Abstract
Liobagrus geumgangensis is a novel Korean fish species endemic to the Geumgang and Mangyeonggang River basins on the Korean Peninsula. During a survey of L. geumgangensis, the discovery of Liobagrus mediadiposalis as a potential threat prompted an investigation into L. geumgangensis genetic diversity and structure. Three populations of L. geumagangensis and one population of L. mediadiposalis were investigated using a 1024-bp sequence in the cytb region of mitochondrial DNA. The Mangyeonggang River of L. geumagangensis displayed the lowest haplotype diversity (Hd) within a range of 0.000–0.337, with one to two haplotypes (h). The Jecheon region of the Geumgang River for L. geumagangensis population had the highest nucleotide diversity (π) and was within the range of 0.00000–0.00066. The h of L. mediadiposalis population was 3, the range of Hd was 0.292, and π was 0.00231. Tajima’s D (D) and Fu’s Fs (F) were negative and non-significant in the LgGJ population. The genetic structure of L. geumgangensis had no shared haplotypes among the three populations. The discovery of L. mediadiposalis in the Geumgang River suggests the necessity of non-habitat conservation and population management of fish farms to conserve L. geumgangensis.
Keywords:
genetic structure; genetic diversity; Liobagrus geumgangensis; Liobagrus mediadiposalis; catfish Key Contribution:
In this study, we investigated the genetic structure of Liobagrus geumgangensis in the Geumgang and Mangyeonggang River basins. Overall, three populations were investigated. Through findings on genetic diversity and genetic structure, we aimed to provide a comprehensive understanding of the measures necessary for the conservation of L. geumgangensis.
1. Introduction
Liobagrus geumgangensis was identified as a new species in 2023 and is endemic to the freshwaters of the Geumgang and Mangyeonggang River basins on the Korean Peninsula [1]. L. geumgangensis and L. mediadiposalis are almost similar in appearance. However, L. geumgangensis and L. mediadiposalis show distinct morphological differences in pectoral-fin spines and rays. In addition, L. geumgangensis is recognized as a different species as it shows more than a 5.8% difference from L. mediadiposalis in the gene sequence using cytb [1]. Until 2023, L. geumgangensis was classified as a single taxon under the name L. mediadiposalis. However, a recent study in 2023 identified it as a new species, and information regarding its genetic structure and diversity before and after this classification remains undisclosed.
Korea’s Geumgang River water system drains to the west, with structures such as the Daecheong Dam and weirs blocking the flow between the upstream and downstream regions. In the case of the Mangyeonggang River water system, gene flow is blocked by many weirs. Thus, the construction of dikes and dams blocks genetic flow between upstream and downstream regions, making it difficult to identify differences in genetic structure. In the case of catfish species, it has been reported that after adapting to a habitat and then moving from that habitat to spawn or feed, they often return to the original habitat [2,3]. Therefore, the identification of conservation areas based on biased wrong information can result in enormous losses due to habitat destruction of the catfish family [2,3]. Among the catfish family, species that rarely migrate may have unique genotypes for each microhabitat [4]. This is presumed to be because the catfish family forms a unique territory. Therefore, detailed, rather than biased, information should be procured for newly discovered species for identifying conservation habitats.
Endemic species are generally overlooked and face a heightened risk of extinction [4,5]. Vulnerability is influenced by factors including the threat of human overexploitation, declining population size, low reproductive potential, habitat damage from human activities, and introduced species [6,7,8]. L. geumgangensis is experiencing population decline because of indiscriminate habitat destruction and lack of attention, potentially resulting in reduced reproduction. The introduction of species sharing similar ecological niches poses a threat to the fertility and persistence of endemic species in relatively confined habitats [9]. This lack of attention may lead to severe genetic contamination, resulting in mixed populations despite genetic differences across geographical discontinuities [5]. Understanding the genetic diversity and structure before such situations arise is crucial for the continuity and conservation of species [10,11].
The mitochondrial DNA (mtDNA) cytb gene has been widely used as a molecular marker to determine population structure and diversity in genetic studies of several taxa [12,13,14,15,16]. River ecosystems operate across multiple temporal and spatial scales, shaping the connectivity and population genetic structure of the species that inhabit these habitats [17]. To confirm the genetic structure of a river ecosystem, identifying differences in genetic structures between different populations is a fundamental requirement [18]. The genetic structure typically develops over generations owing to interruptions in genetic flow [19]. This diversity in genetic structure is advantageous for species conservation. Various genetic differences allow species to persist and help them adapt to environmental changes [9]. Pseudopungtungia nigra has the same habitat distribution as L. geumgangensis [19]. P. nigra shows significant genetic differences between the Geumgang and Mangyeonggang Rivers, dividing into two genetically distinct groups [19]. Therefore, it is expected that L. geumgangensis will also show significant genetic differences between the Geumgang and Mangyeonggang Rivers. Because L. geumgangensis, like P. nigra, has a distribution range limited to Geumgang and Mangyeonggang Rivers, it is considered important to identify differences in genetic structure.
Samples were collected to determine the genetic diversity and structure of L. geumgangensis. During the collection, a population of L. mediadiposalis (LmMJ) was unexpectedly discovered in the upper Geumgang River. Given the similar ecological niche between L. mediadiposalis and L. geumgangensis in the Geumgang River, the former poses a threat to the latter. Therefore, we investigated the genetic structure and diversity of L. geumgangensis using mitochondrial cytb and provided basic data for conservation. Additionally, we sought ways to conserve L. geumgangensis through a genetic investigation of the upper Geumgang River population of L. mediadiposalis.
2. Materials and Methods
2.1. Sampling and Genomic DNA Extraction
Sampling was conducted in August 2023, when the animals were adults. Three populations of L. geumgangensis and one population of L. mediadiposalis were sampled using fishing nets; detailed information is provided in Figure 1 and Table S1. A total of 79 specimens were sampled from four sites. It is challenging to distinguish L. geumgangensis and L. mediadiposalis using morphological characteristics. For the LmMJ population, NCBI showed that LmMJ was 92% similar to L. Geumgangensis. Additionally, for the LmMJ population, NCBI confirmed that LmMJ was 99.71% similar to L. mediadiposalis (OP980987; Nakdonggang River water system) through BLAST identity analysis. Therefore, we considered the LmMJ population to be L. mediadiposalis. L. geumgangensis and L. mediadiposalis are endemic to Korea, and research does not require approval from animal ethical committees. The pectoral fin tissues of the fish samples were preserved in 99% ethanol. Genomic DNA was extracted from preserved tissues of all specimens using a DNeasy Blood & Tissue kit (QIAGEN, Germantown, MD, USA) according to the manufacturer’s instructions.
Figure 1.
Specimen sample of L. geumgangensis (A). Sample location of four populations of L. geumgangensis and L. mediadiposalis (B). LgGJ, L. geumgangensis GJ population; LgJC, L. geumgangensis JC population; LgMG, L. geumgangensis MG population; LmMJ, L. mediadiposalis MJ population.
2.2. mtDNA Sequencing and Sequence Assembly
For mitochondrial gene selection, we selected a region of cytb with an appropriate level of haplotype diversity. Primers developed for cytb of mtDNA (Liobagrus_cytb_F1: TRAGAACTTATGGTAACCCGAA, Liobagrus_cytb_R1: GGATTACAAGACCGGCGCTT) were used in PCR, performed using a Mastercycler® pro gene amplifier (Eppendorf, Enfield, CT, USA). The AccuPower® PCR Premix Kit (BIONEER Co., Daejeon, Republic of Korea) was used for each reaction using 1 μL genomic DNA, 1 μL each of 1.0 μM forward and reverse primer, and 17 μL of tertiary distilled water. The PCR conditions were as follows: pre-denaturation at 95 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 57.5 °C for 30 s, and extension at 72 °C for 30 s, repeated for 30 cycles. The reaction concluded with a final extension at 72 °C for 10 min, followed by termination at 4 °C. The cytb PCR products were sequenced using an ABI 3730xl DNA Analyzer (Applied Biosystems, Waltham, MA, USA). The cytb sequence thus determined was assembled using Geneious Prime 2022.2 (https://www.geneious.com, accessed on 11 November 2023) from raw data. The final determined cytb sequence is shown in the Fasta format in the Supplementary Materials. The cytb sequences were deposited in GenBank (PP061219–PP061226).
2.3. Sequence Analysis of Genetic Diversity and Structure in mtDNA
The alignment of cytb was conducted using the ClustalW algorithm within the MEGA software ver. 11.0.1 [20] based on cytb sequencing data. The number of haplotypes, haplotype diversity (Hd), nucleotide diversity (π), Fu’s Fs (F), and Tajima’s D (D) were calculated using DnaSP ver. 5.0 software [21]. A haplotype network was generated using Network ver. 10.2.0.0 [22] software, employing median-joining network analysis to determine the affinity between genotypes. STRUCTURE software (ver. 2.3.4) [23] was used to perform genetic structure clustering analysis based on the Bayesian model. We set the population constant (K) to 1–10 and applied a suitable admixture model to a mixture of water systems to estimate the most suitable population. Ten independent replicates with a burn-in of 10,000 iterations and Markov chain Monte Carlo (MCMC) with 100,000 iterations were performed. We analyzed a study by Evanno et al. [24] and the cluster results corresponding to K using STRUCTURE HARVESTER (ver. 0.7) [25] to estimate a population-appropriate constant (K). We used CLUMPK to estimate a graph of the appropriate K of the genetic structure of the population [26].
3. Results
3.1. Genetic Diversity
Cytb in mtDNA sets showed genetic diversity among the four populations (Table 1). The LgJC population showed the highest haplotype diversity (Hd) at 0.337. The π of L. geumgangensis populations ranged from 0.00000 to 0.00066, with the highest value being 0.00066 in LgJC and the lowest being 0.00000 in LgMG. For LgJC, F and D were positive, and for LgGJ, F and D were negative; however, these were not significant.
Table 1.
Cytb-based genetic diversity summary information of L. geumgangensis and L. mediadiposalis.
The h for the water system in the L. geumgangensis population was 1–4, the Hd was 0.000–0.619, and the π was 0.000–0.00271. D and F were negative and non-significant in the LgGJ population.
L. mediadiposalis showed haplotype diversity similar to that of LgJC, with an Hd of 0.292. For L. mediadiposalis, D was negative and F was positive.
At the species level (LgGJ, LgJC, LgMG) of L. geumgangensis, the total h was 5, Hd was 0.725, and π was high at 0.00319. F and D were both positive.
3.2. Population Genetic Structure
The FST values for cytb in mtDNA were 0.923–0.981, indicating a high degree of differentiation (Table 2). The Geumgang and Mangyeonggang River water system populations showed a considerably high genetic differentiation of 0.952 and 0.976, respectively. The populations (JC and GJ) of the Geumgang River showed a high genetic differentiation of 0.923.
Table 2.
FST among four populations of L. geumgangensis and L. mediadiposalis according to the cytb gene datasets.
In the median-joining network, the haplotypes were divided into two groups centered on H1 and H5 (Figure 2). Haplotypes H1 and H2 vs. H3 and H4 of the two Geumgang River populations (LgGJ and LgJC) were not shared with each other. The H8 haplotype was unique to the LgMG population. Minor differences were observed between the LgMG (H8) and LgGJ populations (H1), with only two sequence differences. H1, H3, and H4 showed six sequence differences and displayed additional differences compared with the Mangyeonggang River water system.
Figure 2.
A haplotype network of four populations using mitochondrial cytb in L. geumgangensis (LgGJ, LgJC, and LgMG) and L. mediadiposalis (LmMJ). A single slash represents the mutant sequence, equivalent to a dot.
STRUCTURE results were analyzed in two groups (first group: L. geumgangensis and L. mediadiposalis, second group: L. geumgangensis), and the K constant of the first group was found to be 2 (Figure 3). The K constant of the second group was found to be 2, but it also showed high delta K values at K = 3. The first group was L. geumgangensis vs. L. mediadiposalis (LgGJ, LgMG, LgJC vs. LmMJ), whose genetic structure was divided into two. The second group was LgGJ, LgMG vs. LgJC, and the genetic structure was divided into two.
Figure 3.
The figure shows the genetic structure graph corresponding to the Delta K value and the appropriate K value. (A): The first group is a genetic structure graph including L. geumgangensis and L. mediadiposalis. (B): The second group contains genetic structure graphs containing only L. geumgangensis.
4. Discussion
Our goal was to reveal the genetic structure of L. geumgangensis inhabiting the Geumgang and Mangyeonggang Rivers and to recommend conservation strategies through a comparison of the genetic diversity and structure with L. mediadiposalis newly discovered in the Geumgang River. We initially used the mtDNA cytb region to analyze the genetic diversity of three populations (LgJC, LgGJ, and LgMG) living in the Geumgang and Mangyeonggang Rivers and a population of L. mediadiposalis found in the upper Geumgang River (LmMJ). High mutation rates in the cytb region demonstrate the presence of polymorphic sites and haplotypes in the LgGJ and LgJC populations [27,28]. No shared haplotypes existed among the three populations (LgJC, LgGJ, and LgMG).
There are no reports of species-level genetic diversity within Amblycipitidae. Therefore, the genetic diversity within Siluridae was investigated, revealing that L. geumgangensis (Hd = 0.725) showed lower genetic diversity than Silurus asotus (Hd = 0.948) [29]. Genetic diversity is an important factor in determining the evolutionary potential of a species and its ability to respond to change [30]. Low genetic diversity can lead to the loss of evolutionary potential owing to genetic drift and the accumulation of deleterious alleles [8]. Low genetic diversity can make a species vulnerable to extinction, as in the case of Anaecypris hispanica and Ladigesocypris ghigii [31,32]. Habitat destruction and overfishing were not always observed to reduce genetic diversity in the short term [33]. This is probably because short-term habitat destruction does not occur rapidly enough to induce biases in genetic variation among descendant generations. Therefore, the considerably low genetic diversity is assumed to be a long-term phenomenon. In particular, the Mangyeonggang River population may be more vulnerable to extinction owing to its low haplotype diversity. As they evolved recently and have a short evolutionary history, they may show low genetic diversity. Therefore, further research is needed to determine whether genetic diversity is low using nuclear DNA markers.
L. geumgangensis is an endemic species of the Geumgang and Mangyeong Rivers [1]. Currently, these rivers face a threat as shoals and gravel disappear because of habitat destruction caused by weirs and dams [1]. We performed neutrality tests on D and F statistics to investigate the history of each population. The values of D and F were negative in LgGJ; however, they were not statistically significant. Therefore, LgGJ did not experience population expansion or bottlenecks (LgGJ: D = −1.16439, F = −0.879). The reduction in genetic variation in wild populations owing to demographic bottlenecks is an important factor in conservation [34]. There has been no significant expansion in the Geumgang population; despite this, low genetic diversity persists, possibly contributing to its historically low genetic diversity. The lack of genetic diversity in this species may be a historical factor, not necessarily owing to recent demographic changes [35]. The L. geumgangensis Geumgang population did not appear to have undergone expansion, suggesting that its historical genetic diversity was low. However, this low historical genetic diversity does not imply genetic health, raising concerns about potential vulnerability to extinction.
According to the haplotype network and STRUCTURE results (K = 2), L. geumgangensis and L. mediadiposalis showed distinct genetic differences. This is believed to be a clear distinction owing to the large genetic differences between the species [1]. As a new L. mediadiposalis population was discovered in the Geumgang River, this study required information on the genetic diversity and structure of L. mediadiposalis. This was necessary because measurements of the genetic diversity and structure of L. mediadiposalis may pose ecological threats to L. geumgangensis by processes such as hybridization and competition.
Haplotype network analysis for L. geumgangensis showed a clear distinction between the Geumgang and Mangyeonggang River populations (LgJC vs. LgGJ vs. LgMG). The objective results of population clustering and segmentation showed high delta K values at K = 2 and K = 3 in STRUCTURE [23]. Therefore, the overall results are divided into three populations. The LgJC (Jicheon Stream) and LgGJ (Yongsucheon Stream) populations are tributaries flowing into the Geumgang River. LgJC and LgGJ are in the lower reaches and are located downstream of the Daecheong Dam, where the Geumgang River is divided into the upper, middle, and lower parts. The two Geumgang populations exhibited no shared haplotypes according to FST and haplotype network analyses. Because populations are unlikely to move long distances, it is assumed that there is no genetic exchange between populations. Liobagrus protects its spawning grounds through mating behaviors between males and females [35]. Therefore, 1:1 mating is preferred over 1:many mating [36]. L. geumgangensis is presumed to exhibit ecological behavior similar to Liobagrus, including protecting spawning grounds. However, the haplotype network results suggested limited genetic exchange and low haplotype diversity, concluding that the gene pool was small. However, the small sample size may have led to an interpretation bias. A possible reason for this could be that the gene pool may be biased because of the simultaneous sampling of fry from the same year. However, this possibility is low because the focus of the study was on adult fish, and multiple samplings occurred within a single location. Another possibility is that the limited mobility of L. geumgangensis results in individuals born in one location being sampled through dispersal. Because of their low mobility, they tend to remain in proximity until adulthood. If their habitat, characterized by gravel and shoals, is disrupted, it poses a risk to unique genotypes within populations, presenting challenges from a conservation genetics perspective. Future research is required to develop microsatellite markers and identify their genetic structure. However, the current study has already indicated a limited gene pool because of few haplotypes.
L. geumgangensis is an endemic species of the Geumgang and Mangyeonggang Rivers [1]. An L. mediadiposalis population (LmMJ) was discovered in Muju-namdaecheon in the upper reaches of the Geumgang River. The cytb sequence of this discovery was highly consistent (99.71% BLAST results) with L. mediadiposalis (OP980987) residing in the Nakdonggang River. It is possible that L. mediadiposalis from the Nakdonggang River was introduced into the Geumgang River or was originally native to the Geumgang River. If this is so, determining the haplotype genotype of the population becomes crucial because they will possess identical mtDNA. The BLAST results were not 100% consistent, thereby lacking conclusive evidence of introgression. However, two genetic mutations suggest a potential origin from similar populations. If translocation occurs, upstream L. mediadiposalis will be pushed out through habitat competition with L. geumgangensis located downstream owing to flooding, which may also cause hybridization.
The introduction of L. mediadiposalis poses a potential threat to its persistence because introgression with weak reproductive barriers could occur. Similar threats owing to hybridization following introductions are documented in other taxa [33]. Both hypotheses may be unfavorable for L. geumgangensis from a conservation genetics perspective, suggesting the presence of biological and physical threats. These threats should be further explored using distributional and ecological surveys of L. geumgangensis. Therefore, we believe that this study will contribute to the conservation of L. geumgangensis by investigating its genetic structure using mitochondrial cytb, thereby generating ecological and genetic interest for the conservation of L. geumgangensis.
5. Conservation Implications
L. geumgangensis is an endemic fish species inhabiting clear waters with shoals and pebbles [1]. However, the genetic diversity and structure of L. geumgangensis populations have not been elucidated. Therefore, investigating genetic diversity and structure is crucial as basic data for the conservation and preservation of the L. geumgangensis species [35,36]. In this study, the genetic diversity of L. geumgangensis was found to be lower than that of other freshwater fish populations. The low genetic diversity of the population makes it susceptible to gradual decline, especially in the face of escalating threats like river dam construction and habitat destruction. These species may face extinction if active conservation efforts are not undertaken. Specifically, L. mediadiposalis populations were identified in the upper reaches of the Geumgang River population. Therefore, the populations of tributaries (LgJC, LgGJ) flowing into the river should be designated as conservation areas to prevent the possibility of the interbreeding of L. geumgangensis and prevent them from being pushed out ecologically. Considering the low mobility of the species, each microhabitat requires designation and management as an individual conservation area. Additionally, the genetic diversity of the current downstream Geumgang River population must be maintained. However, since the downstream dispersal of L. mediadiposalis due to flooding cannot be prevented, an ecological distribution survey is needed to identify the exact habitat. Furthermore, conservation efforts should include genetic monitoring of the identified habitat to ensure the preservation of the species. Conservation efforts may need to focus on maintaining the species within aquaculture in a dedicated out-of-habitat conservation institution if preventing the spread of L. mediadiposalis proves challenging.
Conservation strategies should be planned according to genetic structure [8]. In the cytb region of mtDNA, the Geumgang (LgGJ and LgJC) and the Mangyeonggang River populations (LgMG) each had unique haplotypes and genotypes that were genetically distinct. Therefore, each population must be treated as a distinct conservation area. The importance of separately managing them arises from the uncertainty regarding the potential effect of outbreeding on species persistence. As outbreeding can lead to outbreeding depression [29], additional research is necessary to develop independent microsatellite markers in the future. Our results provided valuable information on the genetic basis for the conservation of L. geumgangensis.
6. Conclusions
With respect to the conservation of L. geumgangensis, it has been noted that L. mediadisposalis was found in the upper reaches of the Geumgang River. Therefore, it is recommended to designate the populations of tributaries (LgJC, LgGJ) flowing into the river as protected conservation areas to prevent the hybridization of L. geumgangensis and its ecological displacement. If controlling the spread of introduced L. mediadiposalis proves challenging, it becomes imperative to implement conservation measures within fish farms. This may involve collaboration with non-habitat conservation agencies to ensure the preservation of species. In the cytb region of mtDNA, the two Geumgang populations (LgGJ vs. LgJC) and the Mangyeonggang population (LgMG) had unique haplotypes and genotypes that were genetically different. Therefore, each population was treated as a distinct conservation area. Additional research on the development of independent microsatellite markers is necessary in the future. Our results provide information on the genetic basis for the conservation of L. geumgangensis.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/fishes9050153/s1, Table S1: Sampling sites and number of individuals in the study.
Author Contributions
Conceptualization, K.-R.K. and K.-S.K.; methodology, K.-R.K. and M.-S.S.; software, K.-R.K.; validation, K.-R.K.; data curation, K.-R.K.; writing—original draft preparation, K.-R.K.; writing—review and editing, K.-R.K.; supervision, K.-R.K. and K.-S.K.; project administration, K.-S.K.; funding acquisition, K.-S.K. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the following agencies: National Institute of Ecology (NIE-B-2024-47).
Institutional Review Board Statement
This study was conducted in accordance with the guidelines and regulations of the National Institute of Ecology. All experiments were performed in accordance with ARRIVE-related guidelines and regulations of the National Institute of Ecology. Population samples were collected according to the guidelines set out by the National Institute of Ecology. No permission from the government was required to collect the fish. The authors comply with the relevant institutional, national, and international guidelines and legislation for fish studies. Ethics Committee Name: National Institute of Ecology, Approval Code: NIE-01, Approval Date: 1 January 2023.
Data Availability Statement
The cytb sequence was deposited in GenBank (PP061219–PP061226).
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Kim, S.H.; Yun, S.W.; Park, J.Y. A new species of torrent catfish, Liobagrus geumgangensis (Teleostei, Siluriformes, Amblycipitidae), from Korea. ZooKeys 2023, 1180, 317–332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Daugherty, D.J.; Sutton, T.M. Seasonal movement patterns, habitat use, and home range of flathead catfish in the lower St. Joseph River, Michigan. N. Am. J. Fish. Manag. 2005, 25, 256–269. [Google Scholar] [CrossRef] [Scilit]
- Kadye, W.T.; Booth, A.J. Movement patterns and habitat selection of invasive A frican sharptooth catfish. J. Zool. 2013, 289, 41–51. [Google Scholar] [CrossRef] [Scilit]
- Fonseca, F.S.; Domingues, R.R.; Hallerman, E.M.; Hilsdorf, A.W. Genetic diversity of an imperiled Neotropical catfish and recommendations for its restoration. Front. Genet. 2017, 8, 196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chakona, A.; Gouws, G.; Kadye, W.T.; Mpopetsi, P.P.; Skelton, P.H. Probing hidden diversity to enhance conservation of the endangered narrow-range endemic Eastern Cape rocky, Sandelia bainsii (Castelnau 1861). Koedoe Afr. Protected Area Conserv. Sci. 2020, 62, a1627. [Google Scholar] [CrossRef] [Scilit]
- Kim, K.R.; Choi, H.K.; Lee, T.W.; Lee, H.J.; Yu, J.N. Population structure and genetic diversity of the spotted sleeper Odontobutis interrupta (Odontobutidae), a fish endemic to Korea. Diversity 2023, 15, 913. [Google Scholar] [CrossRef] [Scilit]
- Maxwell, S.L.; Fuller, R.A.; Brooks, T.M.; Watson, J.E. Biodiversity: The ravages of guns, nets and bulldozers. Nature 2016, 536, 143–145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Markert, J.A.; Champlin, D.M.; Gutjahr-Gobell, R.; Grear, J.S.; Kuhn, A.; McGreevy, T.J.; Roth, A.; Bagley, M.J.; Nacci, D.E. Population genetic diversity and fitness in multiple environments. BMC Evol. Biol. 2010, 10, 205. [Google Scholar] [CrossRef] [Scilit]
- Frankham, R. Genetics and extinction. Biol. Conserv. 2005, 126, 131–140. [Google Scholar] [CrossRef] [Scilit]
- Brauer, C.J.; Beheregaray, L.B. Recent and rapid anthropogenic habitat fragmentation increases extinction risk for freshwater biodiversity. Evol. Appl. 2020, 13, 2857–2869. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gurevitch, J.; Padilla, D.K. Are invasive species a major cause of extinctions? Trends Ecol. Evol. 2004, 19, 470–474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frankham, R. Conservation genetics. Annu. Rev. Genet. 1995, 29, 305–327. [Google Scholar] [CrossRef]
- Baltazar-Soares, M.; de Araújo Lima, A.R.; Silva, G. Targeted sequencing of mitochondrial genes reveals signatures of molecular adaptation in a nearly panmictic small pelagic fish species. Genes 2021, 12, 91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, M.Y.; Wang, J.J.; Ren, J.F.; Li, F.; Wu, J.X.; Zhou, J.J.; Li, J.; Yang, J.; Lin, H.D.; Yang, J.; et al. Historical landscape evolution shaped the phylogeography and population history of the cyprinid fishes of Acrossocheilus (Cypriniformes: Cyprinidae) according to mitochondrial DNA in Zhejiang Province, China. Diversity 2023, 15, 425. [Google Scholar] [CrossRef] [Scilit]
- Ríos, N.; Casanova, A.; Hermida, M.; Pardo, B.G.; Martínez, P.; Bouza, C.; García, G. Population genomics in Rhamdia quelen (Heptapteridae, Siluriformes) reveals deep divergence and adaptation in the Neotropical region. Genes 2020, 11, 109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baharum, S.N.; Nurdalila, A.A. Application of 16s rDNA and cytochrome b ribosomal markers in studies of lineage and fish populations structure of aquatic species. Mol. Biol. Rep. 2012, 39, 5225–5232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bórquez, J.; Valdovinos, C.; Brante, A. Genetic structure and diversity in the freshwater gastropod Chilina dombeiana in the Biobío River, Chile. Conserv. Genet. 2020, 21, 1023–1036. [Google Scholar] [CrossRef] [Scilit]
- Höglund, J.; Larsson, J.K.; Corrales, C.; Santafé, G.; Baines, D.; Segelbacher, G. Genetic structure among black grouse in Britain: Implications for designing conservation units. Anim. Conserv. 2011, 14, 400–408. [Google Scholar] [CrossRef] [Scilit]
- Kim, K.R.; Kwak, Y.H.; Sung, M.S.; Cho, S.J.; Bang, I.C. Population structure and genetic diversity of the endangered fish black shinner Pseudopungtungia nigra (Cyprinidae) in Korea: A wild and restoration population. Sci. Rep. 2023, 13, 9692. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamura, K.; Stecher, G.; Mega, K.S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [Scilit]
- Librado, P.; Rozas, J. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 2009, 25, 1451–1452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bandelt, H.J.; Forster, P.; Röhl, A. Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 1999, 16, 37–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Earl, D.A.; VonHoldt, B.M. STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef] [Scilit]
- Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. Clumpak: A program for identifying clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mishmar, D.; Ruiz-Pesini, E.; Golik, P.; Macaulay, V.; Clark, A.G.; Hosseini, S.; Brandon, M.; Easley, K.; Chen, E.; Brown, M.D. Natural selection shaped regional mtDNA variation in humans. Proc. Natl Acad. Sci. USA 2003, 100, 171–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruiz-Pesini, E.; Mishmar, D.; Brandon, M.; Procaccio, V.; Wallace, D.C. Effects of purifying and adaptive selection on regional variation in human mtDNA. Science 2004, 303, 223–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, D.; Huang, Y.; Zeng, Q.; Li, B.; Peng, Z. Genetic diversity and population history among geographic populations of Silurus asotus in different water systems in China based on mtDNA Cytb gene sequences. J. Fish. China 2017, 41, 1489–1499. [Google Scholar]
- Frankham, R.; Ballou, J.D.; Eldridge, M.D.B.; Lacy, R.C.; Ralls, K.; Dudash, M.R.; Fenster, C.B. Predicting the probability of outbreeding depression. Conserv. Biol. 2011, 25, 465–475. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alves, M.J.; Coelho, H.; Collares-Pereira, M.J.; Coelho, M.M. Mitochondrial DNA variation in the highly endangered cyprinid fish Anaecypris hispanica: Importance for conservation. Heredity 2001, 87, 463–473. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mamuris, Z.; Stoumboudi, M.T.; Stamatis, C.; Barbieri, R.; Moutou, K.A. Genetic variation in populations of the endangered fish Ladigesocypris ghigii and its implications for conservation. Freshw. Biol. 2005, 50, 1441–1453. [Google Scholar] [CrossRef] [Scilit]
- Chan, J.; Li, W.; Hu, X.; Liu, Y.; Xu, Q. Genetic diversity and population structure analysis of Qinghai-Tibetan Plateau schizothoracine fish (Gymnocypris dobula) based on mtDNA D-loop sequences. Biochem. Syst. Ecol. 2016, 69, 152–160. [Google Scholar] [CrossRef] [Scilit]
- Hedrick, P.W.; Miller, P.S. Conservation genetics: Techniques and fundamentals. Ecol. Appl. 1992, 2, 30–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matocq, M.D.; Villablanca, F.X. Low genetic diversity in an endangered species: Recent or historic pattern? Biol. Conserv. 2001, 98, 61–68. [Google Scholar] [CrossRef] [Scilit]
- Choi, N.H.; Seo, W.I.; Kim, C.C.; Park, C.K.; Heo, S.J.; Yoon, S.M.; Han, K.; Lee, W.K.; Lee, W. Spawning behavior and Early Life Histoty of the Liobagrus mediadiposalis in the Korean Endemic Species. Korean J. Fish. Aquat. Sci. 2008, 41, 478–484. [Google Scholar]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).


