Next Article in Journal
The Impact of Rutin on Heat Stress Response of Hybrid Fish (Carassius auratus cuvieri ♀ × Carassius auratus Red var. ♂)
Next Article in Special Issue
Effect of Feeding Frequency and Restriction on the Growth Performance, Physiology, and Intestinal Histomorphometry of Colossoma macropomum in a Recirculating Aquaculture System
Previous Article in Journal
Oligochitosan Mitigates Vibrio harveyi Infection in Hybrid Groupers (Epinephelus lanceolatus ♂ × Epinephelus fuscoguttatus ♀) by Modulating Immune Responses and Disease-Related Pathways
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Photoperiod on Nutritional Quality of Muscle and Lipid Metabolism of Litopenaeus vannamei

1
State Key Laboratory of Mariculture Biobreeding and Sustainable Goods, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China
2
Department of Mechanical Engineering, College of Navigation and Ship Engineering, Dalian Ocean University, Dalian 116023, China
3
Rizhao Chuguang Industry Group Co., Ltd., Rizhao 276800, China
4
FSL (HAINAN) Technology Co., Ltd., Haikou 570100, China
5
Wanbao Aquatic Products Co., Ltd., Rizhao 276800, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Fishes 2024, 9(12), 508; https://doi.org/10.3390/fishes9120508
Submission received: 14 November 2024 / Revised: 7 December 2024 / Accepted: 10 December 2024 / Published: 12 December 2024
(This article belongs to the Special Issue Fish Farming in Recirculating Aquaculture Systems)

Abstract

Photoperiod serves as a significant environmental signal for organisms and plays a critical role in regulating their metabolic processes. This research aimed to investigate the lipid metabolism and nutritional quality of adults Litopenaeus vannamei (wet weight: 11.27 ± 0.73 g, body length: 12.45 ± 0.42 cm) under five photoperiods (0L:24D, 8L:16D, 12L:12D, 16L:8D, and 24L:0D) for 40 days in recirculating water systems (RASs). The 24L:0D group increased lipid metabolism, as indicated by increased lipid metabolism enzyme levels and related gene expression linked to lipogenesis. Additionally, shrimp in the 24L:0D exhibited the highest value of crude fat. The 0L:24D showed a significantly reduced content of crude fat compared with the 8L:16D and 12L:12D. In 24L:0D, the content of total essential amino acids (TEAAs), total hydrolyzed essential amino acids (THEAAs), and total non-essential amino acids (TNEAAs) increased significantly. Similarly, the content of polyunsaturated fatty acids (PUFAs) in 24L:0D was also higher than in other groups. Conversely, 0L:24D resulted in lower metabolic activity and a reduction in PUFA content. In conclusion, prolonging light could benefit shrimp cultivation. This study thoroughly examined the effects of varying photoperiods on muscle quality and lipid metabolism in L. vannamei, providing essential insights for the improvement of indoor aquaculture environments. Provision of light for 24 h improves production but has some adverse effects on animal welfare, so a 16 h light cycle is recommended.
Key Contribution: To investigate the different photoperiods affect lipid metabolism and the nutritional value of Litopenaeus vannnamei. The results showed that 24L:0D enhances the concentration of essential amino acids and polyunsaturated fatty acids in the muscle tissue of L. vannamei, thereby promoting lipogenesis and the absorption of fatty acids.

1. Introduction

The shrimp species Litopenaeus vannamei holds substantial commercial value in China, with an aquaculture production reaching 1,429,832 tons in 2023 [1]. This species is mainly raised through pond culture and indoor industrial farming methods. Pond farming is more simple and crude in its management style, with less intervention in the culture environment. In contrast to conventional extensive pond farming, indoor shrimp farming is marked by increased culture densities and better environmental management, providing a more stable habitat for shrimp development [2]. Therefore, it is crucial to investigate the indoor light environment, as alterations in light qualities possess a specific ecological role, potentially affecting species’ physiological and ecological characteristics directly and indirectly.
The light environment is a complex, dynamic, and vital biological element [3], notably including light intensity, photoperiod, and spectral composition. [4,5]. Alterations in light qualities possess a specific ecological role, potentially affecting species’ physiological and ecological characteristics directly and indirectly [6,7]. A multitude of research has established the influence of light on the nutritional composition of muscle tissue in aquatic species. Under the groups of 8L:16D and 12L:12D, Dicentrarchus labrax demonstrated a notable concentration of muscle collagen along with superior muscle quality [8]. In their study, Di et al. revealed that juveniles of Maccullochella peelii exhibited the highest amounts of crude ash and crude fat in muscle when exposed to 1500 lx illumination and an 18L:6D photoperiod [9]. These findings suggest that variations in photoperiod can enhance muscle nutritional value and optimize body composition. The primary time cue for biological rhythms influencing animal growth and development is the photoperiod [10]. This distinct environmental factor that supplies a consistent seasonal rhythm is vital for the appropriate physiological progression of aquatic organisms [11]. Compared with other groups, the values of shell length and body weight growth of Haliotis discus hannai in 4L:20D were significantly higher [4]. The influence of photoperiod on aquatic animals and their environments is considerable, affecting aspects such as survival rates, weight gain, production, spawning patterns, and the molting process in crustaceans [3,4,12]. However, research on how photoperiod affects the nutritional makeup of shrimp muscle remains sparse.
The concentration of polyunsaturated fatty acids (PUFAs) is a significant metric for assessing the nutritional quality of muscle. It has been demonstrated that PUFA can diminish fat synthesis by enhancing fatty acid metabolism or blocking fat synthesis [13]. The hepatopancreas plays a pivotal role in lipid metabolism, significantly contributing to processes like lipogenesis, lipolysis, and transport [14]. A variety of metabolites and the related expression of hepatic enzymes are fundamental to these activities, with certain genes recognized as vital in the pathways of lipogenesis. The sterol regulatory element-binding protein-1 (SREBP-1) is instrumental in fatty acid synthesis [15]. Moreover, (peroxisome proliferator-activated receptor alpha) PPARα serves as an important transcriptional regulator pertinent to adipogenesis and lipid metabolism [16]. Critical enzymes such as fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC) are necessary for the de novo synthesis of fatty acids sourced from both endogenous production and dietary intake [17]. Over the past decade, numerous studies have demonstrated the impact of photoperiods on lipid metabolism in aquatic organisms. Prior research has demonstrated that varying light conditions can influence the microbiome to modify lipid metabolism in Danio rerio [18]. Wei et al. showed that the expression levels of hepatic genes associated with lipogenesis and lipid accumulation (including SREBP-1, FAS, ACC, and PPARα) were elevated in Gibel carp (Carassius auratus) following prolonged exposure to light [19]. In indoor aquaculture systems, photoperiods are essential during extended cultivation periods for aquatic species. Nonetheless, the impact of photoperiod on systemic lipid metabolism in adipose tissue remains ambiguous, necessitating additional research.
While there is increasing evidence that photoperiods influence physiological processes in organisms [20,21], the impact of photoperiods on crustaceans is still inadequately comprehended. This research sought to investigate how photoperiod affects lipid metabolism in L. vannamei and to assess if this effect influences the nutritional quality of its muscle. The results provide new insights into optimal photoperiod strategies for the commercial farming of L. vannamei.

2. Materials and Methods

2.1. Experimental Shrimp and Acclimation

The experiment was conducted at Yuhai Hongqi Ocean Engineering Co., Ltd., located in Rizhao, Shandong, China. For this study, healthy adults of L. vannamei were sourced from a nearby aquaculture facility in Rizhao, each with an average wet weight of 11.27 ± 0.73 g and an average body length of 12.45 ± 0.42 cm. Prior to initiating the trial, all shrimp underwent a one-week acclimatization period in specially designed raising tanks. During this acclimatization phase, the shrimp were fed an experimental diet, which was provided three times a day at set intervals: 06:00, 13:00, and 20:00. This careful preparation aimed to ensure that the shrimp were well adapted to their environment and the diet, thereby contributing to the reliability of the experimental results.

2.2. Experimental Design

In the investigations conducted, five photoperiods were evaluated, specifically 0L:24D, 8L:16D, 12L:12D, 16L:8D, and 24L:0D (L: light; D: dark). These photoperiods utilized full spectrum light, characterized by a peak wavelength ranging from 400 to 800 nm, with a specific intensity of 1 W/m² [22]. To accurately assess the peak wavelengths of light intensity, a spectroradiometer known as the PLA-20 Plant Lighting Analyzer, obtained from Hangzhou, China, was employed. This device was instrumental in measuring the light intensity at a distance of 2 cm above the water surface, ensuring that the observed peaks consistently remained within the predetermined range. The placement of the light sources was carefully considered, as they were positioned 10 cm above the tank to maintain consistent lighting conditions. It is also noteworthy that the light source was kept stationary throughout the experiments, which helped eliminate potential variations in light intensity or wavelength that could have arisen from any movement. By maintaining such controlled conditions, the investigations aimed to robustly evaluate the effects of these various photoperiods on the subjects being studied. Breeding pools, oxygen diffusers, drum-type microfilters, sedimentation tanks, biofilters, and UV sterilization were the main components of this system. The system established several automatic timers (GND-1 automatic power-off timer, China) to regulate the light cycle. The switching light activates and deactivates instantaneously, with no apparent stress exhibited by the shrimp. The lights were set to activate at 6:00 AM to replicate the commencement of the natural daylight cycle. The different treatment groups were separated by black-out cloths to avoid light pollution and mutual interference. The experiment was conducted after one week of acclimatization to the specific experimental circumstances. Each group comprised three tanks (diameter: 120 cm, height: 110 cm, volume: 800 L), with each tank containing 120 shrimp. The shrimp were fed commercial feed produced by Wudi Xingchang Aquatic Technology Co., LTD, Binzhou, China, which contained crude protein ≥ 42%, crude fiber ≤ 5%, crude lipid ≤ 5%, crude ash ≤ 16%, and moisture content ≤ 12%. The feed granule size was 1.2 mm. To ensure optimal nutritional intake, a feeding regimen was established, delivering a quantity that corresponds to 5% of the shrimp’s body weight three times a day—specifically at 06:00, 13:00, and 20:00. Each group was exposed to only a few light rays during the dark periods from the water exchange and feeding. This structured feeding schedule is essential for meeting the dietary needs of the shrimp and promoting their growth and health. The experiment with shrimp was cultured in a recirculating aquaculture system (RAS). The environmental conditions within the tanks were carefully monitored and regulated, with the temperature maintained at 26 ± 1 °C, salinity levels kept between 27 and 29 (Delixi Handheld Temperature Refill Salinity Refractometer, Zhejiang Yueqing Delixi Group Co., LTD, China), pH levels adjusted to 7.6 ± 0.1 (PH100-1, Watenv Water Quality PH Meter, Produced by Shanghai Watenv Technology (Shanghai) Co., LTD, Shanghai, China), and dissolved oxygen concentration consistently above 8.0 mg/L (AR8406, Smart Dissolved Oxygen Meter, Fujian Xiamen Xinrui Instrument Co., LTD, Xiamen, China). The levels of total ammonium nitrogen (TAN) and nitrite in all treatments were measured daily using the methodologies outlined by reference [23,24]. The concentrations were maintained at TAN ≤ 0.2 mg/L and nitrite ≤ 0.1 mg/L.

2.3. Samples Preparation and Calculations

Following the 40-day trial, each shrimp underwent a fasting period of 24 h prior to the final sampling [25]. At the end of the experiment, three shrimp were randomly chosen from each tank and sedated using tricaine mesylate (MS-222) (6 g/L) [26]. The hepatopancreas was extracted, frozen in liquid nitrogen, and subsequently stored at −80 °C. Relevant segments (n = 9) of their abdominal muscles were collected, transferred to 15 mL cryotubes, and preserved in a −80 °C freezer for the analysis of nutritional composition, fatty acid profile, and amino acid content.

2.4. Lipid and Enzyme Analysis

A comprehensive biochemical analysis was undertaken utilizing hepatopancreas samples collected from six individuals in each group. To prepare these samples for analysis, they were first homogenized in a 0.9% normal saline solution. The samples were homogenized in centrifugation at a force of 825× g (equivalent to 3000 rpm) for a duration of 20 min at a temperature of 4 °C. This process was essential for separating the cellular components and obtaining a clear supernatant for further analysis. Subsequently, the fatty acid synthase (FAS) (pg/mL), carnitine palmitoyltransferase-1 (CPT-1)(pg/mL), and acetyl-CoA carboxylase (ACC) (nmol/min/mg prot) values of the hepatopancreas were determined using commercial kits (Jiancheng Bioengineering Institute, Nanjing, China).

2.5. Routine Nutritional Components and Fatty Acids and Amino Acids Analysis

In accordance with the GB 5009.3-2016 [27], the content of moisture (n = 9) was carried out using the direct-drying method at a temperature of 105 °C. To assess the crude protein content (n = 9), we employed the micro-Kjeldahl method, as described in GB 5009.5-2016 [28]. This method is widely recognized for its effectiveness in determining nitrogen content, which is used to estimate the protein levels in the sample. The analysis of crude fat content (n = 9) was conducted using the Soxhlet extraction method, following the guidelines set forth in GB 5009.6-2016 [29]. This technique is known for its efficiency in extracting lipids from solid matrices, thereby providing an accurate measurement of fat content. For the assessment of ash content (n = 9), the muffle furnace volatilization method was utilized, adhering to the protocol established in GB 5009.4-2016 [30]. This method allows for the determination of inorganic residues present in the sample after the organic matter has been burned off. Additionally, we followed the standards outlined in GB 5009.124-2016 [31] for the testing of amino acids and GB 5009.168-2016 [32] for the detection of fatty acids (n = 9). These guidelines ensure that our analyses are conducted in a manner that is both systematic and compliant with established protocols in the field.

2.6. Muscle Nutritional Quality Evaluation

Modern techniques for evaluating the nutritional quality of muscle tissue encompass various methods, including the amino acid score (AAS), the chemical score (CS), and the essential amino acid index (EAAI). Each of these assessment techniques is based on a standardized measure of amino acid content, specifically the amino acid score per gram, which was initially established in 1973 by the Food and Agriculture Organization of the United Nations/World Health Organization (FAO/WHO) [33]. This foundational standard serves as a crucial framework for evaluating the protein quality in muscle. Moreover, the guidelines set forth by the Institute of Nutrition and Food Hygiene at the Chinese Academy of Preventive Medical Sciences (CAPMS) in 1991 [34] also play a significant role in these evaluations. These guidelines provide additional insights into the standards of nutritional quality assessment. Particularly important is the amino acid composition of whole egg protein that CAPMS identified in the same year; this composition acts as an essential reference point for comparing and assessing the quality of muscle proteins. By using whole egg protein as a benchmark, researchers and nutritionists can more accurately determine the nutritional value of various muscle proteins, allowing for more informed dietary choices and recommendations.
aa = (Mass fraction of this amino acid in the sample/Mass fraction of crude protein in the sample) × 6.25 × 1000.
AAS = aa/AA(FAO/WHO)
CS = aa/AA (egg)
EAAI = (100A/AE × 100B/BE × 100C/CE × … × 100H/HE)1/n
In the context of this study, the variable “aa” refers to the concentration of a particular amino acid present in the test sample, measured in milligrams per gram (mg/g). On the other hand, “AA (FAO/WHO)” represents the standard reference concentration for that same amino acid as established by the Food and Agriculture Organization and the World Health Organization, also given in mg/g. Additionally, “AA (egg)” denotes the concentration of the same amino acid found in whole egg protein, again measured in mg/g. Moreover, the variable “n” signifies the total number of essential amino acids that are considered for the purposes of comparison. One will find that “A, B, C, …, H” are used to represent the concentrations of specific essential amino acids found in fish muscle protein, also quantified in mg/g. In parallel, the variables “AE, BE, CE, …, IE” correspond to the concentrations of various essential amino acids present in whole egg protein, similarly expressed in mg/g. Thus, the text effectively outlines the methodology for measuring and comparing the concentrations of essential amino acids in both fish muscle and egg protein.

2.7. Quantitative Reverse Transcription PCR (qRT-PCR) Analysis

The procedure for extracting total RNA from the hepatopancreas was carried out using the Trizol Reagent, which is manufactured by Invitrogen in the USA. Following this extraction process, the isolated RNA was utilized to synthesize complementary DNA (cDNA) with the aid of the HiFiScript cDNA Synthesis Kit produced by CW Biotech Co., Ltd. in Shanghai, China. Specifically, 2 μg of the extracted RNA was utilized for this cDNA synthesis, forming an essential component for subsequent analysis. For the quantitative PCR (qPCR) analysis, a Roche thermal cycler (LightCycler 96 produces by Roche Pharmaceuticals, Switzerland) was employed in conjunction with SYBR Green I, a fluorescent dye sourced from CW Biotech Co., Ltd., Beijing, China. This qPCR method was supported by specific primers listed in Table 1, alongside β-actin, which was utilized as a reference or housekeeping gene based on the work of Xie et al. [35]. We have used NCBI’s Primer-BLAST for primer validation. To guarantee the results’ precision and dependability, all quantitative reverse transcription PCR (qRT-PCR) assays were conducted in triplicate and repeated thrice. The procedure for qPCR began with an activation phase where the samples were heated to 95 °C for 2 min. Following this heating step, 45 cycles were carried out, including 10 s at 95 °C, 10 s at 55 °C, and 20 s at 72 °C. An important procedure to validate the specificity of the primers included executing a melting curve analysis, which entailed a gradual temperature increment from 55 °C to 95 °C at the end of the qPCR process. Ultimately, to accurately measure the expression levels of the target genes, normalization against β-actin was performed utilizing the optimal comparative 2−ΔΔCT method as established [36].

2.8. Data Analysis

Data are expressed as the mean ± standard deviation (mean ± SD). Enzyme activity and gene expression were evaluated using one-way analysis of variance (ANOVA), applying the Duncan method for multiple comparisons. Statistical significance was considered at p < 0.05. All analyses were performed with SPSS software version 22.0.

3. Result

3.1. Lipid Metabolism Enzyme

Different photoperiods significantly affected the activity levels of CPT1, ACC, and FAS enzymes (Figure 1). In comparison to the 12L:12D group, the hepatopancreas showed a notable decrease in CPT1 levels in the 24L:0D group (p < 0.05) (Figure 1A). The level of the CPT1 in the 12L:12D group was 1.62 pg/mL, and the highest activity was found in the 24L:0D and the lowest in the 0L:24D group as compared to the 12L:12D group (p < 0.05). The level of the ACC in the 12L:12D group was 15.80 pg/mL. Levels of ACC were considerably higher in shrimp raised under 24L:0D and 16L:8D groups when compared to all other groups (p < 0.05) (Figure 1B). Furthermore, the level of the FAS in the 12L:12D group was 15.60 nmol/min/mg prot. The activity of FAS was significantly elevated in the 24L:0D group compared to all other groups (p < 0.05) (Figure 1C). The activities of CPT1, ACC, and FAS in the 24L:0D group showed significant increases compared to the 0L:24D group (p < 0.05) and were also markedly higher than in the other groups (p < 0.05). All three enzymes followed a consistent trend from high to low, arranged as follows: 24L:0D, 16L:8D, 12L:12D, 8L:16D, and 0L:24D (p < 0.05) (Figure 1A–C).

3.2. Body Composition

The findings for moisture content, crude fat, crude protein, and ash are presented in Table 2. The crude protein was higher in the 12L:12D group than in the others (p < 0.05). Shrimp in the 24L:0D exhibited the highest crude lipid concentration, whereas the 0L:24D condition revealed a significantly reduced crude fat content compared to the 8L:16D and 12L:12D groups (p < 0.05). No substantial difference was seen in the crude lipid content between the 12L:12D and 16L:8D (p > 0.05).

3.3. Amino Acid Composition and Nutritional Value Analysis

3.3.1. Amino Acid Composition

The composition and concentration of amino acids in the muscles of L. vannamei across five different photoperiods are summarized in Table 3. Analysis of muscle samples from five groups of L. vannamei revealed the presence of sixteen amino acids (with tryptophan excluded), which comprised seven essential amino acids (EAAs), four non-essential amino acids (NEAAs), and four semi-essential amino acids. No significant differences in the total amino acid (TAA) mass fractions among the groups exposed to 16L:8D and 24L:0D were observed, with respective values of 19.91 ± 0.71% and 20.20 ± 0.17%. In contrast, the total amino acid mass fractions for the 0L:24D, 8L:16D and 12L:12D groups were considerably lower, at 17.38 ± 0.55%,19.69 ± 0.47% and 18.32 ± 1.69%, respectively, when compared to the previous two groups. In all groups, glutamic acid (Glu) contributed a greater mass fraction of umami amino acids than the others. Furthermore, arginine represented the largest proportion among the semi-essential amino acids. The group exposed to 24L:0D showed the highest arginine mass fraction, significantly surpassing that of the other groups (p < 0.05). The 8L:16D and 16L:8D groups had the lowest mass fraction of histidine (His), which was significantly less than that of the other groups (p < 0.05). Among non-essential amino acids, proline had the highest mass fraction relative to the others. In the 0L:24D group, proline’s mass fraction was significantly lower than in the 16L:8D group (p < 0.05). Additionally, the proline mass proportion in the 16L:8D group was slightly higher than in the 8L:16D, 12L:12D, and 24L:0D groups, although these differences were not statistically significant (p > 0.05).

3.3.2. Nutrition Assessment

Table 4 shows that the scores for Thr and Phe + Tyr across the five photoperiods exceeded those outlined by the FAO/WHO model. Additionally, the content of Lys was above the evaluation criteria set by both the FAO/WHO and the egg protein models. In the 24L:0D group, the levels of Val, Met + Cys, Leu, and Ile were similar to or greater than those indicated in the FAO/WHO pattern, while the total essential amino acids (TEAAs) were above the FAO/WHO guideline. Moreover, the total of essential amino acids in the 24L:0D group surpassed that of the other groups, whereas in the 8L:16D group, the scores for all essential amino acids (EAAs) were lower than those of the other cohorts. The 8L:16D group showed poorer scores for every essential amino acid in comparison to the other groups, with the lowest values recorded for Met + Cys and Leu.
Table 5 illustrates that the amino acid score (AAS) and chemical score (CS) of essential amino acids in the muscles of L. vannamei across varying photoperiods consistently approached or surpassed 1.00, with the CS remaining above 0.50. Furthermore, the AAS and CS for each essential amino acid primarily reached their peak in the 24L:0D condition. In addition, Val was recognized as the main limiting amino acid in both the 0L:24D and 24L:0D groups, whereas Met + Cys emerged as the predominant limiting amino acid in the 8L:16D, 16L:8D, and 12L:12D groups. The 24L:0D condition showed the highest essential amino acid index (EAAI), trailed by the 16L:8D group, while the lowest rankings were found in the 0L:24D, 12L:12D, and 8L:16D groups.

3.4. Fatty Acids Composition

The composition of fatty acids in the muscle of L. vannamei across five photoperiods is summarized in Table 6. A total of 25 fatty acids were identified in each group, consisting of 9 saturated fatty acids, 6 monounsaturated fatty acids, and 10 polyunsaturated fatty acids. Notably, the levels of total saturated fatty acids (SFAs) in the muscles demonstrated significant variation among the five groups. Specifically, the 24L:0D, 12L:12D, and 16L:8D groups showed markedly higher muscle SFA content compared to the 0L:24D and 8L:16D groups (p < 0.05). Among the saturated fatty acids, palmitic acid (C16:0) was present in greater amounts than the others across all groups, with the C16:0 concentration in the 24L:0D group significantly exceeding that of the 8L:16D group (p < 0.05), and also being elevated in comparison to the remaining groups. The total content of MUFA did not vary between groups; however, the concentration of trans-9-octadecenoic acid (C18:1n9t) was found to be the lowest in the 0L:24D group, which was significantly less than that in the 24L:0D group (p < 0.05). In the 8L:16D group, Methyl Nervonate (C24:1) also showed the highest levels compared with other groups (p < 0.05); overall, the MUFA content indicated no significant differences among the groups. In contrast, the content of PUFA displayed significant differences among the groups, with the 0L:24D group presenting the lowest overall PUFA content, which was considerably lower than that in the 24L:0D group, but not statistically different from the remaining three groups. Levels of EPA (C20:5n3) and DHA (C22:6n3) did not show significant variation across the groups.

3.5. Lipid Metabolism-Related Genes

The expression of PPARα, PPAR-γ coactivator 1α(PGC-1α), Rec-erbα, retinoic acid-related orphan receptor alpha (RORα), and SREBP1-C genes is shown in Figure 2 for the hepatopancreas. Notably, shrimp belonging to the 24L:0D group exhibited the highest relative expression of lipogenesis-related genes (Figure 2A–E). A significant decrease in PPARα expression within the hepatopancreas was observed in the 0L:24D group when compared to the 12L:12D group (p < 0.05) (Figure 2A). In shrimp subjected to the 24L:0D condition, PGC-1α expression levels were significantly elevated relative to the other experimental groups (p < 0.05) (Figure 2B). Furthermore, RORα expression showed a significant increase in the 24L:0D group (p < 0.05) (Figure 2D). The hepatopancreas of shrimp under the 0L:24D condition demonstrated a significant reduction in the relative expression of Rec-erbα and SREBP1-C. Conversely, the highest relative expression was recorded in the 24L:0D and 12L:12D groups (p < 0.05) (Figure 2C,E).

4. Discussion

The enzymes carnitine palmitoyl transferase 1 (CPT1), fatty acid synthase (FAS), and acetyl-CoA carboxylase (ACC) are essential for regulating hepatic lipid metabolism in most species examined [37]. The research reveals a notable increase in the activity of these hepatic enzymes linked to lipogenesis and lipid accumulation with prolonged exposure to light. By concentrating on species like rainbow trout (Oncorhynchus mykiss), Nile tilapia (Oreochromis niloticus), and Amago salmon (Oncorhynchus masouishikawae), previous studies [36,37,38,39,40] affirm that FAS and ACC are pivotal in the adipogenesis process. Our research further suggests that continuous exposure to light conditions may promote lipid deposition within the hepatopancreas, which can be attributed to the enhanced activity of enzymes involved in lipogenesis, namely FAS, CPT1, and ACC. These observations are consistent with the established literature. For instance, under simulated winter conditions characterized by a photoperiod of 9 h of light followed by 15 h of darkness (9L:15D), there was a reported decrease in the activities of both FAS and ACC in various fish species, including green sunfish (Lepomis cyanellus), largemouth bass (Micropterus salmoides), brook trout (Salvelinus fontinalis), and yellow perch (Perca flavescens) as noted [41]. Conversely, male estuary fish (Menidia beryllina) subjected to shorter photoperiods of 9.5 h light to 14.5 h dark and 12 h light to 12 h dark exhibited a notable increase in visceral fat when compared to those kept under conditions of 15 h light to 9 h dark [42]. Furthermore, Davis and McEntire found that the effects of different photoperiods (8L:16D and 16L:8D) on the abdominal adipose tissue of white bass (Lepomis gibbosus) seemed to be negligible [43].
Muscles are vital for assessing meat quality as aquatic organisms’ principal nutritional and consumable element. The composition, encompassing crude protein, crude fat, and other components, signifies the entire nutritional worth of these animals. L. vannamei, recognized for its low fat and high protein content, is a species of considerable commercial and nutritional importance [7]. Muscle quality in aquatic animals is chiefly influenced by species, environment, and diet, with fluctuations in environmental circumstances and food compositions affecting muscle quality [44]. Specific research indicates light environment alterations can affect aquatic organisms’ nutritional composition. Wang et al. examined the impact of varying durations of ultraviolet A (UVA) supplemental light on the muscle nutrient composition of L. vannamei, discovering that extended UVA exposure caused stress, resulting in nutrient depletion and a reduction in crude fat content in the muscle [45]. Comparable findings were noted in the current investigation, wherein the muscle crude fat content diminished in the 0L:24D group, indicating that extended darkness elicited stress and nutrition depletion in L. vannamei. Research suggests that varying photoperiods significantly influence the crude fat content in the muscles of Murray cod (Macculochella peeli), specifically 15L:9D > 12L:12D [9]. This effect may be attributed to light-induced stress, which alters the stress behavior of Murray cod and subsequently impacts the organism’s metabolic activities. It has been proposed that stress in aquatic animals induces alterations in the body’s regulatory mechanisms, resulting in heightened metabolic activity, energy redistribution, and subsequent impacts on nutritional composition [45]. Furthermore, variations in the crude fat content of muscle can indicate the body’s metabolic status to a certain degree [46]. This study demonstrated that the crude fat content of muscle in the 0L:24D group was much lower than in the other groups, likely attributable to stress-induced modifications in lipid metabolic pathways under continuous darkness. Conversely, the maximum crude fat concentration was observed, whereas muscle moisture and crude ash content exhibited no significant variation across the various photoperiods. Furthermore, total darkness has markedly diminished muscle protein content, with the lowest crude protein levels recorded in the 0L:24D group in this study. The 24L:0D light state is more favorable for L. vannamei and enhances the traditional nutrient content inside the muscle.
Protein, a fundamental ingredient in meals, is predominantly constituted of diverse amino acids, and the freshness of muscle is intricately linked to its amino acid composition [47]. The study demonstrated that the overall amino acid content was diminished in the 0L:24D and 8L:16D groups relative to the 24L:0D and 16L:8D groups. The protein content of feed influences the overall amino acid content of muscle, and the reduced total amino acid content in the 0L:24D and 8L:16D groups, despite uniform artificial feeding conditions, may be ascribed to diminished bait conversion efficiency. This inefficiency likely arises from impaired food utilization, reducing total muscle amino acid content. Amino acids like Asp and Glu, essential for the umami flavor, predominantly influence the composition of umami amino acids in animal muscles [48]. Glycine and alanine are distinctive amino acids that contribute to a sweet taste. Gly not only promotes the freshness of fish muscle but also augments the antioxidative stress capacity of fish [49]. Research indicates that incorporating glycine into feed can significantly enhance antioxidant and anti-stress capacities in Larimichthys crocea [50]. In this experiment, the Gly content in the 0L:24D group was markedly lower than in the 24L:0D group, presumably due to the suppression of glycine synthesis in muscle during prolonged darkness. The concentrations of TEAA, THEAA, and TNEAA were markedly elevated in the 24L:0D group compared to the other groups, suggesting that the nutritional quality of L. vannamei improved under continuous light circumstances. According to the optimal protein standards set by FAO/WHO, about 40% of total amino acids should consist of essential amino acids, and the ratio of primary amino acids to non-essential ones ought to be greater than 60% [49]. In the present study, we found that the content of EAA/TAA content were about 35% and EAA/NEAA levels were about 80% in the five groups, which was close to or significantly exceeded the ideal pattern scores. The maximum values of threonine, glutamic acid complex and Lys were found in the muscle of shrimp at 24L:0D; these ratios are close to or significantly exceed the ideal pattern score. Additionally, this group exhibited the highest total amounts of amino acids and essential amino acids, indicating that L. vannamei possesses superior nutritive value under the 24L:0D. The EAAI is a significant metric for assessing the nutritional quality of proteins, indicating the equilibrium of amino acid composition and overall protein quality [51]. The highest EAAI of 83.56 was recorded in the 24L:0D group, signifying that the muscle proteins of L. vannamei exhibited excellent quality under continuous light circumstances and adhered to amino acid composition criteria.
Fatty acids are classified into saturated and unsaturated forms, serving as the primary constituents of phospholipids, neutral fats, and glycolipids [52]. C14:0, C16:0, and C18:0 represent the predominant saturated fatty acids in living organisms, with C16:0 being the most prevalent [53]. Upon exposure to external stimuli, saturated fatty acids undergo catabolism, with C16:0 being preferentially used for energy production [54]. This study revealed that the five groups demonstrated elevated amounts of C14:0, C16:0, and C18:0 relative to other saturated fatty acids. The minimal overall quantity of saturated fatty acids and the lowest concentration of C16:0 in the 0L:24D group may be ascribed to energy expenditure generated by stress during extended darkness. EPA and DHA are the essential polyunsaturated fatty acids necessary for the growth of humans and animals [55]. EPA and DHA are essential for the development of the brain, optic nerve, and reproductive organs in aquatic species throughout early growth stages [56]. The concentration of PUFA is a crucial metric for assessing the nutritional integrity of muscle tissue. This study revealed that the 24L:0D group exhibited the highest EPA+DHA content, whereas the 0L:24D group demonstrated the lowest levels, indicating that continuous light conditions facilitate the synthesis and accumulation of EPA and DHA in shrimp. The processes by which photoperiod influences fatty acid production in the muscle of L. vannamei are not yet understood and require additional research.
Lipids are essential components in the biology of crustaceans, as they fulfill multiple vital functions. Primarily, they act as a significant energy reserve, which is crucial for the survival and metabolic activities of these organisms [18]. Additionally, lipids play an important role in preserving the structural integrity of both cellular membranes and subcellular membranes, ensuring that cellular functions can be carried out effectively [57]. The regulation of lipid accumulation within crustaceans is a complex process that depends on the interplay between two key metabolic pathways: lipogenesis and lipolysis. Lipogenesis is the process through which lipids are synthesized and stored, while lipolysis refers to the breakdown of these lipids for energy use. The balance between these opposing processes determines the overall lipid content in these organisms and is critical for their physiological health and energy management [58]. When lipid accumulation becomes excessive, it may cause metabolic problems in aquatic animals, which can detrimentally affect their growth performance and overall health [59]. A diet that includes suitable lipids, which are essential energy sources for aquatic growth, may offer protein-sparing advantages, thereby promoting improved growth performance and enhanced feed conversion efficiency [60,61]. Studies conducted on different fish species have shown that excessive lipid accumulation in the liver or other tissues can result in issues like hyperlipidemia, fatty liver disease, and lipid peroxidation, potentially jeopardizing growth and overall wellbeing [62]. Research reveals that PUFA can reduce fat formation by augmenting fatty acid metabolism or inhibiting lipogenesis [13]. The current study demonstrated that the activities of lipolysis-related enzymes (FAS, CPT-1, and ACC) were augmented, and the polyunsaturated fatty acid (PUFA) content in muscle nutrition was considerably elevated compared to other groups with prolonged light exposure. Subsequent research revealed that the 24L:0D group consistently demonstrated elevated expressions of lipogenesis-associated genes (PPARα, PGC-1α, Rec-erbα, RORα, and SREBP1-C), corroborating the findings of Forman et al., which indicated that PUFA can activate PPARα transcriptional activity by functioning as a ligand, thus enhancing PUFA levels in muscle [63]. The significant accumulation of lipids indicates that these molecules were effectively utilized as a source of energy, resulting in improved growth performance, unlike the observations made in juvenile turbot (Scophthalmus maximus L.) and hybrid grouper [64]. The findings imply that continuous exposure to light could enhance lipid storage in the hepatopancreas by boosting the activity of enzymes associated with lipogenesis, such as FAS, CPT-1, and ACC, along with the activation of lipogenesis-related genes, which include PPARα, PGC-1α, Rec-erbα, RORα, and SREBP1-C. This highlights the crucial role of light in the cultivation of shrimp under controlled conditions, where natural light availability might be limited. Based on these results, a light cycle consisting of 24 h of illumination followed by no darkness is recommended.
In addition, the outcomes of this study could provide significant insights for shrimp aquaculture on land. However, because the parameters were assessed individually, further research is required to determine the optimal combination of photoperiod, intensity, and spectrum in order to create a standardized lighting management protocol for L. vannamei. Moreover, specific research suggests that the different wavelengths of light have an effect on L. vannamei, with green wavelengths being more suitable for the culture of L. vannamei in biofloc systems [11]. Further comprehensive studies on L. vannamei in combination with different light elements are needed.

5. Conclusions

This research investigated how different photoperiods affect lipid metabolism and the nutritional value of L. vannamei. The results showed that 24L:0D enhances the concentration of EAA and PUFA in the muscle tissue of L. vannamei, thereby promoting lipogenesis and the absorption of fatty acids. This suggests that extended light exposure, specifically through a 24L:0D regimen, can significantly improve the nutritional value of the muscle in L. vannamei. Consequently, careful management of lighting is crucial for indoor aquaculture systems to improve shrimp quality and yield. It is advisable to avoid a continuously dark environment. The findings from this research provide valuable information for indoor shrimp farming.

Author Contributions

Conceptualization, B.L.; methodology, B.L. and Y.F.; software, F.F., W.L. and Y.S.; validation, F.F.; formal analysis, F.F. and H.Y.; investigation, H.Y. and X.G.; resources, B.L.; data curation, Y.F.; writing original draft preparation, Y.F. and C.Z. (Chengliang Zhu); writing review and editing, F.F.; visualization, Y.F.; supervision, B.L.; project administration, B.L., C.Z. (Chuanxin Zhang) and F.G.; funding acquisition, B.L. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Key R&D Program of China (2023YFD2400403); Taishan Industrial Experts Program; National Key R&D Program of China (2022YED2001704); Agriculture Research System of MOF and MARA (CARS-47-G24); Central Public-interest Scientific Institution Basal Research Fund, CAFS (No. 2023TD53).

Institutional Review Board Statement

All the procedures performed in the studies involving animals were in accordance with the guidelines and ethical standards of the Chinese Academy of Fishery Sciences and its later amendments or comparable ethical standards.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

Author Hongjun Yang was employed by the company Rizhao Chuguang Industry Group Co., China; Author Yan Sun was employed by the company FSL (HAINAN) Technology Co., Ltd., Haikou, China; Author Chuanxin Zhang was employed by the company Wanbao Aquatic Products Co., Ltd., Rizhao, China. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Bureau of Fisheries. China Fishery Statistics Yearbook; Ministry of Agriculture, China Agriculture Press: Beijing, China, 2024.
  2. Zhou, C.; Xu, D.M.; Lin, K.; Sun, C.H.; Yang, X.T. Intelligent feeding control methods in aquaculture with an emphasis on fish: A review. Rev. Aquac. 2017, 10, 975–993. [Google Scholar] [CrossRef]
  3. Sallemi, J.E.; Di Yorio, M.P.; Hermida, G.N.; Breccia, A.; Battista, A.G.; Vissio, P.G. The saccus vasculosus of the neotropical cichlid fish cichlasoma dimerus: Characterization, developmental studies and its response to Photoperiod. Cell Tissue Res. 2024, 397, 97–110. [Google Scholar] [CrossRef] [PubMed]
  4. Gao, X.L.; Zhang, M.; Li, X.; Wu, F.C.; Song, C.B.; Liu, Y. Light cycle effects on Haliotis discus hannai Ino growth, energy budget, and related gene Expression. Aquaculture 2018, 483, 213–222. [Google Scholar] [CrossRef]
  5. Yang, M.F.; Chen, Z.L.; Hu, F.Y.; Sun, J.N.; Ding, J.Y.; Chang, Y.Q.; Zhao, C. Light spectra regulated foraging and feeding behaviors shed light on stock enhancement of the sea urchin strongylocentrotus Intermedius. Aquac. Rep. 2020, 18, 100480. [Google Scholar] [CrossRef]
  6. Begtashi, I.; Rodríguez, L.; Moles, G.; Zanuy, S.; Carrillo, M. Long-term exposure to continuous light inhibits precocity in juvenile male european sea bass (Dicentrarchus labrax, L.). I. Morphological Aspects. Aquaculture 2004, 241, 539–559. [Google Scholar] [CrossRef]
  7. Rodríguez, R.; Felip, A.; Cerqueira, V.; Hala, E.; Zanuy, S.; Carrillo, M. Identification of a photolabile period for reducing sexual maturation in juvenile male sea bass (Dicentrarchus labrax) by means of a continuous light Regime. Aquac. Int. 2012, 20, 1071–1083. [Google Scholar] [CrossRef]
  8. Li, X.; Wei, P.P.; Liu, S.T.; Ma, H.; Zhang, J.P.; Liu, Y.; Tian, Y. Comparative study of the growth, feeding, amino acid composition, and nutritional quality of Dicentrarchus labrax juveniles under different light photoperiods. J. Fish. Sci. China 2020, 27, 1062–1074. [Google Scholar] [CrossRef]
  9. Di, Z.K.; Li, K.; Liu, R.C.; Wang, G.X.; Lu, Q.; Li, T.Z.; Yan, L.; Jiang, H.F.; Liu, L.P. Effects of photoperiod and light intensity on the growth, muscle nutrition and economic performance of Murray cod (Maccullochella peelii) in the recirculating aquarium System. Acta Hydrobiologica. Sinica 2021, 45, 781–789. [Google Scholar] [CrossRef]
  10. Bromage, N.; Porter, M.; Randall, C. The environmental regulation of maturation in farmed finfish with special reference to the role of photoperiod and Melatonin. Aquaculture 2001, 197, 63–98. [Google Scholar] [CrossRef]
  11. Wood, S.; Loudon, A. Clocks for all seasons: Unwinding the roles and mechanisms of circadian and interval timers in the hypothalamus and Pituitary. J. Endocrinol. 2016, 228, X1. [Google Scholar] [CrossRef]
  12. Reis, W.G.; Wasielesky Jr, W.; Abreu, P.C.; Brandão, H.; Krummenauer, D. The influence of different light wavelengths in the culture of the Pacific white shrimp Litopenaeus vannamei reared in BFT using LED Lights. Aquaculture 2023, 563, 2. [Google Scholar] [CrossRef]
  13. García-Jaramillo, M.; Lytle, K.A.; Spooner, M.H.; Jump, D.B. A lipidomic analysis of docosahexaenoic acid (22:6, ω3) mediated attenuation of western diet induced nonalcoholic steatohepatitis in male ldlr−/− Mice. Metabolites 2019, 9, 252. [Google Scholar] [CrossRef] [PubMed]
  14. Sheridan, M.A. Lipid dynamics in fish: Aspects of absorption, transportation, deposition and Mobilization. Comp. Biochem. Physiol. Part B Comp. Biochem. 1988, 90, 679–690. [Google Scholar] [CrossRef] [PubMed]
  15. Horton, J.D.; Goldstein, J.L.; Brown, M.S. SREBPs: Activators of the complete program of cholesterol and fatty acid synthesis in the Liver. J. Clin. Investig. 2002, 109, 1125–1131. [Google Scholar] [CrossRef] [PubMed]
  16. Grimaldi, B.; Bellet, M.M.; Katada, S.; Astarita, G.; Hirayama, J.; Amin, R.H.; Granneman, J.G.; Piomelli, D.; Leff, T.; Sassone-Corsi, P. PER2 controls lipid metabolism by direct regulation of PPARγ. Cell Metab. 2010, 12, 509–520. [Google Scholar] [CrossRef] [PubMed]
  17. Munday, M.R. Regulation of mammalian Acetyl-CoA Carboxylase. Biochem. Soc. Trans. 2002, 30, 1059–1064. [Google Scholar] [CrossRef]
  18. Basili, D.; Lutfi, E.; Falcinelli, S.; Balbuena-Pecino, S.; Navarro, I.; Bertolucci, C.; Capilla, E.; Carnevali, O. Photoperiod Manipulation Affects Transcriptional Profile of Genes Related to Lipid Metabolism and Apoptosis in Zebrafish (Danio rerio) Larvae: Potential Roles of Gut Microbiota. Microb. Ecol. 2020, 79, 933–946. [Google Scholar] [CrossRef]
  19. Wei, H.; Cai, W.J.; Liu, H.K.; Han, D.; Zhu, X.M.; Yang, Y.X.; Jin, J.Y.; Xie, S.Q. Effects of photoperiod on growth, lipid metabolism and oxidative stress of juvenile gibel carp (Carassius auratus). J. Photochem. Photobiol. B Biol. 2019, 198, 111552. [Google Scholar] [CrossRef]
  20. Gooley, J.J. Circadian regulation of lipid Metabolism. Proc. Nutr. Soc. 2016, 75, 440–450. [Google Scholar] [CrossRef]
  21. Paredes, J.F.; López-Olmeda, J.F.; Martínez, F.J.; Sánchez-Vázquez, F.J. Daily rhythms of lipid metabolic gene expression in zebra fish liver: Response to light/dark and feeding Cycles. Chronobiol. Int. 2015, 32, 1438–1448. [Google Scholar] [CrossRef]
  22. Wang, F.; Dong, S.L.; Huang, G.Q.; Wu, L.X.; Tian, X.L.; Ma, S. The effect of light color on the growth of chinese shrimp fenneropenaeus Chinensis. Aquaculture 2003, 228, 351–360. [Google Scholar] [CrossRef]
  23. Ricart-Jané, D.; Llobera, M.; López-Tejero, M.D. Anticoagulants and other preanalytical factors interfere in plasma nitrate/nitrite quantification by the Griess method. Nitric Oxide 2002, 6, 178–185. [Google Scholar] [CrossRef] [PubMed]
  24. Kim, J.H.; Cho, J.H.; Kim, S.R.; Hur, Y.B. Toxic effects of waterborne ammonia exposure on hematological parameters, oxidative stress and stress indicators of juvenile hybrid grouper, Epinephelus lanceolatus ♂ × Epinephelus fuscoguttatus ♀. Environ. Toxicol. Pharmacol. 2020, 80, 103453. [Google Scholar] [CrossRef] [PubMed]
  25. Song, L.; Bao, X.; Liu, Y.; Liu, W.; Zhao, S.; Liu, S. Effect of Heat Starvation Stress on Physiological Immunity and Metabolism of Mizuhopecten yessoensis. Sustainability 2022, 14, 13217. [Google Scholar] [CrossRef]
  26. Xu, D.F.; Wu, J.X.; Sun, L.J.; Qin, X.M.; Fan, X.P. Comparison on Anesthetic Efficacy of Eugenol and MS-222 on Shrimp Litopenaeus vannamei. J. Guangdong Ocean. Univ. 2021, 41, 44–52. [Google Scholar] [CrossRef]
  27. GB/T 5009.3-2016; Determination of moisture in foods. National Health and Family Planning Commission of the People’s Republic of China: Beijing, China, 2016.
  28. GB/T 5009.5-2016; Determination of protein in foods. State Food and Drug Administration: Beijing, China, 2016.
  29. GB/T 5009.6-2016; Determination of lipid in foods. State Food and Drug Administration: Beijing, China, 2016.
  30. GB/T 5009.4-2016; Determination of ash in foods. National Health and Family Planning Commission of the People’s Republic of China: Beijing, China, 2016.
  31. GB/T 5009.124-2016; Determination of amino acid in foods. State Food and Drug Administration: Beijing, China, 2016.
  32. GB/T 5009.168-2016; Determination of fatty acid in foods. State Food and Drug Administration: Beijing, China, 2016.
  33. Pellett, P.L.; Young, V.R.; UN University. Nutritional Evaluation of Protein Foods; The United National UniversityPublishing Company: Tokyo, Japan, 1980; pp. 26–29. [Google Scholar]
  34. Institute of Nutrition and Hygiene; National Academy of Preventive Sciences. List of Food Ingredients; People’s Medical Publishing House: Beijing, China, 1991. [Google Scholar]
  35. Xie, S.; Wei, D.; Fang, W.; Wan, M.; Guo, T.; Liu, Y.; Yin, P.; Tian, L.; Niu, J. Optimal dietary lipid requirement of postlarval white shrimp, Litopenaeus vannamei in relation to growth performance, stress tolerance and immune response. Aquac. Nutr. 2019, 25, 1231–1240. [Google Scholar] [CrossRef]
  36. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using Real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  37. Lu, M.W.; Cao, Y.; Xiao, J.; Song, M.Y.; Ho, C.T. Molecular mechanisms of the Anti-obesity effect of bioactive ingredients in common spices: A Review. Food Funct. 2018, 9, 4569–4581. [Google Scholar] [CrossRef]
  38. Mennigen, J.A.; Plagnes-Juan, E.; Figueredo-Silva, C.A.; Seiliez, I.; Panserat, S.; Skiba-Cassy, S. Acute endocrine and nutritional Co-regulation of the hepatic omy-miRNA-122b and the lipogenic gene fas in rainbow trout, oncorhynchus Mykiss. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2014, 169, 16–24. [Google Scholar] [CrossRef]
  39. Sugiyama, M.; Takenaga, F.; Kitani, Y.; Yamamoto, G.; Okamoto, H.; Masaoka, T.; Araki, K.; Nagoya, H.; Mori, T. Homozygous and heterozygous GH transgenesis alters fatty acid composition and content in the liver of amago salmon (Oncorhynchus masou Ishikawae). Biol. Open 2012, 1, 1035–1042. [Google Scholar] [CrossRef]
  40. Tian, J.; Wen, H.; Zeng, L.B.; Jiang, M.; Wu, F.; Liu, W.; Yang, C.G. Changes in the activities and mRNA expression levels of lipoprotein lipase (LPL), hormone-sensitive lipase (HSL) and fatty acid synthetase (FAS) of nile tilapia (Oreochromis niloticus) during fasting and re-Feeding. Aquaculture 2013, 400–401, 29–35. [Google Scholar] [CrossRef]
  41. Toneys, M.L.; Coble, D.W. Mortality, hematocrit, osmolality, electrolyte regulation, and fat depletion of young-of-the-year freshwater fishes under simulated winter Conditions. Can. J. Fish. Aquat. Sci. 1980, 37, 225–232. [Google Scholar] [CrossRef]
  42. Huber, M.; Bengtson, D.A. Effects of photoperiod and temperature on the regulation of the onset of maturation in the estuarine fish menidia beryllina (cope) (Atherinidae). J. Exp. Mar. Biol. Ecol. 1999, 240, 285–302. [Google Scholar] [CrossRef]
  43. Davis, K.B.; McEntire, M. Effect of photoperiod on feeding, intraperitoneal fat, and insulin-like growth factor-I in sunshine Bass*. J. World Aquac. Soc. 2006, 37, 431–436. [Google Scholar] [CrossRef]
  44. Harimana, Y.; Tang, X.; Xu, P.; Xu, G.; Karangwa, E.; Zhang, K.; Sun, Y.; Li, Y.; Ma, S.; Uriho, A.; et al. Effect of long-term moderate exercise on muscle cellularity and texture, antioxidant activities, tissue composition, freshness indicators and flavor characteristics in largemouth bass (Micropterus salmoides). Aquaculture 2019, 510, 100–108. [Google Scholar] [CrossRef]
  45. Wang, X.Y.; Liu, B.L.; Gao, X.Q.; Wang, X.; Li, H.X.; Xu, L.; Wang, G.M.; Zhao, K.F.; Huang, B. The Effects of Different UVA Photoperiods on the Growth Performance, Immune Responses, Antioxidant Status and Apoptosis-Related Gene Expression of the Pacific White Shrimp (Penaeus vannamei). Antibiotics 2021, 11, 37. [Google Scholar] [CrossRef]
  46. Rowland, S.J.; Mifsud, C.; Nixon, M.; Boyd, P. Effects of stocking density on the performance of the Australian freshwater silver perch (Bidyanus bidyanus) in Cages. Aquaculture 2006, 253, 301–308. [Google Scholar] [CrossRef]
  47. Ai, Q.; Mai, K.; Li, H.; Zhang, C.; Zhang, L.; Duan, Q.; Tan, B.; Xu, W.; Ma, H.; Zhang, W.; et al. Effects of dietary protein to energy ratios on growth and body composition of juvenile Japanese seabass, Lateolabrax japonicus. Aquaculture 2004, 230, 507–516. [Google Scholar] [CrossRef]
  48. Xiong, H.S.; Zhu, L. Handbook of Food Additives; China Light Industry Press: Beijing, China, 2012. [Google Scholar]
  49. Karakatsouli, N.; Papoutsoglou, S.E.; Pizzonia, G.; Tsatsos, G.; Tsopelakos, A.; Chadio, S.; Kalogiannis, D.; Dalla, C.; Polissidis, A.; Papadopoulou-Daifoti, Z. Effects of light spectrum on growth and physiological status of gilthead seabream sparus aurata and rainbow trout oncorhynchus mykiss reared under recirculating system conditions. Aquac. Eng. 2007, 36, 302–309. [Google Scholar] [CrossRef]
  50. Lai, W.C.; Xu, D.; Li, J.M.; Wang, Z.; Ding, Y.; Wang, X.N.; Li, X.S.; Xu, N.; Mai, K.S.; Ai, Q.H. Dietary polystyrene nanoplastics exposure alters liver lipid metabolism and muscle nutritional quality in carnivorous marine fish large yellow croaker (Larimichthys crocea). J. Hazard. Mater. 2021, 419, 126454. [Google Scholar] [CrossRef]
  51. Bing, X.W.; Zhang, X.Z. Evaluation of nutritional components and nutritive quality of the muscle of Oxyeleotris marmoratus Bleeker. Period. Ocean. Univ. China 2006, 36, 107–111. [Google Scholar]
  52. Zhu, Z.; Song, B.; Lin, X.; Xu, Z. Effect of sustained training on glycolysis and fatty acids oxidation in swimming muscles and liver in juvenile tinfoil barb barbonymus schwanenfeldii (bleeker, 1854). Fish Physiol. Biochem. 2016, 42, 1807–1817. [Google Scholar] [CrossRef] [PubMed]
  53. Zhang, Y.Z.; Yang, Y.M.; Wang, L.; Liu, F.; Li, Y.Z.; Cui, Y.X.; Sun, W.H.; Chen, S.L. Comparative study of the muscle fatty acid composition of different families of half smooth tongue sole (Cynoglossus semilaevis). J. Fish. Sci. China 2016, 23, 417–424. [Google Scholar] [CrossRef]
  54. Henderson, R.J.; Sargent, J.R.; Hopkins, C.C.E. Changes in the content and fatty acid composition of lipid in an isolated population of the capelin Mallotus villosus during sexual maturation and spawning. Mar. Biol. 1984, 78, 255–263. [Google Scholar] [CrossRef]
  55. Shi, X.L.; Xu, Y.J.; Mou, J.T.; Si, X.D. Analysis of amino acids fatty acids of Hippocampus kuda and Solenognathus hardwickii. Chin. J. Mar. Drugs 2017, 36, 75–83. [Google Scholar]
  56. Mourente, G.; Odriozola, J.M. Effect of broodstock diets on lipid classes and their fatty acid composition in eggs of gilthead sea bream (Sparus aurata L.). Fish Physiol. Biochem. 1990, 8, 93–101. [Google Scholar] [CrossRef]
  57. Luvizotto-santos, R.; Lee, J.T.; Branco, Z.P.; Bianchini, A.; Nery, L.E.M. Lipids as energy source during salinity acclimation in the euryhaline crabChasmagnathus granulata dana, 1851 (crustacea-Grapsidae). J. Exp. Zool. 2003, 295A, 200–205. [Google Scholar] [CrossRef]
  58. Gong, Y.L.; Chen, W.J.; Han, D.; Zhu, X.M.; Yang, Y.X.; Jin, J.Y.; Liu, H.K.; Xie, S.Q. Effects of food restriction on growth, body composition and gene expression related in regulation of lipid metabolism and food intake in grass Carp. Aquaculture 2017, 469, 28–35. [Google Scholar] [CrossRef]
  59. Qin, D.G.; Dong, X.H.; Tan, B.P.; Yang, Q.H.; Chi, S.Y.; Liu, H.Y.; Zhang, S. Effects of dietary choline on growth performance, lipid deposition and hepatic lipid transport of grouper (Epinephelus coioides). Aquac. Nutr. 2017, 23, 453–459. [Google Scholar] [CrossRef]
  60. Wang, J.T.; Liu, Y.J.; Tian, L.X.; Mai, K.S.; Du, Z.Y.; Wang, Y.; Yang, H.J. Effect of dietary lipid level on growth performance, lipid deposition, hepatic lipogenesis in juvenile cobia (Rachycentron canadum). Aquaculture 2005, 249, 439–447. [Google Scholar] [CrossRef]
  61. Xiao, P.Z.; Ji, H.; Ye, Y.T.; Zhang, B.T.; Chen, Y.S.; Tian, J.J.; Liu, P.; Chen, L.Q.; Du, Z.Y. Dietary silymarin supplementation promotes growth performance and improves lipid metabolism and health status in grass carp (Ctenopharyngodon idellus) fed diets with elevated lipid Levels. Fish Physiol. Biochem. 2017, 43, 245–263. [Google Scholar] [CrossRef] [PubMed]
  62. Jin, Y.; Tian, L.X.; Zeng, S.L.; Xie, S.W.; Yang, H.J.; Liang, G.Y.; Liu, Y.J. Dietary lipid requirement on Non-specific immune responses in juvenile grass carp (Ctenopharyngodon idella). Fish Shellfish. Immunol. 2013, 34, 1202–1208. [Google Scholar] [CrossRef] [PubMed]
  63. Forman, B.M.; Chen, J.; Evans, R.M. Hypolipidemic drugs, polyunsaturated fatty acids, and eicosanoids are ligands for peroxisome proliferator-activated Receptors. Proc. Natl. Acad. Sci. USA 1997, 94, 4312–4317. [Google Scholar] [CrossRef] [PubMed]
  64. Long, S.S.; Dong, X.H.; Tan, B.P.; Zhang, S.; Xie, S.W.; Yang, Q.H.; Chi, S.Y.; Liu, H.Y.; Deng, J.M.; Yang, Y.Z.; et al. Growth performance, antioxidant ability, biochemical index in serum, liver histology and hepatic metabolomics analysis of juvenile hybrid grouper (♀Epinephelus fuscoguttatus × ♂Epinephelus lanceolatus) fed with oxidized fish Oil. Aquaculture 2021, 545, 737261. [Google Scholar] [CrossRef]
Figure 1. Effect of five photoperiods on CPT1 (A), ACC (B), and FAS (C) activity of L. vannamei. Values are expressed as the mean ± SD. Different letters indicate significant differences (p < 0.05) among the groups.
Figure 1. Effect of five photoperiods on CPT1 (A), ACC (B), and FAS (C) activity of L. vannamei. Values are expressed as the mean ± SD. Different letters indicate significant differences (p < 0.05) among the groups.
Fishes 09 00508 g001
Figure 2. Effect of the five photoperiods (AE) on lipid metabolism gene expression in the hepatopancreas of L. vannamei. The values are expressed as the mean ± SD. Different letters indicate significant differences (p < 0.05) among groups.
Figure 2. Effect of the five photoperiods (AE) on lipid metabolism gene expression in the hepatopancreas of L. vannamei. The values are expressed as the mean ± SD. Different letters indicate significant differences (p < 0.05) among groups.
Fishes 09 00508 g002
Table 1. Primers used for gene expression analysis by qRT-PCR.
Table 1. Primers used for gene expression analysis by qRT-PCR.
GenesFunctionPrimer sequence(5′-3′)Reference
β-ActinInternal referenceF: GCCCATCTACGAGGGATA
R: GGTGGTCGTGAAGGTGTAA
Xie et al. [35]
PPARα F: TACAGTTCCGTCAGTTCCGC
R: ATCATGACGCTGTTCTGCCA
Designed by author
PGC-1αF: GATCTCTCGCCTGACCTTCG
R: CACAGATGGGGTTTCCCTCC
Designed by author
Rec-erbαF: ACCTTCGCCCAGAATGTCAG
R: CAAGCACCCAGATGCGTAGA
Designed by author
RORαF: AACGAAGTCCGCATGGAGAG
R: GCCTTTCCTCAGCAAGTCCT
Designed by author
SREBP1-CF: ACCTTCGCCCAGAATGTCAG
R: CAAGCACCCAGATGCGTAGA
Designed by author
Table 2. Common nutritional component contents of L. vannamei under different photoperiods n = 9; x ¯ ± SD; %.
Table 2. Common nutritional component contents of L. vannamei under different photoperiods n = 9; x ¯ ± SD; %.
Nutritional ComponentGroups
0L:24D8L:16D12L:12D16L:8D24L:0D
moisture78.57 ± 1.5476.30 ± 1.2476.41 ± 1.3277.21 ± 0.3975.97 ± 0.34
crude lipid1.44 ± 0.03 d1.58 ± 0.03 c1.62 ± 0.10 bc1.66 ± 0.05 b1.72 ± 0.03 a
crude protein19.33 ± 0.04 c19.38 ± 0.19 ab19.45 ± 0.08 a19.23 ± 0.05 c19.42 ± 0.21 ab
ash2.59 ± 0.042.50 ± 0.102.64 ± 0.052.57 ± 0.062.63 ± 0.02
Note: Values with the same small letter superscripts or no letter superscripts in the same row indicate no significant differences (p > 0.05), and different lowercase letters indicate significant differences (p < 0.05).
Table 3. Amino acid composition in muscle of L. vannamei under different photoperiods n = 9; x ¯ ± SD; %.
Table 3. Amino acid composition in muscle of L. vannamei under different photoperiods n = 9; x ¯ ± SD; %.
Amino AcidsGroups
0L:24D8L:16D12L:12D16L:8D24L:0D
Cystine (Cys) i0.47 ± 0.03 ab0.46 ± 0.05 ab0.44 ± 0.03 b0.35 ± 0.03 c0.51 ± 0.04 a
Histidine (His) i1.62 ± 0.01 b1.52 ± 0.04 c1.91 ± 0.08 a1.57 ± 0.07 c1.95 ± 0.01 a
Arginine (Arg) i1.53 ± 0.01 c1.53 ± 0.07 c1.51 ± 0.04 c1.73 ± 0.03 b2.11 ± 0.03 a
Glutamic acid (Glu) ii1.56 ± 0.09 c1.58 ± 0.07 c1.57 ± 0.02 c1.75 ± 0.22 b1.89 ± 0.08 a
Glycine (Gly) ii0.70 ± 0.06 b0.72 ± 0.02 b0.70 ± 0.02 b0.85 ± 0.02 a0.87 ± 0.03 a
Alanine (Ala) ii1.14 ± 0.0.02 c1.21 ± 0.02 b1.15 ± 0.08 c1.24 ± 0.05 b1.31 ± 0.02 a
Serine (Ser) ii0.47 ± 0.01 c0.47 ± 0.02 c0.56 ± 0.02 b0.79 ± 0.02 a0.82 ± 0.04 a
Proline (Pro) ii0.58 ± 0.02 c0.56 ± 0.03 c0.57 ± 0.02 c0.67 ± 0.03 b0.76 ± 0.02 a
Tyrosine (Tyr) ii0.87 ± 0.0.03 c0.86 ± 0.03 c0.87 ± 0.05 c0.94 ± 0.02 b1.04 ± 0.04 a
Threonine (Thr) iii0.75 ± 0.020.72 ± 0.030.74 ± 0.030.73 ± 0.030.76 ± 0.02
Valine (Val) iii0.53 ± 0.020.53 ± 0.070.54 ± 0.040.54 ± 0.030.53 ± 0.03
Methionine (Met) iii0.32 ± 0.02 c0.46 ± 0.02 a0.43 ± 0.03 b0.42 ± 0.01 b0.46 ± 0.02 a
Isoleucine (IIe) iii0.74 ± 0.020.73 ± 0.010.73 ± 0.060.74 ± 0.040.76 ± 0.01
Leucine (Leu) iii0.99 ± 0.05 c1.07 ± 0.04 bc1.14 ± 0.01 b1.68 ± 0.02 a1.73 ± 0.08 a
Phenylalanine (Phe) iii0.43 ± 0.030.45 ± 0.040.42 ± 0.030.44 ± 0.040.44 ± 0.02
Lysine (Lys) iii0.96 ± 0.01 c0.99 ± 0.02 c1.17 ± 0.03 b1.69 ± 0.06 a1.73 ± 0.05 a
Total essential amino acids (TEAAs)6.10 ± 0.32 c6.55 ± 0.54 b7.02 ± 0.02 b7.21 ± 0.24 a7.53 ± 0.09 a
Total hydrolyzed essential amino acid (THEAA)3.62 ± 0.03 ab3.51 ± 0.18 ab3.86 ± 0.28 a3.65 ± 0.12 a3.51 ± 0.38 b
Total non-essential amino acids (TNEAAs)7.66 ± 0.12 d8.26 ± 0.43 c8.81 ± 0.31 b9.05 ± 0.32 b9.16 ± 0.20 a
Total amino acid (TAA)17.38 ± 0.55 c18.32 ± 1.69 c19.69 ± 0.47 b19.91 ± 0.71 a20.20 ± 0.17 a
TEAA/TAA0.35 ± 0.01 b0.36 ± 0.01 ab0.36 ± 0.01 ab0.36 ± 0.01 ab0.37 ± 0.01 a
TEAA/TNEAA0.80 ± 0.02 b0.80 ± 0.03 b0.80 ± 0.01 b0.80 ± 0.03 b0.82 ± 0.02 a
Note: The above contents are all contents in fresh muscle samples; i: semi-essential amino acid; ii: non-essential amino acid; iii: essential amino acid; in the same row, values with the same small letter superscripts or no letter superscripts indicate no significant differences (p > 0.05), and different small letter superscripts indicate significant differences (p < 0.05).
Table 4. Comparison of essential amino acid contents in muscle of L. vannamei under different photoperiods with FAO /WHO amino acid pattern and whole egg protein amino acid pattern mg/ g(N).
Table 4. Comparison of essential amino acid contents in muscle of L. vannamei under different photoperiods with FAO /WHO amino acid pattern and whole egg protein amino acid pattern mg/ g(N).
GroupsThrValMet + CysIsoleucineLeuPhe + TyrLysTotal
0L:24D2712741952474194434962345
8L:16D2662571572303964194582183
12L:12D2692701772414224414572277
16L:8D2712811962514314545162400
24L:0D2882922172634594825432544
FAO/WHO pattern2503102202504403803402190
egg protein pattern2924113863315345654412960
Table 5. Comparison of AAS, CS and EAAI of essential amino acid in muscle of L. vannamei under different photoperiods.
Table 5. Comparison of AAS, CS and EAAI of essential amino acid in muscle of L. vannamei under different photoperiods.
EAAAASCS
0L:24D8L:16D12L:12D16L:8D24L:0D0L:24D8L:16D12L:12D16L:8D24L:0D
Thr1.081.061.081.081.150.930.910.920.930.99
Val0.880.830.870.910.940.670.630.660.680.71
Lys1.461.351.351.521.601.131.041.041.171.23
Leu0.950.900.960.981.040.780.740.790.810.86
Ile0.990.920.971.011.050.750.700.730.760.79
Phe + Tyr1.171.101.161.201.270.780.740.780.800.85
Met + Cys0.890.710.810.890.990.510.410.460.510.56
EAAI77.0771.1174.6778.6383.56
Table 6. Fatty acid composition in muscle of L. vannamei under different photoperiods n = 9; x ± SD; %.
Table 6. Fatty acid composition in muscle of L. vannamei under different photoperiods n = 9; x ± SD; %.
Fatty AcidsGroups
0L:24D8L:16D12L:12D16L:8D24L:0D
C14:03.86 ± 0.53 b3.23 ± 0.62 b5.18 ± 0.61 a5.19 ± 0.07 a4.18 ± 0.85 ab
C15:00.21 ± 0.030.24 ± 0.020.25 ± 0.020.23 ± 0.020.23 ± 0.02
C16:015.18 ± 0.90 c17.66 ± 0.69 b18.56 ± 0.42 ab19.08 ± 0.22 a19.33 ± 0.64 a
C17:00.28 ± 0.010.28 ± 0.010.28 ± 0.020.27 ± 0.010.27 ± 0.02
C18:05.73 ± 0.145.63 ± 0.265.64 ± 0.075.60 ± 0.225.62 ± 0.21
C20:00.28 ± 0.01 ab0.30 ± 0.01 a0.27 ± 0.02 b0.31 ± 0.02 a0.25 ± 0.01 b
C22:00.20 ± 0.020.18 ± 0.030.20 ± 0.010.20 ± 0.010.18 ± 0.02
C23:00.06 ± 0.010.06 ± 0.010.06 ± 0.020.05 ± 0.010.05 ± 0.01
C24:00.12 ± 0.02 b0.18 ± 0.01 a0.13 ± 0.01 b0.11 ± 0.01 bc0.09 ± 0.02 c
C16:13.22 ± 0.60 a2.34 ± 0.16 b2.83 ± 0.10 ab2.98 ± 0.44 ab3.14 ± 0.40 ab
C18:1n9t0.10 ± 0.01 c0.14 ± 0.01 b0.20 ± 0.05 b0.16 ± 0.01 b0.27 ± 0.04 a
C18:1n9c23.36 ± 3.22 a17.90 ± 1.30 b20.99 ± 1.09 ab21.46 ± 1.61 ab23.40 ± 2.60 a
C20:11.34 ± 0.041.26 ± 0.111.26 ± 0.111.33 ± 0.051.34 ± 0.12
C22:1n92.87 ± 1.01 b5.74 ± 0.68 a3.97 ± 1.01 ab4.02 ± 0.51 ab3.62 ± 0.98 b
C24:10.36 ± 0.01 b0.54 ± 0.07 a0.40 ± 0.03 b0.40 ± 0.04 b0.38 ± 0.08 b
C18:2n6c19.33 ± 0.7519.66 ± 0.2920.19 ± 0.2420.47 ± 1.6219.57 ± 0.69
C18:3n60.40 ± 0.01 b0.37 ± 0.04 c0.42 ± 0.02 ab0.43 ± 0.02 ab0.45 ± 0.01 a
C18:3n32.30 ± 0.39 b2.70 ± 0.36 b3.94 ± 0.36 a3.75 ± 0.23 a2.90 ± 0.24 b
C20:20.76 ± 0.09 b0.94 ± 0.17 a0.80 ± 0.04 ab0.77 ± 0.04 b0.89 ± 0.05 ab
C20:3n60.08 ± 0.01 b0.09 ± 0.01 b0.12 ± 0.01 a0.09 ± 0.01 b0.10 ± 0.01 a
C20:3n30.12 ± 0.02 b0.18 ± 0.03 a0.15 ± 0.02 ab0.15 ± 0.02 ab0.14 ± 0.04 ab
C20:4n60.73 ± 0.130.79 ± 0.150.57 ± 0.040.68 ± 0.180.73 ± 0.10
C22:20.14 ± 0.010.21 ± 0.010.18 ± 0.040.16 ± 0.020.15 ± 0.04
EPA(C20:5n3)4.21 ± 0.154.69 ± 0.214.24 ± 0.294.32 ± 0.364.26 ± 0.41
DHA(C22:6n3)9.62 ± 2.6011.00 ± 3.149.19 ± 0.119.43 ± 1.729.09 ± 1.12
SFA25.39 ± 0.49 c27.89 ± 0.13 b30.58 ± 0.72 a30.90 ± 0.24 a30.30 ± 0.22 ab
MUFA32.31 ± 2.1329.65 ± 3.4229.64 ± 0.9130.33 ± 1.5731.53 ± 1.70
PUFA32.52 ± 2.05 c39.03 ± 1.00 b39.79 ± 0.42 b40.47 ± 3.39 b44.21 ± 2.11 a
EPA+DHA12.30 ± 1.0013.97 ± 2.1613.43 ± 0.3013.75 ± 2.0714.21 ± 0.24
Note: Values with the same small letter superscripts or no letter superscripts in the same row indicate no significant differences (p > 0.05), and different lowercase letters indicate significant differences (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Fang, Y.; Fei, F.; Guo, F.; Zhu, C.; Gao, X.; Li, W.; Yang, H.; Sun, Y.; Zhang, C.; Liu, B. Effect of Photoperiod on Nutritional Quality of Muscle and Lipid Metabolism of Litopenaeus vannamei. Fishes 2024, 9, 508. https://doi.org/10.3390/fishes9120508

AMA Style

Fang Y, Fei F, Guo F, Zhu C, Gao X, Li W, Yang H, Sun Y, Zhang C, Liu B. Effect of Photoperiod on Nutritional Quality of Muscle and Lipid Metabolism of Litopenaeus vannamei. Fishes. 2024; 9(12):508. https://doi.org/10.3390/fishes9120508

Chicago/Turabian Style

Fang, Yingying, Fan Fei, Fulu Guo, Chengliang Zhu, Xiaoqiang Gao, Wenyang Li, Hongjun Yang, Yan Sun, Chuanxin Zhang, and Baoliang Liu. 2024. "Effect of Photoperiod on Nutritional Quality of Muscle and Lipid Metabolism of Litopenaeus vannamei" Fishes 9, no. 12: 508. https://doi.org/10.3390/fishes9120508

APA Style

Fang, Y., Fei, F., Guo, F., Zhu, C., Gao, X., Li, W., Yang, H., Sun, Y., Zhang, C., & Liu, B. (2024). Effect of Photoperiod on Nutritional Quality of Muscle and Lipid Metabolism of Litopenaeus vannamei. Fishes, 9(12), 508. https://doi.org/10.3390/fishes9120508

Article Metrics

Back to TopTop