Effects of Dietary Glutamate on the Growth Performance and Antioxidant Capacity of Juvenile Chinese Mitten Crab (Eriocheir sinensis)
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Diets
2.2. Feeding Trial and Sampling
2.3. Chemical Composition Analysis
2.4. Analysis of Biochemical Parameters in the Hepatopancreas
2.5. Analysis of Gene Expression
2.6. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Nutrient Composition of Crabs
3.3. The Actiities of Enzymes Related to Antioxidant Capacity in the Hepatopancreas
3.4. The Amino Acid Metabolism in the Hepatopancreas
3.5. Protein Metabolism in the Hepatopancreas
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Brosnan, J.T.; Brosnan, M.E. Glutamate: A truly functional amino acid. Amino Acids 2013, 45, 413–418. [Google Scholar] [CrossRef] [PubMed]
- Lallès, J.P.; Bosi, P.; Smidt, H.; Stokes, C.R. Weaning—A challenge to gut physiologists. Livest. Sci. 2007, 108, 82–93. [Google Scholar] [CrossRef]
- Burrin, D.G.; Stoll, B. Metabolic fate and function of dietary glutamate in the gut. Am. J. Clin. Nutr. 2009, 90, 850–856. [Google Scholar] [CrossRef] [PubMed]
- Conceio, L.E.C.; Rnnestad, I.; Tonheim, S.K. Metabolic budgets for lysine and glutamate in unfed herring (Clupea harengus) larvae. Aquaculture 2002, 206, 305–312. [Google Scholar] [CrossRef]
- Van Waarde, A. Aerobic and anaerobic ammonia production by fish. Comp. Biochem. Physiol. B 1983, 74, 675–684. [Google Scholar] [CrossRef] [PubMed]
- Larsson, T.; Koppang, E.O.; Espe, M.; Terjesen, B.F.; Krasnov, A.; Moreno, H.M.; Rørvik, K.A.; Thomassen, M.; Mørkøre, T. Fillet quality and health of Atlantic salmon (Salmo salar L.) fed a diet supplemented with glutamate. Aquaculture 2014, 426, 288–295. [Google Scholar] [CrossRef]
- Oehme, M.; Grammes, F.; Takle, H.; Zambonino-Infante, J.L.; Refstie, S.; Thomassen, M.S.; Rørvik, K.-A.; Terjesen, B.F. Dietary supplementation of glutamate and arginine to Atlantic salmon (Salmo salar L.) increases growth during the first autumn in sea. Aquaculture 2010, 310, 156–163. [Google Scholar] [CrossRef]
- Silva, L.C.R.D.; Furuya, W.M.; Natali, M.R.M.; Schamber, C.R.; Santos, L.D.D.; Vidal, L.V.O. Productive performance and intestinal morphology of Nile tilapia juvenile fed diets with L-glutamine and L-glutamate. Rev. Bras. Zootec. 2010, 39, 1175–1179. [Google Scholar] [CrossRef]
- Maclennan, P.A.; Brown, R.; Rennie, M.J. A positive relationship between protein synthetic rate and intracellular glutamine concentration in perfused rat skeletal muscle. FEBS Lett. 1987, 215, 187–191. [Google Scholar] [CrossRef]
- Coffier, M.S.; Claeyssens, S.; Hecketsweiler, B.; Lavoinne, A.; Ducrotté, P.; Déchelotte, P. Enteral glutamine stimulates protein synthesis and decreases ubiquitin mRNA level in human gut mucosa. Am. J. Physiol.-Gastrointest. Liver Physiol. 2003, 285, G266–G273. [Google Scholar] [CrossRef]
- Caballero-Solares, A.; Viegas, I.; Salgado, M.C.; Siles, A.M.; Saez, A.; Metón, I.; Baanante, I.V.; Fernández, F. Diets supplemented with glutamate or glutamine improve protein retention and modulate gene expression of key enzymes of hepatic metabolism in gilthead seabream (Sparus aurata) juveniles. Aquaculture 2015, 444, 79–87. [Google Scholar] [CrossRef]
- Brosnan, M.E.; Brosnan, J.T. Hepatic glutamate metabolism: A tale of 2 hepatocytes. Am. J. Clin. Nutr. 2009, 90, 857–861. [Google Scholar] [CrossRef] [PubMed]
- Wu, G. Functional amino acids in growth, reproduction, and health. Adv. Nutr. 2010, 1, 31–37. [Google Scholar] [CrossRef] [PubMed]
- Abboudi, T.; Mambrini, M.; Larondelle, Y.; Rollin, X. The effect of dispensable amino acids on nitrogen and amino acid losses in Atlantic salmon (Salmo salar) fry fed a protein-free diet. Aquaculture 2009, 65, 345–353. [Google Scholar] [CrossRef]
- Tanaka, H.; Shibata, K.; Mori, M.; Ogura, M. Metabolism of essential amino acids in growing rats at graded levels of soybean protein isolate. J. Nutr. Sci. Vitaminol. 1995, 41, 433–443. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, H.; Kawamata, Y.; Kuwahara, T.; Torii, K.; Sakai, R. Nitrogen in dietary glutamate is utilized exclusively for the synthesis of amino acids in the rat intestine. Am. J. Physiol.-Endocrinol. Metab. 2013, 304, E100–E108. [Google Scholar] [CrossRef] [PubMed]
- Espinosa, D.C.; Miguel, V.; Mennerich, D.; Kietzmann, T.; Sánchez-Pérez, P.; Cadenas, S.; Lamas, S. Antioxidant responses and cellular adjustments to oxidative stress. Redox Biol. 2015, 6, 183–197. [Google Scholar] [CrossRef] [PubMed]
- He, L.; Wu, J.; Tang, W.; Zhou, X.; Lin, Q.; Luo, F.; Yin, Y.; Li, T. Prevention of oxidative stress by α-ketoglutarate via activation of CAR signaling and modulation of the expression of key antioxidant-associated targets in vivo and in vitro. J. Agric. Food Chem. 2018, 66, 11273–11283. [Google Scholar] [CrossRef] [PubMed]
- Cai, G.Y. Effect of Glutamate on Antioxoidant Level and Subseouent Development of In Vitro Cultured Mouse Embryos in the Blocking Stage. Master’s Thesis, Yanbian University, Yanji, China, 2017. (In Chinese). [Google Scholar]
- Fujita, T.; Yanaga, K. Association between glutamine extraction and release of citrulline and glycine by the human small intestine. Life Sci. 2007, 80, 1846–1850. [Google Scholar] [CrossRef]
- Kaul, S.; Sharma, S.S.; Mehta, I.K. Free radical scavenging potential of L-proline: Evidence from in vitro assays. Amino Acids 2008, 34, 315–320. [Google Scholar] [CrossRef]
- Meister, A. Glutathione-ascorbic acid antioxidant system in animals. J. Biol. Chem. 1994, 269, 9397–9402. [Google Scholar] [CrossRef]
- Zhao, Y.; Li, J.-Y.; Yin, L.; Feng, L.; Liu, Y.; Jiang, W.-D.; Wu, P.; Zhao, J.; Chen, D.-F.; Zhou, X.-Q.; et al. Effects of dietary glutamate supplementation on flesh quality, antioxidant defense and gene expression related to lipid metabolism and myogenic regulation in Jian carp (Cyprinus carpio var. Jian). Aquaculture 2019, 502, 212–222. [Google Scholar] [CrossRef]
- Canton, H. The Europa Directory of International Organizations 2021, 23rd ed.; Routledge: London, UK, 2021; pp. 297–305. [Google Scholar]
- Tao, S.; Zhang, Q.; Zhang, J. Feed market situation, prospect and countermeasures in 2021. Chin. J. Anim. Sci. 2022, 86, 45–49. (In Chinese) [Google Scholar]
- Huang, J.; Deng, H. Effects of low protein diet on nutrient digestion and nitrogen emission of growing pigs. Livest. Poult. Inventory 2017, 45, 21–28. (In Chinese) [Google Scholar]
- Gloaguen, M.; Floc’H, N.L.; Corrent, E.; Primot, Y.; Milgen, J.V. The use of free amino acids allows formulating very low crude protein diets for piglets. J. Anim. Sci. 2014, 92, 637–641. [Google Scholar] [CrossRef]
- AOAC. Official Methods of Analysis of AOAC International; Association of Official Analytical Chemists: Washington, DC, USA, 2005. [Google Scholar]
- Vandesompele, J.; Preter, K.D.; Pattyn, F.; Poppe, B.; Roy, N.V.; Paepe, A.D.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Han, H.; Yin, J.; Zheng, J.; Zhu, X.; Li, T.; Yin, Y. Effects of glutamate and aspartate on growth performance, serum amino acids, and amino acid transporters in piglets. Food Agric. Immunol. 2018, 54, 675–687. [Google Scholar] [CrossRef]
- Ladeira, A.; Rusth, R.; Carneiro, C.; Campelo, D.; Morante, V.; Luz, R.; Carneiro, A.; Salaro, A. Dietary monosodium glutamate supplementation during the feed training of pacamã (Lophiosilurus alexandri): Growth performance and intestinal histomorphometry. Aquac. Res. 2021, 52, 356–363. [Google Scholar] [CrossRef]
- Zhao, Y.; Hu, Y.; Zhou, X.Q.; Zeng, X.Y.; Feng, L.; Liu, Y.; Jiang, W.D.; Li, S.H.; Li, D.B.; Wu, X.Q. Effects of dietary glutamate supplementation on growth performance, digestive enzyme activities and antioxidant capacity in intestine of grass carp (Ctenopharyngodon idella). Aquac. Nutr. 2015, 21, 935–941. [Google Scholar] [CrossRef]
- Zhu, S.; Long, X.; Turchini, G.M.; Deng, D.; Cheng, Y.; Wu, X. Towards defining optimal dietary protein levels for male and female sub-adult Chinese mitten crab, Eriocheir sinensis reared in earthen ponds: Performances, nutrient composition and metabolism, antioxidant capacity and immunity. Aquaculture 2021, 536, 736442. [Google Scholar] [CrossRef]
- Cabrini, L.; Bergami, R.; Fiorentini, D.; Marchetti, M.; Landi, L.; Tolomelli, B. Vitamin B6 deficiency affects antioxidant defences in rat liver and heart. IUBMB Life 1998, 46, 689–697. [Google Scholar] [CrossRef] [PubMed]



| Ingredients | Experimental Diets | |||||
|---|---|---|---|---|---|---|
| 30% Protein 0% Glu | 30% Protein 1% Glu | 30% Protein 2% Glu | 35% Protein 0% Glu | 35% Protein 1% Glu | 35% Protein 2% Glu | |
| Ingredients | ||||||
| Fish meal | 21 | 21 | 21 | 24.5 | 24.5 | 24.5 |
| Gelatin | 3 | 3 | 3 | 3.5 | 3.5 | 3.5 |
| Casein | 12 | 12 | 12 | 14 | 14 | 14 |
| Corn starch | 26 | 26 | 26 | 26 | 26 | 26 |
| Fish oil | 2.5 | 2.5 | 2.5 | 2.5 | 2.5 | 2.5 |
| Soybean oil | 2.5 | 2.5 | 2.5 | 2.5 | 2.5 | 2.5 |
| Arginine | 2 | 2 | 2 | 2 | 2 | 2 |
| Methionine | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 |
| Lysine | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 |
| Vitamin premix a | 1.5 | 1.5 | 1.5 | 1.5 | 1.5 | 1.5 |
| Mineral premix b | 1.5 | 1.5 | 1.5 | 1.5 | 1.5 | 1.5 |
| Soybean lecithin | 2 | 2 | 2 | 2 | 2 | 2 |
| Cholesterol | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 |
| Choline chloride | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 |
| Betaine | 2 | 2 | 2 | 2 | 2 | 2 |
| Butylated hydroxytoluene | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 |
| Sodium carboxymethyl cellulose | 2 | 2 | 2 | 2 | 2 | 2 |
| Glutamate | 0 | 1 | 2 | 0 | 1 | 2 |
| Cellulose | 19.9 | 18.9 | 17.9 | 13.9 | 12.9 | 11.9 |
| Proximate analysis (%) | ||||||
| Moisture | 6.36 | 6.69 | 6.32 | 6.31 | 6.50 | 6.70 |
| Crude protein | 30.52 | 30.75 | 31.52 | 35.58 | 36.58 | 37.62 |
| Crude lipid | 8.68 | 8.59 | 8.63 | 9.56 | 9.47 | 9.62 |
| Ash | 4.81 | 4.92 | 5.00 | 5.53 | 5.61 | 5.29 |
| Primers Name | Sequences (5′-3′) | Product Size | References |
|---|---|---|---|
| mTOR F | AGGTCCTGTTATGCTGTGGC | 158 bp | MT920347.1 |
| mTOR R | ATCTCGGGGATGTCCTGTGA | ||
| PI3K F | GCTGTCAGTCCAGTTCGACA | 111 bp | c147204_g1 |
| PI3K R | ACAGTATGCTTGGTCAGGGC | ||
| AMPD F | CACAACGTCCACTCCGAGAA | 116 bp | c143453_g1 |
| AMPD R | CGGAACAGGTTGTCGAGGAA | ||
| AKT F | ATAAGGACCCCAACAAGCGG | 134 bp | KY709138.1 |
| AKT R | CACTTGGGGTTTGAAAGGCG | ||
| S6K1 F | TGACTACCCGGACCTGCTAA | 154 bp | XM_050855088.1 |
| S6K1 R | TGCCACACCAATGAACCCTT | ||
| 4EBP F | GCTGTCTGCTCCCTCACTTT | 163 bp | XM_050856547.1 |
| 4EBP R | ACCCGTCAGCTTCTTAAGCC | ||
| GLDH F | GGCAACGATGTAACGTGTGG | 116 bp | XM_050832606.1 |
| GLDH R | CGAAGCATCTTGCCACCAAC |
| Parameters | |||
|---|---|---|---|
| Diets | Weight Gain (%) | Specific Growth Rate (% Day−1) | Hepatopancreas Index (%) |
| 30% Protein-0% Glu | 283.59 ± 76.72 | 2.29 ± 0.37 | 8.62 ± 2.72 b |
| 30% Protein-1% Glu | 327.91 ± 73.45 | 2.48 ± 0.32 | 12.4 ± 0.95 a |
| 30% Protein-2% Glu | 328.53 ± 67.74 | 2.49 ± 0.29 | 8.46 ± 1.63 b |
| 35% Protein-0% Glu | 375.2 ± 59.48 A | 2.68 ± 0.22 A | 8.98 ± 1.6 |
| 35% Protein-1% Glu | 315.42 ± 66.24 AB | 2.44 ± 0.27 AB | 8.28 ± 1.34 |
| 35% Protein-2% Glu | 265.83 ± 106.38 B | 2.17 ± 0.55 B | 9.83 ± 0.75 |
| Two-way ANOVA (p value) | |||
| Protein | NS | NS | NS |
| Glu | NS | NS | NS |
| Protein × Glu | NS | NS | NS |
| Parameters | ||||
|---|---|---|---|---|
| Diets | Moisture (%) | Ash (%) | Crude Protein (%) | Crude Lipid (%) |
| 30% Protein–0% Glu | 66.18 ± 2.16 | 11.88 ± 0.21 | 14.19 ± 0.13 a | 6.12 ± 0.23 |
| 30% Protein–1% Glu | 66.54 ± 3.15 | 12.01 ± 0.42 | 14.14 ± 0.33 a | 5.89 ± 0.16 |
| 30% Protein–2% Glu | 66.28 ± 1.11 | 11.96 ± 0.25 | 13.34 ± 0.24 b | 5.95 ± 0.32 |
| 35% Protein–0% Glu | 66.82 ± 3.74 | 12 ± 0.33 | 13.94 ± 0.26 A | 6.1 ± 0.48 |
| 35% Protein–1% Glu | 66.13 ± 1.65 | 12.08 ± 0.49 | 13.76 ± 0.11 AB | 6.03 ± 0.23 |
| 35% Protein–2% Glu | 66.19 ± 3.69 | 11.96 ± 0.47 | 13.26 ± 0.43 B | 5.81 ± 0.67 |
| Two-way ANOVA (p value) | ||||
| Protein | NS | NS | NS | <0.05 |
| Glu | NS | NS | <0.01 | NS |
| Protein × Glu | NS | NS | NS | NS |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zheng, J.; He, Y.; Shi, M.; Jia, L.; Xu, Y.; Tan, Y.; Qi, C.; Ye, J. Effects of Dietary Glutamate on the Growth Performance and Antioxidant Capacity of Juvenile Chinese Mitten Crab (Eriocheir sinensis). Fishes 2024, 9, 306. https://doi.org/10.3390/fishes9080306
Zheng J, He Y, Shi M, Jia L, Xu Y, Tan Y, Qi C, Ye J. Effects of Dietary Glutamate on the Growth Performance and Antioxidant Capacity of Juvenile Chinese Mitten Crab (Eriocheir sinensis). Fishes. 2024; 9(8):306. https://doi.org/10.3390/fishes9080306
Chicago/Turabian StyleZheng, Jiajun, Yisong He, Mengyu Shi, Li Jia, Yang Xu, Yue Tan, Changle Qi, and Jinyun Ye. 2024. "Effects of Dietary Glutamate on the Growth Performance and Antioxidant Capacity of Juvenile Chinese Mitten Crab (Eriocheir sinensis)" Fishes 9, no. 8: 306. https://doi.org/10.3390/fishes9080306
APA StyleZheng, J., He, Y., Shi, M., Jia, L., Xu, Y., Tan, Y., Qi, C., & Ye, J. (2024). Effects of Dietary Glutamate on the Growth Performance and Antioxidant Capacity of Juvenile Chinese Mitten Crab (Eriocheir sinensis). Fishes, 9(8), 306. https://doi.org/10.3390/fishes9080306

