Effect of Photoperiod on Nutritional Quality of Muscle and Lipid Metabolism of Litopenaeus vannamei
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Shrimp and Acclimation
2.2. Experimental Design
2.3. Samples Preparation and Calculations
2.4. Lipid and Enzyme Analysis
2.5. Routine Nutritional Components and Fatty Acids and Amino Acids Analysis
2.6. Muscle Nutritional Quality Evaluation
2.7. Quantitative Reverse Transcription PCR (qRT-PCR) Analysis
2.8. Data Analysis
3. Result
3.1. Lipid Metabolism Enzyme
3.2. Body Composition
3.3. Amino Acid Composition and Nutritional Value Analysis
3.3.1. Amino Acid Composition
3.3.2. Nutrition Assessment
3.4. Fatty Acids Composition
3.5. Lipid Metabolism-Related Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bureau of Fisheries. China Fishery Statistics Yearbook; Ministry of Agriculture, China Agriculture Press: Beijing, China, 2024.
- Zhou, C.; Xu, D.M.; Lin, K.; Sun, C.H.; Yang, X.T. Intelligent feeding control methods in aquaculture with an emphasis on fish: A review. Rev. Aquac. 2017, 10, 975–993. [Google Scholar] [CrossRef]
- Sallemi, J.E.; Di Yorio, M.P.; Hermida, G.N.; Breccia, A.; Battista, A.G.; Vissio, P.G. The saccus vasculosus of the neotropical cichlid fish cichlasoma dimerus: Characterization, developmental studies and its response to Photoperiod. Cell Tissue Res. 2024, 397, 97–110. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.L.; Zhang, M.; Li, X.; Wu, F.C.; Song, C.B.; Liu, Y. Light cycle effects on Haliotis discus hannai Ino growth, energy budget, and related gene Expression. Aquaculture 2018, 483, 213–222. [Google Scholar] [CrossRef]
- Yang, M.F.; Chen, Z.L.; Hu, F.Y.; Sun, J.N.; Ding, J.Y.; Chang, Y.Q.; Zhao, C. Light spectra regulated foraging and feeding behaviors shed light on stock enhancement of the sea urchin strongylocentrotus Intermedius. Aquac. Rep. 2020, 18, 100480. [Google Scholar] [CrossRef]
- Begtashi, I.; Rodríguez, L.; Moles, G.; Zanuy, S.; Carrillo, M. Long-term exposure to continuous light inhibits precocity in juvenile male european sea bass (Dicentrarchus labrax, L.). I. Morphological Aspects. Aquaculture 2004, 241, 539–559. [Google Scholar] [CrossRef]
- Rodríguez, R.; Felip, A.; Cerqueira, V.; Hala, E.; Zanuy, S.; Carrillo, M. Identification of a photolabile period for reducing sexual maturation in juvenile male sea bass (Dicentrarchus labrax) by means of a continuous light Regime. Aquac. Int. 2012, 20, 1071–1083. [Google Scholar] [CrossRef]
- Li, X.; Wei, P.P.; Liu, S.T.; Ma, H.; Zhang, J.P.; Liu, Y.; Tian, Y. Comparative study of the growth, feeding, amino acid composition, and nutritional quality of Dicentrarchus labrax juveniles under different light photoperiods. J. Fish. Sci. China 2020, 27, 1062–1074. [Google Scholar] [CrossRef]
- Di, Z.K.; Li, K.; Liu, R.C.; Wang, G.X.; Lu, Q.; Li, T.Z.; Yan, L.; Jiang, H.F.; Liu, L.P. Effects of photoperiod and light intensity on the growth, muscle nutrition and economic performance of Murray cod (Maccullochella peelii) in the recirculating aquarium System. Acta Hydrobiologica. Sinica 2021, 45, 781–789. [Google Scholar] [CrossRef]
- Bromage, N.; Porter, M.; Randall, C. The environmental regulation of maturation in farmed finfish with special reference to the role of photoperiod and Melatonin. Aquaculture 2001, 197, 63–98. [Google Scholar] [CrossRef]
- Wood, S.; Loudon, A. Clocks for all seasons: Unwinding the roles and mechanisms of circadian and interval timers in the hypothalamus and Pituitary. J. Endocrinol. 2016, 228, X1. [Google Scholar] [CrossRef]
- Reis, W.G.; Wasielesky Jr, W.; Abreu, P.C.; Brandão, H.; Krummenauer, D. The influence of different light wavelengths in the culture of the Pacific white shrimp Litopenaeus vannamei reared in BFT using LED Lights. Aquaculture 2023, 563, 2. [Google Scholar] [CrossRef]
- García-Jaramillo, M.; Lytle, K.A.; Spooner, M.H.; Jump, D.B. A lipidomic analysis of docosahexaenoic acid (22:6, ω3) mediated attenuation of western diet induced nonalcoholic steatohepatitis in male ldlr−/− Mice. Metabolites 2019, 9, 252. [Google Scholar] [CrossRef] [PubMed]
- Sheridan, M.A. Lipid dynamics in fish: Aspects of absorption, transportation, deposition and Mobilization. Comp. Biochem. Physiol. Part B Comp. Biochem. 1988, 90, 679–690. [Google Scholar] [CrossRef] [PubMed]
- Horton, J.D.; Goldstein, J.L.; Brown, M.S. SREBPs: Activators of the complete program of cholesterol and fatty acid synthesis in the Liver. J. Clin. Investig. 2002, 109, 1125–1131. [Google Scholar] [CrossRef] [PubMed]
- Grimaldi, B.; Bellet, M.M.; Katada, S.; Astarita, G.; Hirayama, J.; Amin, R.H.; Granneman, J.G.; Piomelli, D.; Leff, T.; Sassone-Corsi, P. PER2 controls lipid metabolism by direct regulation of PPARγ. Cell Metab. 2010, 12, 509–520. [Google Scholar] [CrossRef] [PubMed]
- Munday, M.R. Regulation of mammalian Acetyl-CoA Carboxylase. Biochem. Soc. Trans. 2002, 30, 1059–1064. [Google Scholar] [CrossRef]
- Basili, D.; Lutfi, E.; Falcinelli, S.; Balbuena-Pecino, S.; Navarro, I.; Bertolucci, C.; Capilla, E.; Carnevali, O. Photoperiod Manipulation Affects Transcriptional Profile of Genes Related to Lipid Metabolism and Apoptosis in Zebrafish (Danio rerio) Larvae: Potential Roles of Gut Microbiota. Microb. Ecol. 2020, 79, 933–946. [Google Scholar] [CrossRef]
- Wei, H.; Cai, W.J.; Liu, H.K.; Han, D.; Zhu, X.M.; Yang, Y.X.; Jin, J.Y.; Xie, S.Q. Effects of photoperiod on growth, lipid metabolism and oxidative stress of juvenile gibel carp (Carassius auratus). J. Photochem. Photobiol. B Biol. 2019, 198, 111552. [Google Scholar] [CrossRef]
- Gooley, J.J. Circadian regulation of lipid Metabolism. Proc. Nutr. Soc. 2016, 75, 440–450. [Google Scholar] [CrossRef]
- Paredes, J.F.; López-Olmeda, J.F.; Martínez, F.J.; Sánchez-Vázquez, F.J. Daily rhythms of lipid metabolic gene expression in zebra fish liver: Response to light/dark and feeding Cycles. Chronobiol. Int. 2015, 32, 1438–1448. [Google Scholar] [CrossRef]
- Wang, F.; Dong, S.L.; Huang, G.Q.; Wu, L.X.; Tian, X.L.; Ma, S. The effect of light color on the growth of chinese shrimp fenneropenaeus Chinensis. Aquaculture 2003, 228, 351–360. [Google Scholar] [CrossRef]
- Ricart-Jané, D.; Llobera, M.; López-Tejero, M.D. Anticoagulants and other preanalytical factors interfere in plasma nitrate/nitrite quantification by the Griess method. Nitric Oxide 2002, 6, 178–185. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Cho, J.H.; Kim, S.R.; Hur, Y.B. Toxic effects of waterborne ammonia exposure on hematological parameters, oxidative stress and stress indicators of juvenile hybrid grouper, Epinephelus lanceolatus ♂ × Epinephelus fuscoguttatus ♀. Environ. Toxicol. Pharmacol. 2020, 80, 103453. [Google Scholar] [CrossRef] [PubMed]
- Song, L.; Bao, X.; Liu, Y.; Liu, W.; Zhao, S.; Liu, S. Effect of Heat Starvation Stress on Physiological Immunity and Metabolism of Mizuhopecten yessoensis. Sustainability 2022, 14, 13217. [Google Scholar] [CrossRef]
- Xu, D.F.; Wu, J.X.; Sun, L.J.; Qin, X.M.; Fan, X.P. Comparison on Anesthetic Efficacy of Eugenol and MS-222 on Shrimp Litopenaeus vannamei. J. Guangdong Ocean. Univ. 2021, 41, 44–52. [Google Scholar] [CrossRef]
- GB/T 5009.3-2016; Determination of moisture in foods. National Health and Family Planning Commission of the People’s Republic of China: Beijing, China, 2016.
- GB/T 5009.5-2016; Determination of protein in foods. State Food and Drug Administration: Beijing, China, 2016.
- GB/T 5009.6-2016; Determination of lipid in foods. State Food and Drug Administration: Beijing, China, 2016.
- GB/T 5009.4-2016; Determination of ash in foods. National Health and Family Planning Commission of the People’s Republic of China: Beijing, China, 2016.
- GB/T 5009.124-2016; Determination of amino acid in foods. State Food and Drug Administration: Beijing, China, 2016.
- GB/T 5009.168-2016; Determination of fatty acid in foods. State Food and Drug Administration: Beijing, China, 2016.
- Pellett, P.L.; Young, V.R.; UN University. Nutritional Evaluation of Protein Foods; The United National UniversityPublishing Company: Tokyo, Japan, 1980; pp. 26–29. [Google Scholar]
- Institute of Nutrition and Hygiene; National Academy of Preventive Sciences. List of Food Ingredients; People’s Medical Publishing House: Beijing, China, 1991. [Google Scholar]
- Xie, S.; Wei, D.; Fang, W.; Wan, M.; Guo, T.; Liu, Y.; Yin, P.; Tian, L.; Niu, J. Optimal dietary lipid requirement of postlarval white shrimp, Litopenaeus vannamei in relation to growth performance, stress tolerance and immune response. Aquac. Nutr. 2019, 25, 1231–1240. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using Real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Lu, M.W.; Cao, Y.; Xiao, J.; Song, M.Y.; Ho, C.T. Molecular mechanisms of the Anti-obesity effect of bioactive ingredients in common spices: A Review. Food Funct. 2018, 9, 4569–4581. [Google Scholar] [CrossRef]
- Mennigen, J.A.; Plagnes-Juan, E.; Figueredo-Silva, C.A.; Seiliez, I.; Panserat, S.; Skiba-Cassy, S. Acute endocrine and nutritional Co-regulation of the hepatic omy-miRNA-122b and the lipogenic gene fas in rainbow trout, oncorhynchus Mykiss. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2014, 169, 16–24. [Google Scholar] [CrossRef]
- Sugiyama, M.; Takenaga, F.; Kitani, Y.; Yamamoto, G.; Okamoto, H.; Masaoka, T.; Araki, K.; Nagoya, H.; Mori, T. Homozygous and heterozygous GH transgenesis alters fatty acid composition and content in the liver of amago salmon (Oncorhynchus masou Ishikawae). Biol. Open 2012, 1, 1035–1042. [Google Scholar] [CrossRef][Green Version]
- Tian, J.; Wen, H.; Zeng, L.B.; Jiang, M.; Wu, F.; Liu, W.; Yang, C.G. Changes in the activities and mRNA expression levels of lipoprotein lipase (LPL), hormone-sensitive lipase (HSL) and fatty acid synthetase (FAS) of nile tilapia (Oreochromis niloticus) during fasting and re-Feeding. Aquaculture 2013, 400–401, 29–35. [Google Scholar] [CrossRef]
- Toneys, M.L.; Coble, D.W. Mortality, hematocrit, osmolality, electrolyte regulation, and fat depletion of young-of-the-year freshwater fishes under simulated winter Conditions. Can. J. Fish. Aquat. Sci. 1980, 37, 225–232. [Google Scholar] [CrossRef]
- Huber, M.; Bengtson, D.A. Effects of photoperiod and temperature on the regulation of the onset of maturation in the estuarine fish menidia beryllina (cope) (Atherinidae). J. Exp. Mar. Biol. Ecol. 1999, 240, 285–302. [Google Scholar] [CrossRef]
- Davis, K.B.; McEntire, M. Effect of photoperiod on feeding, intraperitoneal fat, and insulin-like growth factor-I in sunshine Bass*. J. World Aquac. Soc. 2006, 37, 431–436. [Google Scholar] [CrossRef]
- Harimana, Y.; Tang, X.; Xu, P.; Xu, G.; Karangwa, E.; Zhang, K.; Sun, Y.; Li, Y.; Ma, S.; Uriho, A.; et al. Effect of long-term moderate exercise on muscle cellularity and texture, antioxidant activities, tissue composition, freshness indicators and flavor characteristics in largemouth bass (Micropterus salmoides). Aquaculture 2019, 510, 100–108. [Google Scholar] [CrossRef]
- Wang, X.Y.; Liu, B.L.; Gao, X.Q.; Wang, X.; Li, H.X.; Xu, L.; Wang, G.M.; Zhao, K.F.; Huang, B. The Effects of Different UVA Photoperiods on the Growth Performance, Immune Responses, Antioxidant Status and Apoptosis-Related Gene Expression of the Pacific White Shrimp (Penaeus vannamei). Antibiotics 2021, 11, 37. [Google Scholar] [CrossRef]
- Rowland, S.J.; Mifsud, C.; Nixon, M.; Boyd, P. Effects of stocking density on the performance of the Australian freshwater silver perch (Bidyanus bidyanus) in Cages. Aquaculture 2006, 253, 301–308. [Google Scholar] [CrossRef]
- Ai, Q.; Mai, K.; Li, H.; Zhang, C.; Zhang, L.; Duan, Q.; Tan, B.; Xu, W.; Ma, H.; Zhang, W.; et al. Effects of dietary protein to energy ratios on growth and body composition of juvenile Japanese seabass, Lateolabrax japonicus. Aquaculture 2004, 230, 507–516. [Google Scholar] [CrossRef]
- Xiong, H.S.; Zhu, L. Handbook of Food Additives; China Light Industry Press: Beijing, China, 2012. [Google Scholar]
- Karakatsouli, N.; Papoutsoglou, S.E.; Pizzonia, G.; Tsatsos, G.; Tsopelakos, A.; Chadio, S.; Kalogiannis, D.; Dalla, C.; Polissidis, A.; Papadopoulou-Daifoti, Z. Effects of light spectrum on growth and physiological status of gilthead seabream sparus aurata and rainbow trout oncorhynchus mykiss reared under recirculating system conditions. Aquac. Eng. 2007, 36, 302–309. [Google Scholar] [CrossRef]
- Lai, W.C.; Xu, D.; Li, J.M.; Wang, Z.; Ding, Y.; Wang, X.N.; Li, X.S.; Xu, N.; Mai, K.S.; Ai, Q.H. Dietary polystyrene nanoplastics exposure alters liver lipid metabolism and muscle nutritional quality in carnivorous marine fish large yellow croaker (Larimichthys crocea). J. Hazard. Mater. 2021, 419, 126454. [Google Scholar] [CrossRef]
- Bing, X.W.; Zhang, X.Z. Evaluation of nutritional components and nutritive quality of the muscle of Oxyeleotris marmoratus Bleeker. Period. Ocean. Univ. China 2006, 36, 107–111. [Google Scholar]
- Zhu, Z.; Song, B.; Lin, X.; Xu, Z. Effect of sustained training on glycolysis and fatty acids oxidation in swimming muscles and liver in juvenile tinfoil barb barbonymus schwanenfeldii (bleeker, 1854). Fish Physiol. Biochem. 2016, 42, 1807–1817. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.Z.; Yang, Y.M.; Wang, L.; Liu, F.; Li, Y.Z.; Cui, Y.X.; Sun, W.H.; Chen, S.L. Comparative study of the muscle fatty acid composition of different families of half smooth tongue sole (Cynoglossus semilaevis). J. Fish. Sci. China 2016, 23, 417–424. [Google Scholar] [CrossRef]
- Henderson, R.J.; Sargent, J.R.; Hopkins, C.C.E. Changes in the content and fatty acid composition of lipid in an isolated population of the capelin Mallotus villosus during sexual maturation and spawning. Mar. Biol. 1984, 78, 255–263. [Google Scholar] [CrossRef]
- Shi, X.L.; Xu, Y.J.; Mou, J.T.; Si, X.D. Analysis of amino acids fatty acids of Hippocampus kuda and Solenognathus hardwickii. Chin. J. Mar. Drugs 2017, 36, 75–83. [Google Scholar]
- Mourente, G.; Odriozola, J.M. Effect of broodstock diets on lipid classes and their fatty acid composition in eggs of gilthead sea bream (Sparus aurata L.). Fish Physiol. Biochem. 1990, 8, 93–101. [Google Scholar] [CrossRef]
- Luvizotto-santos, R.; Lee, J.T.; Branco, Z.P.; Bianchini, A.; Nery, L.E.M. Lipids as energy source during salinity acclimation in the euryhaline crabChasmagnathus granulata dana, 1851 (crustacea-Grapsidae). J. Exp. Zool. 2003, 295A, 200–205. [Google Scholar] [CrossRef]
- Gong, Y.L.; Chen, W.J.; Han, D.; Zhu, X.M.; Yang, Y.X.; Jin, J.Y.; Liu, H.K.; Xie, S.Q. Effects of food restriction on growth, body composition and gene expression related in regulation of lipid metabolism and food intake in grass Carp. Aquaculture 2017, 469, 28–35. [Google Scholar] [CrossRef]
- Qin, D.G.; Dong, X.H.; Tan, B.P.; Yang, Q.H.; Chi, S.Y.; Liu, H.Y.; Zhang, S. Effects of dietary choline on growth performance, lipid deposition and hepatic lipid transport of grouper (Epinephelus coioides). Aquac. Nutr. 2017, 23, 453–459. [Google Scholar] [CrossRef]
- Wang, J.T.; Liu, Y.J.; Tian, L.X.; Mai, K.S.; Du, Z.Y.; Wang, Y.; Yang, H.J. Effect of dietary lipid level on growth performance, lipid deposition, hepatic lipogenesis in juvenile cobia (Rachycentron canadum). Aquaculture 2005, 249, 439–447. [Google Scholar] [CrossRef]
- Xiao, P.Z.; Ji, H.; Ye, Y.T.; Zhang, B.T.; Chen, Y.S.; Tian, J.J.; Liu, P.; Chen, L.Q.; Du, Z.Y. Dietary silymarin supplementation promotes growth performance and improves lipid metabolism and health status in grass carp (Ctenopharyngodon idellus) fed diets with elevated lipid Levels. Fish Physiol. Biochem. 2017, 43, 245–263. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Tian, L.X.; Zeng, S.L.; Xie, S.W.; Yang, H.J.; Liang, G.Y.; Liu, Y.J. Dietary lipid requirement on Non-specific immune responses in juvenile grass carp (Ctenopharyngodon idella). Fish Shellfish. Immunol. 2013, 34, 1202–1208. [Google Scholar] [CrossRef] [PubMed]
- Forman, B.M.; Chen, J.; Evans, R.M. Hypolipidemic drugs, polyunsaturated fatty acids, and eicosanoids are ligands for peroxisome proliferator-activated Receptors. Proc. Natl. Acad. Sci. USA 1997, 94, 4312–4317. [Google Scholar] [CrossRef] [PubMed]
- Long, S.S.; Dong, X.H.; Tan, B.P.; Zhang, S.; Xie, S.W.; Yang, Q.H.; Chi, S.Y.; Liu, H.Y.; Deng, J.M.; Yang, Y.Z.; et al. Growth performance, antioxidant ability, biochemical index in serum, liver histology and hepatic metabolomics analysis of juvenile hybrid grouper (♀Epinephelus fuscoguttatus × ♂Epinephelus lanceolatus) fed with oxidized fish Oil. Aquaculture 2021, 545, 737261. [Google Scholar] [CrossRef]


| Genes | Function | Primer sequence(5′-3′) | Reference |
|---|---|---|---|
| β-Actin | Internal reference | F: GCCCATCTACGAGGGATA R: GGTGGTCGTGAAGGTGTAA | Xie et al. [35] |
| PPARα | F: TACAGTTCCGTCAGTTCCGC R: ATCATGACGCTGTTCTGCCA | Designed by author | |
| PGC-1α | F: GATCTCTCGCCTGACCTTCG R: CACAGATGGGGTTTCCCTCC | Designed by author | |
| Rec-erbα | F: ACCTTCGCCCAGAATGTCAG R: CAAGCACCCAGATGCGTAGA | Designed by author | |
| RORα | F: AACGAAGTCCGCATGGAGAG R: GCCTTTCCTCAGCAAGTCCT | Designed by author | |
| SREBP1-C | F: ACCTTCGCCCAGAATGTCAG R: CAAGCACCCAGATGCGTAGA | Designed by author |
| Nutritional Component | Groups | ||||
|---|---|---|---|---|---|
| 0L:24D | 8L:16D | 12L:12D | 16L:8D | 24L:0D | |
| moisture | 78.57 ± 1.54 | 76.30 ± 1.24 | 76.41 ± 1.32 | 77.21 ± 0.39 | 75.97 ± 0.34 |
| crude lipid | 1.44 ± 0.03 d | 1.58 ± 0.03 c | 1.62 ± 0.10 bc | 1.66 ± 0.05 b | 1.72 ± 0.03 a |
| crude protein | 19.33 ± 0.04 c | 19.38 ± 0.19 ab | 19.45 ± 0.08 a | 19.23 ± 0.05 c | 19.42 ± 0.21 ab |
| ash | 2.59 ± 0.04 | 2.50 ± 0.10 | 2.64 ± 0.05 | 2.57 ± 0.06 | 2.63 ± 0.02 |
| Amino Acids | Groups | ||||
|---|---|---|---|---|---|
| 0L:24D | 8L:16D | 12L:12D | 16L:8D | 24L:0D | |
| Cystine (Cys) i | 0.47 ± 0.03 ab | 0.46 ± 0.05 ab | 0.44 ± 0.03 b | 0.35 ± 0.03 c | 0.51 ± 0.04 a |
| Histidine (His) i | 1.62 ± 0.01 b | 1.52 ± 0.04 c | 1.91 ± 0.08 a | 1.57 ± 0.07 c | 1.95 ± 0.01 a |
| Arginine (Arg) i | 1.53 ± 0.01 c | 1.53 ± 0.07 c | 1.51 ± 0.04 c | 1.73 ± 0.03 b | 2.11 ± 0.03 a |
| Glutamic acid (Glu) ii | 1.56 ± 0.09 c | 1.58 ± 0.07 c | 1.57 ± 0.02 c | 1.75 ± 0.22 b | 1.89 ± 0.08 a |
| Glycine (Gly) ii | 0.70 ± 0.06 b | 0.72 ± 0.02 b | 0.70 ± 0.02 b | 0.85 ± 0.02 a | 0.87 ± 0.03 a |
| Alanine (Ala) ii | 1.14 ± 0.0.02 c | 1.21 ± 0.02 b | 1.15 ± 0.08 c | 1.24 ± 0.05 b | 1.31 ± 0.02 a |
| Serine (Ser) ii | 0.47 ± 0.01 c | 0.47 ± 0.02 c | 0.56 ± 0.02 b | 0.79 ± 0.02 a | 0.82 ± 0.04 a |
| Proline (Pro) ii | 0.58 ± 0.02 c | 0.56 ± 0.03 c | 0.57 ± 0.02 c | 0.67 ± 0.03 b | 0.76 ± 0.02 a |
| Tyrosine (Tyr) ii | 0.87 ± 0.0.03 c | 0.86 ± 0.03 c | 0.87 ± 0.05 c | 0.94 ± 0.02 b | 1.04 ± 0.04 a |
| Threonine (Thr) iii | 0.75 ± 0.02 | 0.72 ± 0.03 | 0.74 ± 0.03 | 0.73 ± 0.03 | 0.76 ± 0.02 |
| Valine (Val) iii | 0.53 ± 0.02 | 0.53 ± 0.07 | 0.54 ± 0.04 | 0.54 ± 0.03 | 0.53 ± 0.03 |
| Methionine (Met) iii | 0.32 ± 0.02 c | 0.46 ± 0.02 a | 0.43 ± 0.03 b | 0.42 ± 0.01 b | 0.46 ± 0.02 a |
| Isoleucine (IIe) iii | 0.74 ± 0.02 | 0.73 ± 0.01 | 0.73 ± 0.06 | 0.74 ± 0.04 | 0.76 ± 0.01 |
| Leucine (Leu) iii | 0.99 ± 0.05 c | 1.07 ± 0.04 bc | 1.14 ± 0.01 b | 1.68 ± 0.02 a | 1.73 ± 0.08 a |
| Phenylalanine (Phe) iii | 0.43 ± 0.03 | 0.45 ± 0.04 | 0.42 ± 0.03 | 0.44 ± 0.04 | 0.44 ± 0.02 |
| Lysine (Lys) iii | 0.96 ± 0.01 c | 0.99 ± 0.02 c | 1.17 ± 0.03 b | 1.69 ± 0.06 a | 1.73 ± 0.05 a |
| Total essential amino acids (TEAAs) | 6.10 ± 0.32 c | 6.55 ± 0.54 b | 7.02 ± 0.02 b | 7.21 ± 0.24 a | 7.53 ± 0.09 a |
| Total hydrolyzed essential amino acid (THEAA) | 3.62 ± 0.03 ab | 3.51 ± 0.18 ab | 3.86 ± 0.28 a | 3.65 ± 0.12 a | 3.51 ± 0.38 b |
| Total non-essential amino acids (TNEAAs) | 7.66 ± 0.12 d | 8.26 ± 0.43 c | 8.81 ± 0.31 b | 9.05 ± 0.32 b | 9.16 ± 0.20 a |
| Total amino acid (TAA) | 17.38 ± 0.55 c | 18.32 ± 1.69 c | 19.69 ± 0.47 b | 19.91 ± 0.71 a | 20.20 ± 0.17 a |
| TEAA/TAA | 0.35 ± 0.01 b | 0.36 ± 0.01 ab | 0.36 ± 0.01 ab | 0.36 ± 0.01 ab | 0.37 ± 0.01 a |
| TEAA/TNEAA | 0.80 ± 0.02 b | 0.80 ± 0.03 b | 0.80 ± 0.01 b | 0.80 ± 0.03 b | 0.82 ± 0.02 a |
| Groups | Thr | Val | Met + Cys | Isoleucine | Leu | Phe + Tyr | Lys | Total |
|---|---|---|---|---|---|---|---|---|
| 0L:24D | 271 | 274 | 195 | 247 | 419 | 443 | 496 | 2345 |
| 8L:16D | 266 | 257 | 157 | 230 | 396 | 419 | 458 | 2183 |
| 12L:12D | 269 | 270 | 177 | 241 | 422 | 441 | 457 | 2277 |
| 16L:8D | 271 | 281 | 196 | 251 | 431 | 454 | 516 | 2400 |
| 24L:0D | 288 | 292 | 217 | 263 | 459 | 482 | 543 | 2544 |
| FAO/WHO pattern | 250 | 310 | 220 | 250 | 440 | 380 | 340 | 2190 |
| egg protein pattern | 292 | 411 | 386 | 331 | 534 | 565 | 441 | 2960 |
| EAA | AAS | CS | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 0L:24D | 8L:16D | 12L:12D | 16L:8D | 24L:0D | 0L:24D | 8L:16D | 12L:12D | 16L:8D | 24L:0D | |
| Thr | 1.08 | 1.06 | 1.08 | 1.08 | 1.15 | 0.93 | 0.91 | 0.92 | 0.93 | 0.99 |
| Val | 0.88 | 0.83 | 0.87 | 0.91 | 0.94 | 0.67 | 0.63 | 0.66 | 0.68 | 0.71 |
| Lys | 1.46 | 1.35 | 1.35 | 1.52 | 1.60 | 1.13 | 1.04 | 1.04 | 1.17 | 1.23 |
| Leu | 0.95 | 0.90 | 0.96 | 0.98 | 1.04 | 0.78 | 0.74 | 0.79 | 0.81 | 0.86 |
| Ile | 0.99 | 0.92 | 0.97 | 1.01 | 1.05 | 0.75 | 0.70 | 0.73 | 0.76 | 0.79 |
| Phe + Tyr | 1.17 | 1.10 | 1.16 | 1.20 | 1.27 | 0.78 | 0.74 | 0.78 | 0.80 | 0.85 |
| Met + Cys | 0.89 | 0.71 | 0.81 | 0.89 | 0.99 | 0.51 | 0.41 | 0.46 | 0.51 | 0.56 |
| EAAI | 77.07 | 71.11 | 74.67 | 78.63 | 83.56 | |||||
| Fatty Acids | Groups | ||||
|---|---|---|---|---|---|
| 0L:24D | 8L:16D | 12L:12D | 16L:8D | 24L:0D | |
| C14:0 | 3.86 ± 0.53 b | 3.23 ± 0.62 b | 5.18 ± 0.61 a | 5.19 ± 0.07 a | 4.18 ± 0.85 ab |
| C15:0 | 0.21 ± 0.03 | 0.24 ± 0.02 | 0.25 ± 0.02 | 0.23 ± 0.02 | 0.23 ± 0.02 |
| C16:0 | 15.18 ± 0.90 c | 17.66 ± 0.69 b | 18.56 ± 0.42 ab | 19.08 ± 0.22 a | 19.33 ± 0.64 a |
| C17:0 | 0.28 ± 0.01 | 0.28 ± 0.01 | 0.28 ± 0.02 | 0.27 ± 0.01 | 0.27 ± 0.02 |
| C18:0 | 5.73 ± 0.14 | 5.63 ± 0.26 | 5.64 ± 0.07 | 5.60 ± 0.22 | 5.62 ± 0.21 |
| C20:0 | 0.28 ± 0.01 ab | 0.30 ± 0.01 a | 0.27 ± 0.02 b | 0.31 ± 0.02 a | 0.25 ± 0.01 b |
| C22:0 | 0.20 ± 0.02 | 0.18 ± 0.03 | 0.20 ± 0.01 | 0.20 ± 0.01 | 0.18 ± 0.02 |
| C23:0 | 0.06 ± 0.01 | 0.06 ± 0.01 | 0.06 ± 0.02 | 0.05 ± 0.01 | 0.05 ± 0.01 |
| C24:0 | 0.12 ± 0.02 b | 0.18 ± 0.01 a | 0.13 ± 0.01 b | 0.11 ± 0.01 bc | 0.09 ± 0.02 c |
| C16:1 | 3.22 ± 0.60 a | 2.34 ± 0.16 b | 2.83 ± 0.10 ab | 2.98 ± 0.44 ab | 3.14 ± 0.40 ab |
| C18:1n9t | 0.10 ± 0.01 c | 0.14 ± 0.01 b | 0.20 ± 0.05 b | 0.16 ± 0.01 b | 0.27 ± 0.04 a |
| C18:1n9c | 23.36 ± 3.22 a | 17.90 ± 1.30 b | 20.99 ± 1.09 ab | 21.46 ± 1.61 ab | 23.40 ± 2.60 a |
| C20:1 | 1.34 ± 0.04 | 1.26 ± 0.11 | 1.26 ± 0.11 | 1.33 ± 0.05 | 1.34 ± 0.12 |
| C22:1n9 | 2.87 ± 1.01 b | 5.74 ± 0.68 a | 3.97 ± 1.01 ab | 4.02 ± 0.51 ab | 3.62 ± 0.98 b |
| C24:1 | 0.36 ± 0.01 b | 0.54 ± 0.07 a | 0.40 ± 0.03 b | 0.40 ± 0.04 b | 0.38 ± 0.08 b |
| C18:2n6c | 19.33 ± 0.75 | 19.66 ± 0.29 | 20.19 ± 0.24 | 20.47 ± 1.62 | 19.57 ± 0.69 |
| C18:3n6 | 0.40 ± 0.01 b | 0.37 ± 0.04 c | 0.42 ± 0.02 ab | 0.43 ± 0.02 ab | 0.45 ± 0.01 a |
| C18:3n3 | 2.30 ± 0.39 b | 2.70 ± 0.36 b | 3.94 ± 0.36 a | 3.75 ± 0.23 a | 2.90 ± 0.24 b |
| C20:2 | 0.76 ± 0.09 b | 0.94 ± 0.17 a | 0.80 ± 0.04 ab | 0.77 ± 0.04 b | 0.89 ± 0.05 ab |
| C20:3n6 | 0.08 ± 0.01 b | 0.09 ± 0.01 b | 0.12 ± 0.01 a | 0.09 ± 0.01 b | 0.10 ± 0.01 a |
| C20:3n3 | 0.12 ± 0.02 b | 0.18 ± 0.03 a | 0.15 ± 0.02 ab | 0.15 ± 0.02 ab | 0.14 ± 0.04 ab |
| C20:4n6 | 0.73 ± 0.13 | 0.79 ± 0.15 | 0.57 ± 0.04 | 0.68 ± 0.18 | 0.73 ± 0.10 |
| C22:2 | 0.14 ± 0.01 | 0.21 ± 0.01 | 0.18 ± 0.04 | 0.16 ± 0.02 | 0.15 ± 0.04 |
| EPA(C20:5n3) | 4.21 ± 0.15 | 4.69 ± 0.21 | 4.24 ± 0.29 | 4.32 ± 0.36 | 4.26 ± 0.41 |
| DHA(C22:6n3) | 9.62 ± 2.60 | 11.00 ± 3.14 | 9.19 ± 0.11 | 9.43 ± 1.72 | 9.09 ± 1.12 |
| SFA | 25.39 ± 0.49 c | 27.89 ± 0.13 b | 30.58 ± 0.72 a | 30.90 ± 0.24 a | 30.30 ± 0.22 ab |
| MUFA | 32.31 ± 2.13 | 29.65 ± 3.42 | 29.64 ± 0.91 | 30.33 ± 1.57 | 31.53 ± 1.70 |
| PUFA | 32.52 ± 2.05 c | 39.03 ± 1.00 b | 39.79 ± 0.42 b | 40.47 ± 3.39 b | 44.21 ± 2.11 a |
| EPA+DHA | 12.30 ± 1.00 | 13.97 ± 2.16 | 13.43 ± 0.30 | 13.75 ± 2.07 | 14.21 ± 0.24 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fang, Y.; Fei, F.; Guo, F.; Zhu, C.; Gao, X.; Li, W.; Yang, H.; Sun, Y.; Zhang, C.; Liu, B. Effect of Photoperiod on Nutritional Quality of Muscle and Lipid Metabolism of Litopenaeus vannamei. Fishes 2024, 9, 508. https://doi.org/10.3390/fishes9120508
Fang Y, Fei F, Guo F, Zhu C, Gao X, Li W, Yang H, Sun Y, Zhang C, Liu B. Effect of Photoperiod on Nutritional Quality of Muscle and Lipid Metabolism of Litopenaeus vannamei. Fishes. 2024; 9(12):508. https://doi.org/10.3390/fishes9120508
Chicago/Turabian StyleFang, Yingying, Fan Fei, Fulu Guo, Chengliang Zhu, Xiaoqiang Gao, Wenyang Li, Hongjun Yang, Yan Sun, Chuanxin Zhang, and Baoliang Liu. 2024. "Effect of Photoperiod on Nutritional Quality of Muscle and Lipid Metabolism of Litopenaeus vannamei" Fishes 9, no. 12: 508. https://doi.org/10.3390/fishes9120508
APA StyleFang, Y., Fei, F., Guo, F., Zhu, C., Gao, X., Li, W., Yang, H., Sun, Y., Zhang, C., & Liu, B. (2024). Effect of Photoperiod on Nutritional Quality of Muscle and Lipid Metabolism of Litopenaeus vannamei. Fishes, 9(12), 508. https://doi.org/10.3390/fishes9120508
