities of several antioxidant enzymes in animals [22]. A study reported that dietary glutamate reduced the activity of plasma alanine aminotransferase (ALT) and up-regulated the expression of antioxidation-related genes in Atlantic salmon (Salmo salar L.), indicating that glutamate has a positive effect on the antioxidant capacity and liver health of Atlantic salmon [6]. Similarly, glutamate increased the activities of SOD, GPX, and GST in muscle of Cyprinus carpio var. Jian, thereby reducing muscle lipid peroxidation and improving muscle quality [23]. However, most studies have focused on mammals or fish, and this has not been reported in crustaceans.
In recent years, with the rapid development of aquaculture, feed protein resources such as fish meal and soybean meal have become increasingly scarce and their prices have been rising [24,25]. How to reduce the amount of feed protein and improve protein utilization is an important direction to maintain the sustainable development of aquaculture. Dietary protein deficiency can result in a large number of essential amino acids being used for the synthesis of non-essential amino acids, and thereby reducing utilization efficiency [26,27]. Therefore, this study aimed to investigate the effects of glutamate on the growth performance and antioxidant capacity of juvenile Chinese mitten crab Eriocheir sinensis fed with low protein diets or normal protein diets.

2. Materials and Methods

2.1. Experimental Diets

Six experimental diets were formulated by gradient supplementation, in which 0%, 1% and 2% glutamate were supplemented to low protein (30%) and normal protein (35%) diets, respectively. The formulation and proximate composition of the experimental diets are shown in Table 1.
The ingredients were finely ground using a pulverizer (2500Y, Anhui Hualing Xichu Equipment Co., Ltd., Anhui, China). Thereafter, the crushed ingredients were sieved using a 60-mesh strainer (Huafeng Hardware Instrument Co., Ltd., Zhejiang, China). The ingredients were weighed according to the formula and mixed adequately. Then, distilled water was added into the mixed ingredients. Subsequently, the dough was pelleted using a screw-press pelletizer (F-26, South China University of Technology, Guangzhou, China). Finally, the diets were oven-dried and stored at −20 °C.

2.2. Feeding Trial and Sampling

All experiments on animals were approved by the Committee on the Ethics of Animal Experiments in Huzhou University and the Care and Use of Laboratory Animals in China. Juvenile crabs were obtained from a farm in Huzhou. Crabs were acclimatized to the experimental conditions in 300 L tanks (100 × 80 × 60 cm) before the feeding trial. A total of 600 female crabs (0.4 ± 0.01 g, mean ± SE) were weighed and put into 30 tanks (100 × 80 × 60 cm). Each treatment used a set of four parallel tanks, each tank containing 20 crabs. To improve the survival of crabs, three folded plastic nets were placed in each tank as shelters. The experimental crabs were fed twice daily at a ratio of 4% body weight (6:00 and 18:00, respectively). After feeding, 30% tank water was exchanged daily. During the feeding trial, the dissolved oxygen concentration of the experimental water was >7 mg/L. The water temperature was maintained at 25 °C to 27 °C, and ammonia nitrogen was <0.05 mg/L.
After a 56-d feeding trial, crabs were euthanized, and five crabs were sampled randomly from each tank for proximate nutrient composition. Where after, six crabs were sampled randomly and the hepatopancreases were frozen in liquid nitrogen and kept in an ultra-low temperature freezer (MD-86L456, Midea Group, Guangdong, China) for enzyme activity, gene expression and nutrient composition analyses.
Weight gain, specific growth rate and hepatopancreas index of crabs were calculated according to the formulas below:
Weight gain (WG, %) = 100 × (final crab weight − initial crab weight)/initial crab weight
Specific growth rate (SGR, %) = 100 × (LN final crab weight − LN initial crab weight)/days
Hepatopancreas index (%) = 100 × hepatopancreas weight of crab/whole crab weight

2.3. Chemical Composition Analysis

The proximate nutrient compositions of diets and crabs were estimated using the methods described as AOAC [28]. Firstly, the moisture of diets and crabs was measured by drying 8 h at 105 °C in an oven. After drying, the crude protein contents of diets and crabs were measured using the kjeldah method (Kjeltec™ 8200, Foss, Hoganas, Sweden). The crude lipid content of diets and crabs were analyzed using the Soxhlet extraction method (1000 mL, Fujian minbo toughened glass Co., Ltd., Fujian, China). Finally, the ash contents of diets and crabs were analyzed by ashing the samples at 550 °C for 6 h in a muffle furnace (PCD-E3000 Serials, Peaks, Japan). Four duplicate samples were analyzed for each treatment (n = 4).

2.4. Analysis of Biochemical Parameters in the Hepatopancreas

The biochemical parameters were analyzed using commercial assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The information for each kit is listed as follows: total antioxidant capacity (T-AOC; Cat. No. A015-2), superoxide dismutase (SOD; Cat. No. A001-1), glutathione peroxidase (GPX; Cat. No. A005-1-2), glutathione S-transferase (GST; Cat. No. A004-1-1), pyruvate (Pyruvate; Cat. No. A081-1-1), glutaminase (GLS; Cat. No.A124-1-1), glutamine synthetase (GS; Cat. No. A047-1-1), glutamate dehydrogenase (GDH; Cat. No. A125-1-1). Four duplicate samples were analyzed for each treatment (n = 4).

2.5. Analysis of Gene Expression

Total RNA was extracted from the hepatopancreas using the (RNAiso Plus, Takara, Japan). The total RNA concentration of each sample was measured using a Nano Drop 2000 (Thermo, USA). The samples were reverse transcribed using a commercial kit (PrimeScript™ RT master, Takara, Japan). The primers were designed based on the transcriptome sequencing and NCBI data base (Table 2). The RT–PCR amplification reactions were performed using a CFX96 Real-Time PCR system (Bio-rad, Richmond, CA, USA). PCR conditions were set according to the instruction from commercial kits (SYBR Premix, Takara, Japan). The relative gene expressions were calculated by geometric averaging of multiple internal control genes (β-actin and glyceraldehyde-phosphate dehydrogenase (GAPDH)) [29]. Four duplicate samples were analyzed for each treatment (n = 4).

2.6. Statistical Analysis

Statistical analysis was performed using SPSS 26.0 for Windows (SPSS, Michigan Avenue, Chicago, IL, USA). Two-way ANOVA was used to determine if there was any interaction between dietary protein level and glutamate level. At the same glutamate level, independent-samples T test was used to determine significant differences between crabs cultivated at different protein levels. At the same protein condition, one-way ANOVA was used to analyze the significant differences among crabs fed the diets with different glutamate levels. Significance was set at p < 0.05.

3. Results

3.1. Growth Performance

As showed in the Table 3. At 30% protein level, diets supplemented with 1% and 2% glutamate slightly increased the weight gain (WG) and specific growth rate (SGR) of crabs (p > 0.05). However, at 35% protein level, the WG and SGR of crabs significantly decreased with the increasing dietary glutamate, and the WG and SGR of crabs fed the 2% glutamate diet was significantly lower than that of the control crabs (p < 0.05). At 30% protein level, the hepatopancreas index (HSI) of crabs fed the 1% glutamate was significantly higher than that of crabs fed the diets containing 0% and 2% glutamate (p < 0.05). At the 35% protein level, dietary glutamate did not significantly affect the HSI of crabs (p > 0.05). There were no significant interactions between dietary protein level and glutamate levels based on the WG, SGR and HSI (p > 0.05).

3.2. Nutrient Composition of Crabs

As shown in Table 4, dietary glutamate did not significantly affect the moisture, ash, and crude lipid of crabs fed with diets for both 30% and 35% protein levels (p > 0.05). There was a significant main effect of dietary glutamate on crude protein content (p < 0.05). At 30% protein level, the crude protein content of crabs fed the 2% glutamate diets was significantly higher than that of crabs fed the diets containing 0% and 1% glutamate (p < 0.05). At 35% protein level, the crude protein content of crabs fed the 0% glutamate diets was significantly higher than that of crabs fed diets containing 2% glutamate (p < 0.05).

3.3. The Actiities of Enzymes Related to Antioxidant Capacity in the Hepatopancreas

Dietary glutamate did not significantly affect the total antioxidant capacity (T-AOC) of crabs fed with the diets under both 30% and 35% protein levels (p > 0.05; Figure 1A). However, the crude protein content of diets has a significant main effect on the T-AOC (p < 0.05; Figure 1A). The T-AOC of crabs fed the 30% protein diets was significantly lower than that of crabs fed the 35% protein diets (p < 0.05; Figure 1A). At 30% protein level, the superoxide dismutase (SOD) activity significantly increased with the increase in glutamate content (p < 0.05; Figure 1B) but, at 35% protein level, dietary glutamate did not significantly affect the SOD of crabs (p > 0.05). Under the 2% glutamate condition, the SOD activity in the hepatopancreas of crabs fed 30% protein was significantly higher than that of crabs fed 35% protein (p < 0.05; Figure 1B). At 30% protein level, the glutathione peroxidase (GPX) and glutathione S-transferase (GST) of crabs fed the 1% glutamate diets were significantly lower than those of crabs fed the 0% and 2% glutamate diets (p < 0.05; Figure 1C,D). At 35% protein level, dietary glutamate did not significantly affect the activities of GPX and GST (p > 0.05; Figure 1C).

3.4. The Amino Acid Metabolism in the Hepatopancreas

Dietary glutamate did not significantly affect the pyruvate, glutamine synthetase and glutamate dehydrogenase of crabs fed with the diets under both 30% and 35% protein levels (p > 0.05; Figure 2A,C,D). However, the crude protein content of diets has a significant main effect on the pyruvate (p < 0.05, Figure 2A). At 30% protein level, the activity of glutaminase was significantly higher in crabs fed the 1% glutamate diets (p < 0.05; Figure 2B). At 35% protein level, dietary glutamate did not affect the activity of glutaminase (p > 0.05; Figure 2B).

3.5. Protein Metabolism in the Hepatopancreas

At 30% protein level, dietary glutamate did not affect the relative expressions of mTOR, S6K1 and 4EBP (p > 0.05; Figure 3A,C,D). However, at 35% protein level, dietary glutamate significantly down-regulated the relative expressions of mTOR, PI3K, S6K1 and 4EBP (p < 0.05; Figure 3A–D). At 30% protein level, dietary glutamate significantly down-regulated the relative expressions of PI3K (p < 0.05; Figure 3B). The crude protein content of diets has a significant main effect on the relative expressions of 4EBP (p < 0.05; Figure 3D). The relative expressions of 4EBP of crabs fed the 30% protein diets was significantly lower than that of crabs fed the 35% protein diets (p < 0.05; Figure 3D).

4. Discussion

Glutamate plays an important physiological role in the growth of animals [1,2,3]. Some previous studies reported that dietary glutamate can improve the weight gain of fish [6,7,8]. However, in the present study, dietary glutamate did not significantly affect the weight gain and specific growth rate. Moreover, dietary glutamate significantly decreased the growth of Chinese mitten crab. This result was different from that for grass carp [30], golden head snapper [11] and Atlantic salmon [6]. Moreover, a previous study in weaned piglet reported that dietary supplementation with more than 3.2% glutamate reduced growth performance and presented a toxicity effect [30]. On the other hand, dietary excessive concentrations of sodium glutamate caused intestinal mucosa stress in fish [31]. The differences may be caused by species specificity. Unfortunately, it is difficult to find an article on glutamate toxicity effects in crustaceans. Therefore, it is necessary to further study the toxic effect of glutamate in shrimp and crab. Some previous studies reported that glutamate can significantly increase the hepatosomic index of aquatic animals [7]. Similar results were also found in the present study, where 1% glutamate supplemented to a diet with 30% protein level significantly increased the hepatopancreas index of juvenile Chinese mitten crab. Growth is closely related to the accumulation of nutrients in animals. A study reported that dietary glutamate increased the crude lipid content in the gold head snapper (Sparus aurata) [11]. It has also been reported that dietary glutamate can improve protein content and lipid content in grass carp (Ctenopharyngodon idella) [32]. In the present study, dietary glutamate did not significantly affect the moisture, ash, and crude lipid of crabs fed with the diets under both 30% and 35% protein levels. Even worse, 2% glutamate significantly decreased the crude protein of Chinese mitten crab. The differences may be caused by species specificity. Unfortunately, glutamate has been poorly studied in crustaceans. Therefore, the expression of genes involved in protein synthesis in the hepatopancreas of the crab was further investigated in the present study. The results indicated that dietary glutamate significantly down-regulated the relative expressions of mTOR, PI3K, S6K1 and 4EBP of crabs fed the diets containing 35% protein, which indicated that dietary glutamate inhibits protein synthesis by inhibiting the mTOR pathway in Chinese mitten crab. These results were consistent with those of body composition. In summary, dietary glutamate decreased the growth and protein content of Chinese mitten crab by regulating the mTOR pathway.
Previous studies have demonstrated that a low protein diet can lead to oxidative stress in Chinese mitten crabs [33]. In the present study, the T-AOC of crabs fed the 30% protein diets was significantly lower than that of crabs fed the 35% protein diets, which is consistent with other studies. GSH–PX and GSH–ST are required by the endogenous antioxidant defense system to scavenge oxygen free radicals and maintain cellular redox balance [34]. In the present study, dietary glutamate did not significantly affect the GSH–PX and GSH–ST, which indicated that glutamate did not improve the GSH enzyme system. However, SOD activity significantly increased with the increase of glutamate content. This result indicated that dietary glutamate could improve the activity of SOD, thereby increasing the antioxidant capacity in Chinese mitten crab under low protein conditions.

5. Conclusions

Dietary glutamate cannot significantly increase the growth of Chinese mitten crab, but it can decrease the growth and protein content of Chinese by regulating the mTOR pathway. However, dietary glutamate can improve the activity of SOD, thereby increasing the antioxidant capacity in Chinese mitten crab under low protein conditions.

Author Contributions

J.Z., writing—original draft and editing, Y.H., writing—review and editing. M.S., writing—review and editing. L.J., writing—review and editing. Y.X., writing—review and editing. Y.T., writing—review and editing. C.Q., supervision. J.Y., supervision. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by grants from the Zhejiang Province R&D Plan (2022C02058), Zhejiang Provincial Natural Science Foundation of China under Grant No. LTGN23C190003, and the Huzhou Natural Science Foundation (2021YZ14) and the Graduate Research Innovation Project of Huzhou University (2023KYCX68).

Institutional Review Board Statement

All experiments on animals were approved by the Committee on the Ethics of Animal Experiments in Huzhou University and the Care and Use of Laboratory Animals in China. approval code: 20220701; approval date: 20 July 2022.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Brosnan, J.T.; Brosnan, M.E. Glutamate: A truly functional amino acid. Amino Acids 2013, 45, 413–418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Lallès, J.P.; Bosi, P.; Smidt, H.; Stokes, C.R. Weaning—A challenge to gut physiologists. Livest. Sci. 2007, 108, 82–93. [Google Scholar] [CrossRef] [Scilit]
  3. Burrin, D.G.; Stoll, B. Metabolic fate and function of dietary glutamate in the gut. Am. J. Clin. Nutr. 2009, 90, 850–856. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Conceio, L.E.C.; Rnnestad, I.; Tonheim, S.K. Metabolic budgets for lysine and glutamate in unfed herring (Clupea harengus) larvae. Aquaculture 2002, 206, 305–312. [Google Scholar] [CrossRef] [Scilit]
  5. Van Waarde, A. Aerobic and anaerobic ammonia production by fish. Comp. Biochem. Physiol. B 1983, 74, 675–684. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Larsson, T.; Koppang, E.O.; Espe, M.; Terjesen, B.F.; Krasnov, A.; Moreno, H.M.; Rørvik, K.A.; Thomassen, M.; Mørkøre, T. Fillet quality and health of Atlantic salmon (Salmo salar L.) fed a diet supplemented with glutamate. Aquaculture 2014, 426, 288–295. [Google Scholar] [CrossRef] [Scilit]
  7. Oehme, M.; Grammes, F.; Takle, H.; Zambonino-Infante, J.L.; Refstie, S.; Thomassen, M.S.; Rørvik, K.-A.; Terjesen, B.F. Dietary supplementation of glutamate and arginine to Atlantic salmon (Salmo salar L.) increases growth during the first autumn in sea. Aquaculture 2010, 310, 156–163. [Google Scholar] [CrossRef] [Scilit]
  8. Silva, L.C.R.D.; Furuya, W.M.; Natali, M.R.M.; Schamber, C.R.; Santos, L.D.D.; Vidal, L.V.O. Productive performance and intestinal morphology of Nile tilapia juvenile fed diets with L-glutamine and L-glutamate. Rev. Bras. Zootec. 2010, 39, 1175–1179. [Google Scholar] [CrossRef] [Scilit]
  9. Maclennan, P.A.; Brown, R.; Rennie, M.J. A positive relationship between protein synthetic rate and intracellular glutamine concentration in perfused rat skeletal muscle. FEBS Lett. 1987, 215, 187–191. [Google Scholar] [CrossRef] [Scilit]
  10. Coffier, M.S.; Claeyssens, S.; Hecketsweiler, B.; Lavoinne, A.; Ducrotté, P.; Déchelotte, P. Enteral glutamine stimulates protein synthesis and decreases ubiquitin mRNA level in human gut mucosa. Am. J. Physiol.-Gastrointest. Liver Physiol. 2003, 285, G266–G273. [Google Scholar] [CrossRef] [Scilit]
  11. Caballero-Solares, A.; Viegas, I.; Salgado, M.C.; Siles, A.M.; Saez, A.; Metón, I.; Baanante, I.V.; Fernández, F. Diets supplemented with glutamate or glutamine improve protein retention and modulate gene expression of key enzymes of hepatic metabolism in gilthead seabream (Sparus aurata) juveniles. Aquaculture 2015, 444, 79–87. [Google Scholar] [CrossRef] [Scilit]
  12. Brosnan, M.E.; Brosnan, J.T. Hepatic glutamate metabolism: A tale of 2 hepatocytes. Am. J. Clin. Nutr. 2009, 90, 857–861. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Wu, G. Functional amino acids in growth, reproduction, and health. Adv. Nutr. 2010, 1, 31–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Abboudi, T.; Mambrini, M.; Larondelle, Y.; Rollin, X. The effect of dispensable amino acids on nitrogen and amino acid losses in Atlantic salmon (Salmo salar) fry fed a protein-free diet. Aquaculture 2009, 65, 345–353. [Google Scholar] [CrossRef] [Scilit]
  15. Tanaka, H.; Shibata, K.; Mori, M.; Ogura, M. Metabolism of essential amino acids in growing rats at graded levels of soybean protein isolate. J. Nutr. Sci. Vitaminol. 1995, 41, 433–443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Nakamura, H.; Kawamata, Y.; Kuwahara, T.; Torii, K.; Sakai, R. Nitrogen in dietary glutamate is utilized exclusively for the synthesis of amino acids in the rat intestine. Am. J. Physiol.-Endocrinol. Metab. 2013, 304, E100–E108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Espinosa, D.C.; Miguel, V.; Mennerich, D.; Kietzmann, T.; Sánchez-Pérez, P.; Cadenas, S.; Lamas, S. Antioxidant responses and cellular adjustments to oxidative stress. Redox Biol. 2015, 6, 183–197. [Google Scholar] [CrossRef] [PubMed]
  18. He, L.; Wu, J.; Tang, W.; Zhou, X.; Lin, Q.; Luo, F.; Yin, Y.; Li, T. Prevention of oxidative stress by α-ketoglutarate via activation of CAR signaling and modulation of the expression of key antioxidant-associated targets in vivo and in vitro. J. Agric. Food Chem. 2018, 66, 11273–11283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Cai, G.Y. Effect of Glutamate on Antioxoidant Level and Subseouent Development of In Vitro Cultured Mouse Embryos in the Blocking Stage. Master’s Thesis, Yanbian University, Yanji, China, 2017. (In Chinese) [Google Scholar]
  20. Fujita, T.; Yanaga, K. Association between glutamine extraction and release of citrulline and glycine by the human small intestine. Life Sci. 2007, 80, 1846–1850. [Google Scholar] [CrossRef] [Scilit]
  21. Kaul, S.; Sharma, S.S.; Mehta, I.K. Free radical scavenging potential of L-proline: Evidence from in vitro assays. Amino Acids 2008, 34, 315–320. [Google Scholar] [CrossRef] [Scilit]
  22. Meister, A. Glutathione-ascorbic acid antioxidant system in animals. J. Biol. Chem. 1994, 269, 9397–9402. [Google Scholar] [CrossRef] [Scilit]
  23. Zhao, Y.; Li, J.-Y.; Yin, L.; Feng, L.; Liu, Y.; Jiang, W.-D.; Wu, P.; Zhao, J.; Chen, D.-F.; Zhou, X.-Q.; et al. Effects of dietary glutamate supplementation on flesh quality, antioxidant defense and gene expression related to lipid metabolism and myogenic regulation in Jian carp (Cyprinus carpio var. Jian). Aquaculture 2019, 502, 212–222. [Google Scholar] [CrossRef] [Scilit]
  24. Canton, H. The Europa Directory of International Organizations 2021, 23rd ed.; Routledge: London, UK, 2021; pp. 297–305. [Google Scholar]
  25. Tao, S.; Zhang, Q.; Zhang, J. Feed market situation, prospect and countermeasures in 2021. Chin. J. Anim. Sci. 2022, 86, 45–49. (In Chinese) [Google Scholar]
  26. Huang, J.; Deng, H. Effects of low protein diet on nutrient digestion and nitrogen emission of growing pigs. Livest. Poult. Inventory 2017, 45, 21–28. (In Chinese) [Google Scholar]
  27. Gloaguen, M.; Floc’H, N.L.; Corrent, E.; Primot, Y.; Milgen, J.V. The use of free amino acids allows formulating very low crude protein diets for piglets. J. Anim. Sci. 2014, 92, 637–641. [Google Scholar] [CrossRef] [Scilit]
  28. AOAC. Official Methods of Analysis of AOAC International; Association of Official Analytical Chemists: Washington, DC, USA, 2005. [Google Scholar]
  29. Vandesompele, J.; Preter, K.D.; Pattyn, F.; Poppe, B.; Roy, N.V.; Paepe, A.D.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Li, Y.; Han, H.; Yin, J.; Zheng, J.; Zhu, X.; Li, T.; Yin, Y. Effects of glutamate and aspartate on growth performance, serum amino acids, and amino acid transporters in piglets. Food Agric. Immunol. 2018, 54, 675–687. [Google Scholar] [CrossRef] [Scilit]
  31. Ladeira, A.; Rusth, R.; Carneiro, C.; Campelo, D.; Morante, V.; Luz, R.; Carneiro, A.; Salaro, A. Dietary monosodium glutamate supplementation during the feed training of pacamã (Lophiosilurus alexandri): Growth performance and intestinal histomorphometry. Aquac. Res. 2021, 52, 356–363. [Google Scholar] [CrossRef] [Scilit]
  32. Zhao, Y.; Hu, Y.; Zhou, X.Q.; Zeng, X.Y.; Feng, L.; Liu, Y.; Jiang, W.D.; Li, S.H.; Li, D.B.; Wu, X.Q. Effects of dietary glutamate supplementation on growth performance, digestive enzyme activities and antioxidant capacity in intestine of grass carp (Ctenopharyngodon idella). Aquac. Nutr. 2015, 21, 935–941. [Google Scholar] [CrossRef] [Scilit]
  33. Zhu, S.; Long, X.; Turchini, G.M.; Deng, D.; Cheng, Y.; Wu, X. Towards defining optimal dietary protein levels for male and female sub-adult Chinese mitten crab, Eriocheir sinensis reared in earthen ponds: Performances, nutrient composition and metabolism, antioxidant capacity and immunity. Aquaculture 2021, 536, 736442. [Google Scholar] [CrossRef] [Scilit]
  34. Cabrini, L.; Bergami, R.; Fiorentini, D.; Marchetti, M.; Landi, L.; Tolomelli, B. Vitamin B6 deficiency affects antioxidant defences in rat liver and heart. IUBMB Life 1998, 46, 689–697. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Effects of glutamate on antioxidant capacity in the hepatopancreas of juvenile Chinese mitten crab. The asterisk (*) indicates that there are significant differences among different protein level groups with the same amount of glutamate (* means p < 0.05, ** means p < 0.01). The different lowercase letters in the table indicate that there are significant differences among crabs fed with different glutamate diets at 30% protein (p < 0.05).
Figure 1. Effects of glutamate on antioxidant capacity in the hepatopancreas of juvenile Chinese mitten crab. The asterisk (*) indicates that there are significant differences among different protein level groups with the same amount of glutamate (* means p < 0.05, ** means p < 0.01). The different lowercase letters in the table indicate that there are significant differences among crabs fed with different glutamate diets at 30% protein (p < 0.05).
Fishes 09 00306 g001
Figure 2. Effects of glutamate on the amino acid metabolism in the hepatopancreas of juvenile Chinese mitten crab. (A) The content of pyruvate; (B) The activity of glutaminase; (C) The activity of glutamine synthetase; (D) The activity of glutamate dehydrogenase. The asterisk (*) indicates that there are significant differences among different protein level groups with the same amount of glutamate (* means p < 0.05). The different lowercase letters in the table indicate that there are significant differences among crabs fed with different glutamate diets at 30% protein (p < 0.05).
Figure 2. Effects of glutamate on the amino acid metabolism in the hepatopancreas of juvenile Chinese mitten crab. (A) The content of pyruvate; (B) The activity of glutaminase; (C) The activity of glutamine synthetase; (D) The activity of glutamate dehydrogenase. The asterisk (*) indicates that there are significant differences among different protein level groups with the same amount of glutamate (* means p < 0.05). The different lowercase letters in the table indicate that there are significant differences among crabs fed with different glutamate diets at 30% protein (p < 0.05).
Fishes 09 00306 g002
Figure 3. Effects of glutamate on the protein metabolism related genes in the hepatopancreas of juvenile Chinese mitten crab. (A) The relative expression of mTOR (Mammalian target of rapamycin); (B) The relative expression of PI3K (Phosphatidylinositide 3-kinases); (C) The relative expression of S6K1 (Ribosomal protein S6 kinase 1); (D) The relative expression of 4EBP (e IF4E-binding protein). The different lowercase letters in the table indicate that there are significant differences among crabs fed with different glutamate diets at 30% protein (p < 0.05). Different capital letters indicate that there are significant differences among crabs fed with different glutamate diets at 35% protein (p < 0.05). The asterisk (*) indicates that there are significant differences among different protein level groups with the same amount of glutamate (* means p < 0.05, ** means p < 0.01, *** means p < 0.001,).
Figure 3. Effects of glutamate on the protein metabolism related genes in the hepatopancreas of juvenile Chinese mitten crab. (A) The relative expression of mTOR (Mammalian target of rapamycin); (B) The relative expression of PI3K (Phosphatidylinositide 3-kinases); (C) The relative expression of S6K1 (Ribosomal protein S6 kinase 1); (D) The relative expression of 4EBP (e IF4E-binding protein). The different lowercase letters in the table indicate that there are significant differences among crabs fed with different glutamate diets at 30% protein (p < 0.05). Different capital letters indicate that there are significant differences among crabs fed with different glutamate diets at 35% protein (p < 0.05). The asterisk (*) indicates that there are significant differences among different protein level groups with the same amount of glutamate (* means p < 0.05, ** means p < 0.01, *** means p < 0.001,).
Fishes 09 00306 g003
Table 1. Formulation and proximate composition of the experimental diets (dry matter, %).
Table 1. Formulation and proximate composition of the experimental diets (dry matter, %).
IngredientsExperimental Diets
30% Protein
0% Glu
30% Protein
1% Glu
30% Protein
2% Glu
35% Protein
0% Glu
35% Protein
1% Glu
35% Protein
2% Glu
Ingredients
Fish meal21212124.524.524.5
Gelatin3333.53.53.5
Casein121212141414
Corn starch262626262626
Fish oil2.52.52.52.52.52.5
Soybean oil2.52.52.52.52.52.5
Arginine222222
Methionine0.50.50.50.50.50.5
Lysine0.50.50.50.50.50.5
Vitamin premix a1.51.51.51.51.51.5
Mineral premix b1.51.51.51.51.51.5
Soybean lecithin222222
Cholesterol0.50.50.50.50.50.5
Choline chloride0.50.50.50.50.50.5
Betaine222222
Butylated hydroxytoluene0.10.10.10.10.10.1
Sodium carboxymethyl cellulose222222
Glutamate012012
Cellulose19.918.917.913.912.911.9
Proximate analysis (%)
Moisture6.366.696.326.316.506.70
Crude protein30.5230.7531.5235.5836.5837.62
Crude lipid8.688.598.639.569.479.62
Ash4.814.925.005.535.615.29
a Vitamin premix (per 100 g premix): Ca pantothenate, 0.3 g; para-aminobenzoic acid, 0.1 g; cholecalciferol, 0.0075 g; riboflavin, 0.0625 g; menadione, 0.05 g; ascorbic acid, 0.5 g; biotin, 0.005 g; retinol acetate, 0.043 g; folic acid, 0.025 g; pyridoxine hydrochloride, 0.225 g; thiamin hydrochloride, 0.15 g; niacin, 0.3 g; α-tocopherol acetate, 0.5 g; The remaining part will be used α-cellulose to 100 g. b Mineral premix (per 100 g premix): KI, 0.023 g; CuCl2·2H2O, 0.015 g; Ca(H2PO4)2, 26.5 g; MnSO4·6H2O, 0.143 g; AlCl3·6H2O, 0.024 g; KH2PO4, 21.5 g; NaH2PO4, 10.0 g; CoCl2·6H2O, 0.14 g; KCl, 2.8 g; ZnSO4·7H2O, 0.476 g; Calcium lactate, 16.50 g; CaCO3, 10.5 g; MgSO4·7H2O, 10.0 g; Fe-citrate, 1 g; The remaining part will be used α-cellulose to 100 g.
Table 2. Sequences of primers.
Table 2. Sequences of primers.
Primers NameSequences (5′-3′)Product Size References
mTOR FAGGTCCTGTTATGCTGTGGC158 bpMT920347.1
mTOR RATCTCGGGGATGTCCTGTGA
PI3K FGCTGTCAGTCCAGTTCGACA111 bpc147204_g1
PI3K RACAGTATGCTTGGTCAGGGC
AMPD FCACAACGTCCACTCCGAGAA116 bpc143453_g1
AMPD RCGGAACAGGTTGTCGAGGAA
AKT FATAAGGACCCCAACAAGCGG134 bpKY709138.1
AKT RCACTTGGGGTTTGAAAGGCG
S6K1 FTGACTACCCGGACCTGCTAA154 bpXM_050855088.1
S6K1 RTGCCACACCAATGAACCCTT
4EBP FGCTGTCTGCTCCCTCACTTT163 bpXM_050856547.1
4EBP RACCCGTCAGCTTCTTAAGCC
GLDH FGGCAACGATGTAACGTGTGG116 bpXM_050832606.1
GLDH RCGAAGCATCTTGCCACCAAC
Table 3. Effects of glutamate on the growth performance of juvenile Chinese mitten crab.
Table 3. Effects of glutamate on the growth performance of juvenile Chinese mitten crab.
Parameters
DietsWeight Gain (%)Specific Growth Rate (% Day−1)Hepatopancreas Index (%)
30% Protein-0% Glu283.59 ± 76.722.29 ± 0.378.62 ± 2.72 b
30% Protein-1% Glu327.91 ± 73.452.48 ± 0.3212.4 ± 0.95 a
30% Protein-2% Glu328.53 ± 67.742.49 ± 0.298.46 ± 1.63 b
35% Protein-0% Glu375.2 ± 59.48 A2.68 ± 0.22 A8.98 ± 1.6
35% Protein-1% Glu315.42 ± 66.24 AB2.44 ± 0.27 AB8.28 ± 1.34
35% Protein-2% Glu265.83 ± 106.38 B2.17 ± 0.55 B9.83 ± 0.75
Two-way ANOVA (p value)
ProteinNSNSNS
GluNSNSNS
Protein × GluNSNSNS
The different lowercase letters in the table indicate that there are significant differences among crabs fed with different glutamate diets at 30% protein (p < 0.05). Different capital letters indicate that there are significant differences among crabs fed with different glutamate diets at 35% protein (p < 0.05). NS means no significant differences.
Table 4. Effect of glutamate on the whole-body composition of juvenile Chinese mitten crab.
Table 4. Effect of glutamate on the whole-body composition of juvenile Chinese mitten crab.
Parameters
DietsMoisture (%)Ash (%)Crude Protein (%)Crude Lipid (%)
30% Protein–0% Glu66.18 ± 2.1611.88 ± 0.2114.19 ± 0.13 a6.12 ± 0.23
30% Protein–1% Glu66.54 ± 3.1512.01 ± 0.4214.14 ± 0.33 a5.89 ± 0.16
30% Protein–2% Glu66.28 ± 1.1111.96 ± 0.2513.34 ± 0.24 b5.95 ± 0.32
35% Protein–0% Glu66.82 ± 3.7412 ± 0.3313.94 ± 0.26 A6.1 ± 0.48
35% Protein–1% Glu66.13 ± 1.6512.08 ± 0.4913.76 ± 0.11 AB6.03 ± 0.23
35% Protein–2% Glu66.19 ± 3.6911.96 ± 0.4713.26 ± 0.43 B5.81 ± 0.67
Two-way ANOVA (p value)
ProteinNSNSNS<0.05
GluNSNS<0.01NS
Protein × GluNSNSNSNS
The different lowercase letters in the table indicate that there are significant differences among crabs fed with different glutamate diets at 30% protein (p < 0.05). Different capital letters indicate that there are significant differences among crabs fed with different glutamate diets at 35% protein (p < 0.05). NS means no significant differences.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zheng, J.; He, Y.; Shi, M.; Jia, L.; Xu, Y.; Tan, Y.; Qi, C.; Ye, J. Effects of Dietary Glutamate on the Growth Performance and Antioxidant Capacity of Juvenile Chinese Mitten Crab (Eriocheir sinensis). Fishes 2024, 9, 306. https://doi.org/10.3390/fishes9080306

AMA Style

Zheng J, He Y, Shi M, Jia L, Xu Y, Tan Y, Qi C, Ye J. Effects of Dietary Glutamate on the Growth Performance and Antioxidant Capacity of Juvenile Chinese Mitten Crab (Eriocheir sinensis). Fishes. 2024; 9(8):306. https://doi.org/10.3390/fishes9080306

Chicago/Turabian Style

Zheng, Jiajun, Yisong He, Mengyu Shi, Li Jia, Yang Xu, Yue Tan, Changle Qi, and Jinyun Ye. 2024. "Effects of Dietary Glutamate on the Growth Performance and Antioxidant Capacity of Juvenile Chinese Mitten Crab (Eriocheir sinensis)" Fishes 9, no. 8: 306. https://doi.org/10.3390/fishes9080306

APA Style

Zheng, J., He, Y., Shi, M., Jia, L., Xu, Y., Tan, Y., Qi, C., & Ye, J. (2024). Effects of Dietary Glutamate on the Growth Performance and Antioxidant Capacity of Juvenile Chinese Mitten Crab (Eriocheir sinensis). Fishes, 9(8), 306. https://doi.org/10.3390/fishes9080306

Article Metrics

Back to TopTop