Physiological Function Disturbances and Adaptive Responses in Nile Tilapia (Oreochromis niloticus) Under Different Salinity Stresses
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Acquisition and Maintenance
2.2. Experimental Design and Sample Collection
2.3. Biochemical Analysis
2.4. Quantitative Real-Time PCR (qPCR) Analysis
2.5. Integrated Biomarker Response (IBR)
2.6. Statistical Analysis
3. Results
3.1. Evaluation of Intestinal Energy Metabolism and Immune Indicators
3.2. Assessment of Brain Energy Metabolism and Antioxidant Indices
3.3. Assessment of Basic Muscle Indicators
3.4. Related Gene Expression Assessments
3.5. Integrated Biomarker Response (IBR) Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Silvy, Y.; Guilyardi, E.; Sallée, J.B.; Durack, P.J. Human-induced changes to the global ocean water masses and their time of emergence. Nat. Clim. Chang. 2020, 10, 1030–1036. [Google Scholar] [CrossRef]
- Röthig, T.; Trevathan-Tackett, S.M.; Voolstra, C.R.; Ross, C.; Chaffron, S.; Durack, P.J.; Warmuth, L.M.; Sweet, M. Human-induced salinity changes impact marine organisms and ecosystems. Glob. Chang. Biol. 2023, 29, 4731–4749. [Google Scholar] [CrossRef]
- Dehler, C.E.; Secombes, C.J.; Martin, S.A.M. Seawater transfer alters the intestinal microbiota profiles of Atlantic salmon (Salmo salar L.). Sci. Rep. 2017, 7, 13877. [Google Scholar] [CrossRef] [PubMed]
- Islam, M.J.; Kunzmann, A.; Slater, M.J. Extreme winter cold-induced osmoregulatory, metabolic, and physiological responses in European seabass (Dicentrarchus labrax) acclimatized at different salinities. Sci. Total Environ. 2021, 771, 145202. [Google Scholar] [CrossRef] [PubMed]
- Islam, M.J.; Kunzmann, A.; Thiele, R.; Slater, M.J. Effects of extreme ambient temperature in European seabass, Dicentrarchus labrax acclimated at different salinities: Growth performance, metabolic and molecular stress responses. Sci. Total Environ. 2020, 735, 139371. [Google Scholar] [CrossRef]
- Mena, F.; González-Ortegón, E.; Solano, K.; Araújo, C.V.M. The effect of the insecticide diazinon on the osmoregulation and the avoidance response of the white leg shrimp (Penaeus vannamei) is salinity dependent. Ecotoxicol. Environ. Saf. 2020, 206, 111364. [Google Scholar] [CrossRef]
- Xiong, Y.H.; Dong, S.L.; Huang, M.; Li, Y.; Wang, X.; Wang, F.; Ma, S.S.; Zhou, Y.G. Growth, osmoregulatory response, adenine nucleotide contents, and liver transcriptome analysis of steelhead trout (Oncorhynchus mykiss) under different salinity acclimation methods. Aquaculture 2020, 520, 734937. [Google Scholar] [CrossRef]
- Dawood, M.A.O.; Noreldin, A.E.; Sewilam, H. Long term salinity disrupts the hepatic function, intestinal health, and gills antioxidative status in Nile tilapia stressed with hypoxia. Ecotoxicol. Environ. Saf. 2021, 220, 112412. [Google Scholar] [CrossRef]
- Morgan, J.D.; Iwama, G.K. Effects of salinity on growth, metabolism, and ion regulation in juvenile rainbow and steelhead trout (Oncorhynchus mykiss) and fall chinook salmon (Oncorhynchus tshawytscha). Can. J. Fish. Aquat. Sci. 1991, 48, 2083–2094. [Google Scholar] [CrossRef]
- Sangiao-Alvarellos, S.; Arjona, F.J.; del Río, M.P.M.; Míguez, J.M.; Mancera, J.M.; Soengas, J.L. Time course of osmoregulatory and metabolic changes during osmotic acclimation in Sparus auratus. J. Exp. Biol. 2005, 208, 4291–4304. [Google Scholar] [CrossRef]
- Bœuf, G.; Payan, P. How should salinity influence fish growth? Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2001, 130, 411–423. [Google Scholar] [CrossRef]
- Krogdahl, A.; Sundby, A.; Olli, J.J. Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) digest and metabolize nutrients differently. Effects of water salinity and dietary starch level. Aquaculture 2004, 229, 335–360. [Google Scholar] [CrossRef]
- Lushchak, V.I. Environmentally induced oxidative stress in aquatic animals. Aquat. Toxicol. 2011, 101, 13–30. [Google Scholar] [CrossRef] [PubMed]
- Fang, H.; Yang, Y.Y.; Wu, X.M.; Zheng, S.Y.; Song, Y.J.; Zhang, J.; Chang, M.X. Effects and Molecular Regulation Mechanisms of Salinity Stress on the Health and Disease Resistance of Grass Carp. Front. Immunol. 2022, 13, 917497. [Google Scholar] [CrossRef] [PubMed]
- Sardella, B.A.; Brauner, C.J. The effect of elevated salinity on ‘California’ Mozambique tilapia (Oreochromis mossambicus x O. urolepis hornorum) metabolism. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2008, 148, 430–436. [Google Scholar] [CrossRef] [PubMed]
- Li, X.J.; Shen, Y.D.; Bao, Y.G.; Wu, Z.X.; Yang, B.Q.; Jiao, L.F.; Zhang, C.D.; Tocher, D.R.; Zhou, Q.C.; Jin, M. Physiological responses and adaptive strategies to acute low-salinity environmental stress of the euryhaline marine fish black seabream (Acanthopagrus schlegelii). Aquaculture 2022, 554, 738117. [Google Scholar] [CrossRef]
- Moniruzzaman, M.; Mukherjee, M.; Kumar, S.; Chakraborty, S.B. Effects of salinity stress on antioxidant status and inflammatory responses in females of a “Near Threatened” economically important fish species Notopterus chitala: A mechanistic approach. Environ. Sci. Pollut. Res. 2022, 29, 75031–75042. [Google Scholar] [CrossRef]
- Schmitz, M.; Douxfils, J.; Mandiki, S.N.M.; Morana, C.; Baekelandt, S.; Kestemont, P. Chronic hyperosmotic stress interferes with immune homeostasis in striped catfish (Pangasianodon hypophthalmus, S.) and leads to excessive inflammatory response during bacterial infection. Fish Shellfish Immunol. 2016, 55, 550–558. [Google Scholar] [CrossRef]
- Xing, S.Y.; Li, P.; He, S.W.; Cao, Z.H.; Wang, X.; Cao, X.Q.; Liu, B.; Chen, C.Z.; You, H.; Li, Z.H. Physiological responses in Nile tilapia (Oreochromis niloticus) induced by combined stress of environmental salinity and triphenyltin. Mar. Environ. Res. 2022, 180, 105736. [Google Scholar] [CrossRef]
- du Sert, N.P.; Ahluwalia, A.; Alam, S.; Avey, M.T.; Baker, M.; Browne, W.J.; Clark, A.; Cuthill, I.C.; Dirnagl, U.; Emerson, M.; et al. Reporting animal research: Explanation and elaboration for the ARRIVE guidelines 2.0. PLoS Biol. 2020, 18, e3000411. [Google Scholar] [CrossRef]
- Bouskill, N.J.; Handy, R.D.; Ford, T.E.; Galloway, T.S. Differentiating copper and arsenic toxicity using biochemical biomarkers in Asellus aquaticus and Dreissena polymorpha. Ecotoxicol. Environ. Saf. 2006, 65, 342–349. [Google Scholar] [CrossRef] [PubMed]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.H.; Xing, S.Y.; Li, P.; He, S.W.; Cao, Z.H.; Wang, X.; Cao, X.Q.; Liu, B.; You, H. Systematic toxicological analysis of the effect of salinity on the physiological stress induced by triphenyltin in Nile tilapia. Aquat. Toxicol. 2023, 257, 106441. [Google Scholar] [CrossRef] [PubMed]
- Feng, J.Y.; Liu, Q.Q.; Xu, H.Z.; Chen, R.H.; Luo, L.; Lin, S.M.; Chen, Y.J.; Wang, D.S. Postprandial change in glucose metabolism at the molecular level in the adipose tissue of omnivorous GIFT Oreochromis niloticus. Fish. Sci. 2019, 85, 33–41. [Google Scholar] [CrossRef]
- Du, R.Y.; Chen, J.X.; Zhu, J.; Feng, J.Y.; Luo, L.; Lin, S.M.; Chen, Y.J. Glucose homeostasis and glucose tolerance were impaired with elevated lipid to starch ratios in practical diets for the omnivorous genetically improved farmed tilapia Oreochromis niloticus. Aquaculture 2020, 523, e735221. [Google Scholar] [CrossRef]
- Ayisi, C.L.; Zhao, J.L.; Hua, X.M.; Apraku, A. Replacing fish oil with palm oil: Effects on mRNA expression of fatty acid transport genes and signalling factors related to lipid metabolism in Nile tilapia (Oreochromis niloticus). Aquac. Nutr. 2018, 24, 1822–1833. [Google Scholar] [CrossRef]
- Yue, M.M.; Zhao, J.L.; Tang, S.J.; Zhao, Y. Effects of Estradiol and Testosterone on the Expression of Growth-related Genes in Female and Male Nile Tilapia, Oreochromis niloticus. J. World Aquac. Soc. 2018, 49, 216–228. [Google Scholar] [CrossRef]
- Kishawy, A.T.Y.; Mohammed, H.A.; Zaglool, A.W.; Attia, M.S.; Hassan, F.A.M.; Roushdy, E.M.; Ismail, T.A.; Ibrahim, D. Partial defatted black solider larvae meal as a promising strategy to replace fish meal protein in diet for Nile tilapia (Oreochromis niloticus): Performance, expression of protein and fat transporters, and cytokines related genes and economic efficiency. Aquaculture 2022, 555, e738195. [Google Scholar] [CrossRef]
- Abdel-Tawwab, M.; Khalil, R.H.; Selema, T.; Elsamanooudy, S.I.; El-Werwary, S.O.M.; Shady, S.H.H.; Monier, M.N.; Ismaiel, M.M.S. Dietary Chlorella vulgaris effectively alleviates oxidative stress, immunosuppression, and enhances the resistance to Streptococcus agalactiae infection in cadmium-intoxicated Nile tilapia fingerlings. Fish Shellfish Immunol. 2023, 136, 108717. [Google Scholar] [CrossRef]
- Abdelazim, A.M.; Saadeldin, I.M.; Swelum, A.A.A.; Afifi, M.M.; Alkaladi, A. Oxidative Stress in the Muscles of the Fish Nile Tilapia Caused by Zinc Oxide Nanoparticles and Its Modulation by Vitamins C and E. Oxidative Med. Cell. Longev. 2018, 2018, 6926712. [Google Scholar] [CrossRef]
- Tseng, Y.C.; Hwang, P.P. Some insights into energy metabolism for osmoregulation in fish. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2008, 148, 419–429. [Google Scholar] [CrossRef] [PubMed]
- Laiz-Carrión, R.; Sangiao-Alvarellos, S.; Guzmán, J.M.; del Río, M.P.M.; Míguez, J.M.; Soengas, J.L.; Mancera, J.M. Energy metabolism in fish tissues related to osmoregulation and cortisol action. Fish Physiol. Biochem. 2002, 27, 179–188. [Google Scholar] [CrossRef]
- Jiang, I.F.; Kumar, V.B.; Lee, D.N.; Weng, C.F. Acute osmotic stress affects Tilapia (Oreochromis mossambicus) innate immune responses. Fish Shellfish Immunol. 2008, 25, 841–846. [Google Scholar] [CrossRef]
- Ouyang, H.F.; Deng, N.N.; Xu, J.C.; Huang, J.J.; Han, C.; Liu, D.R.; Liu, S.Y.; Yan, B.H.; Han, L.Q.; Li, S.S.; et al. Effects of hyperosmotic stress on the intestinal microbiota, transcriptome, and immune function of mandarin fish (Siniperca chuatsi). Aquaculture 2023, 563, 13. [Google Scholar] [CrossRef]
- Lu, M.Y.; Su, M.L.; Liu, N.X.; Zhang, J.B. Effects of environmental salinity on the immune response of the coastal fish Scatophagus argus during bacterial infection. Fish Shellfish Immunol. 2022, 124, 401–410. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.W.; Li, Y.H.; Liao, N.; Shang, X.Z.; Xu, F.Q.; Yin, D.C.; Shao, D.Y.; Jiang, C.M.; Shi, J.L. Energy metabolic mechanisms for high altitude sickness: Downregulation of glycolysis and upregulation of the lactic acid/amino acid-pyruvate-TCA pathways and fatty acid oxidation. Sci. Total Environ. 2023, 894, 164998. [Google Scholar] [CrossRef]
- Zhao, H.; Ke, H.Y.; Zhang, L.; Zhao, Z.M.; Lai, J.S.; Zhou, J.; Huang, Z.P.; Li, H.D.; Du, J.; Li, Q. Integrated analysis about the effects of heat stress on physiological responses and energy metabolism in Gymnocypris chilianensis. Sci. Total Environ. 2022, 806, 151252. [Google Scholar] [CrossRef]
- Jenkins, C.M.; Yang, J.Y.; Sims, H.F.; Gross, R.W. Reversible high affinity inhibition of phosphofructokinase-1 by acyl-CoA: A mechanism integrating glycolytic flux with lipid metabolism. J. Biol. Chem. 2011, 286, 11937–11950. [Google Scholar] [CrossRef] [PubMed]
- Shan, H.W.; Geng, Z.X.; Ma, S.; Wang, T. Comparative study of the key enzymes and biochemical substances involved in the energy metabolism of Pacific white shrimp, Litopenaeus vannamei, with different ammonia-N tolerances. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2019, 221, 73–81. [Google Scholar] [CrossRef]
- Dickinson, B.C.; Chang, C.J. Chemistry and biology of reactive oxygen species in signaling or stress responses. Nat. Chem. Biol. 2011, 7, 504–511. [Google Scholar] [CrossRef]
- Li, Z.H.; Chen, L.; Wu, Y.H.; Li, P.; Li, Y.F.; Ni, Z.H. Effects of mercury on oxidative stress and gene expression of potential biomarkers in larvae of the Chinese rare minnow Gobiocypris rarus. Arch. Environ. Contam. Toxicol. 2014, 67, 245–251. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.H.; Xu, H.Y.; Zheng, W.L.; Lam, S.H.; Gong, Z.Y. RNA-Sequencing Analysis of TCDD-Induced Responses in Zebrafish Liver Reveals High Relatedness to In Vivo Mammalian Models and Conserved Biological Pathways. PLoS ONE 2013, 8, e77292. [Google Scholar] [CrossRef]
- Cui, W.T.; Cao, L.; Liu, J.H.; Ren, Z.H.; Zhao, B.; Dou, S.Z. Effects of seawater acidification and cadmium on the antioxidant defense of flounder Paralichthys olivaceus larvae. Sci. Total Environ. 2020, 718, 137234. [Google Scholar] [CrossRef] [PubMed]
- Ross, D. Glutathione, free radicals and chemotherapeutic agents: Mechanisms of free-radical induced toxicity and glutathione-dependent protection. Pharmacol. Ther. 1988, 37, 231–249. [Google Scholar] [CrossRef]
- Di Giulio, R.T.; Habig, C.; Gallagher, E.P. Effects of Black Rock Harbor sediments on indices of biotransformation, oxidative stress, and DNA integrity in channel catfish. Aquat. Toxicol. 1993, 26, 1–22. [Google Scholar] [CrossRef]
- Dawood, M.A.O.; Koshio, S.; El-Sabagh, M.; Billah, M.M.; Zaineldin, A.I.; Zayed, M.M.; Omar, A. Changes in the growth, humoral and mucosal immune responses following β-glucan and vitamin C administration in red sea bream, Pagrus major. Aquaculture 2017, 470, 214–222. [Google Scholar] [CrossRef]
- Cheng, C.H.; Yang, F.F.; Ling, R.Z.; Liao, S.A.; Miao, Y.T.; Ye, C.X.; Wang, A.L. Effects of ammonia exposure on apoptosis, oxidative stress and immune response in pufferfish (Takifugu obscurus). Aquat. Toxicol. 2015, 164, 61–71. [Google Scholar] [CrossRef] [PubMed]
- Baysoy, E.; Atli, G.; Gürler, C.; Dogan, Z.; Eroglu, A.; Kocalar, K.; Canli, M. The effects of increased freshwater salinity in the biodisponibility of metals (Cr, Pb) and effects on antioxidant systems of Oreochromis niloticus. Ecotoxicol. Environ. Saf. 2012, 84, 249–253. [Google Scholar] [CrossRef]
- Loro, V.L.; Jorge, M.B.; da Silva, K.R.; Wood, C.M. Oxidative stress parameters and antioxidant response to sublethal waterborne zinc in a euryhaline teleost Fundulus heteroclitus: Protective effects of salinity. Aquat. Toxicol. 2012, 110–111, 187–193. [Google Scholar] [CrossRef]
- Despa, S.; Bossuyt, J.; Han, F.; Ginsburg, K.S.; Jia, L.G.; Kutchai, H.; Tucker, A.L.; Bers, D.M. Phospholemman-phosphorylation mediates the β-adrenergic effects on Na/K pump function in cardiac myocytes. Circ. Res. 2005, 97, 252–259. [Google Scholar] [CrossRef]
- Derobertis, E.; Pellegrino, A.; Rodriguesdasilva, G.; Salganicoff, L. Cholinergic and non-cholinergic nerve endings in rat brain–I: Isolation and subcellular distribution of acetylcholine and acetylcholinesterase. J. Neurochem. 1962, 9, 23. [Google Scholar] [CrossRef]
- Tan, X.Y.; Luo, Z.; Xie, P.; Li, X.D.; Liu, X.J.; Xi, W.Q. Effect of dietary conjugated linoleic acid (CLA) on growth performance, body composition and hepatic intermediary metabolism in juvenile yellow catfish Pelteobagrus fulvidraco. Aquaculture 2010, 310, 186–191. [Google Scholar] [CrossRef]
- Yang, Y.; Qi, S.Z.; Wang, D.H.; Wang, K.; Zhu, L.Z.; Chai, T.T.; Wang, C.J. Toxic effects of thifluzamide on zebrafish (Danio rerio). J. Hazard. Mater. 2016, 307, 127–136. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.Z.; Li, P.; Wang, W.B.; Li, Z.H. Response of growth performance, serum biochemical parameters, antioxidant capacity, and digestive enzyme activity to different feeding strategies in common carp (Cyprinus carpio) under high-temperature stress. Aquaculture 2022, 548, 737636. [Google Scholar] [CrossRef]
- Shi, Q.L.; Xu, H.; Kleinman, W.A.; Gibson, G.E. Novel functions of the α-ketoglutarate dehydrogenase complex may mediate diverse oxidant-induced changes in mitochondrial enzymes associated with Alzheimer’s disease. Biochim. Biophys. Acta Mol. Basis Dis. 2008, 1782, 229–238. [Google Scholar] [CrossRef] [PubMed]
- Musrati, R.A.; Kollarova, M.; Mernik, N.; Mikulasova, D. Malate dehydrogenase: Distribution, function and properties. Gen. Physiol. Biophys. 1998, 17, 193–210. [Google Scholar]
- Mitrakou, A. Kidney: Its impact on glucose homeostasis and hormonal regulation. Diabetes Res. Clin. Pract. 2011, 93, S66–S72. [Google Scholar] [CrossRef]
- Yang, S.S.; Zhao, T.T.; Ma, A.J.; Huang, Z.H.; Liu, Z.F.; Cui, W.X.; Zhang, J.S.; Zhu, C.Y.; Guo, X.L.; Yuan, C.H. Metabolic responses in Scophthalmus maximus kidney subjected to thermal stress. Fish Shellfish Immunol. 2020, 103, 37–46. [Google Scholar] [CrossRef]
- Li, H.Y.; Xu, W.J.; Jin, J.Y.; Yang, Y.X.; Zhu, X.M.; Han, D.; Liu, H.K.; Xie, S.Q. Effects of starvation on glucose and lipid metabolism in gibel carp (Carassius auratus gibelio var. CAS III). Aquaculture 2018, 496, 166–175. [Google Scholar] [CrossRef]
- Black, D.; Love, R.M. The sequential mobilisation and restoration of energy reserves in tissues of Atlantic cod during starvation and refeeding. J. Comp. Physiol. B Biochem. Syst. Environ. Physiol. 1986, 156, 469–479. [Google Scholar] [CrossRef]
- Navarro, I.; Gutiérrez, J. Fasting and starvation. Biochem. Mol. Biol. Fishes 1995, 4, 393–434. [Google Scholar]
- Wang, H.; Chang, G.; Qiang, J.; Xu, P. Relationship of RNA/DNA ratio to somatic growth of Nile tilapia juveniles (Oreochromis niloticus) under joint effects of temperature and salinity. Aquac. Res. 2017, 48, 2663–2671. [Google Scholar] [CrossRef]





| Gene Name | Sequences of Primers (5′–3′) | Reference |
|---|---|---|
| hk1a F | TGCCACTGCTACACTGAAGATGC | [24] |
| hk1a R | TCCTCGGGCGTGTCGTAGATTT | |
| pfk F | CATCCCAGCGTTCATTCCTG | [25] |
| pfk R | TGCCGTCTCCACCGATTACACA | |
| G6PD F | TGCTCCTGTTTCTCTCTCCG | [26] |
| G6PD R | CATCCCAGCGTTCATTCCTG | |
| il-1β F | TCAGTTCACCAGCAGGGATG | [23] |
| il-1β R | GACAGATAGAGGTTTGTGCC | |
| myog F | CCACAATGGAGGTCAAGG | [27] |
| myog R | AGAGTGTCGTCGTCAAGC | |
| PPAR-α F | TACGGTGTTTACGAAGCCCT | [28] |
| PPAR-α R | AGGAAGGTGTCATCTGGGTG | |
| sod F | GGTGCCCTGGAGCCCTA | [29] |
| sod R | ATGCGAAGTCTTCCACTGTC | |
| cat F | TAATGGGAGAGGGAAGATGG | [29] |
| cat R | ATCTTAGATGAGGCGGTGATG | |
| gst F | TAATGGGAGAGGGAAGATGG | [30] |
| gst R | CTCTGCGATGTAATTCAGGA | |
| nkaα1a F | AACTGATTTGGTCCCTGCAA | [19] |
| nkaα1a R | ATGCATTTCTGGGCTGTCTC | |
| β-actin F | TGGTGGGTATGGGTCAGAAAG | [19] |
| β-actin R | CTGTTGGCTTTGGGGTTCA |
| Factors/Interactions | IL-β | ACP | PFK | PK | HK | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| DF | F | p | F | p | F | p | F | p | F | p | |
| Time | 2 | 28.911 | 0.000 | 289.271 | 0.000 | 11.120 | 0.000 | 8.261 | 0.003 | 33.963 | 0.000 |
| Salinity | 2 | 5.535 | 0.013 | 398.737 | 0.000 | 175.659 | 0.000 | 79.464 | 0.000 | 116.685 | 0.002 |
| Time ∗ Salinity | 4 | 11.296 | 0.000 | 100.448 | 0.000 | 11.611 | 0.000 | 10.183 | 0.000 | 2.425 | 0.086 |
| Factors/Interactions | SDH | MDH | NKA | SOD | MDA | GSH | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| DF | F | p | F | p | F | p | F | p | F | p | F | p | |
| Time | 2 | 2.433 | 0.116 | 28.390 | 0.000 | 9.241 | 0.000 | 20.892 | 0.000 | 62.475 | 0.000 | 13.508 | 0.000 |
| Salinity | 2 | 74.303 | 0.000 | 42.494 | 0.000 | 2.533 | 0.098 | 24.026 | 0.000 | 36.462 | 0.000 | 6.543 | 0.007 |
| Time ∗ Salinity | 4 | 9.414 | 0.000 | 23.143 | 0.000 | 4.766 | 0.005 | 30.534 | 0.000 | 29.843 | 0.000 | 8.609 | 0.000 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, P.; Li, T.; Xing, S.; Liu, L.; Li, Z.-H. Physiological Function Disturbances and Adaptive Responses in Nile Tilapia (Oreochromis niloticus) Under Different Salinity Stresses. Fishes 2024, 9, 498. https://doi.org/10.3390/fishes9120498
Li P, Li T, Xing S, Liu L, Li Z-H. Physiological Function Disturbances and Adaptive Responses in Nile Tilapia (Oreochromis niloticus) Under Different Salinity Stresses. Fishes. 2024; 9(12):498. https://doi.org/10.3390/fishes9120498
Chicago/Turabian StyleLi, Ping, Tengzhou Li, Shaoying Xing, Ling Liu, and Zhi-Hua Li. 2024. "Physiological Function Disturbances and Adaptive Responses in Nile Tilapia (Oreochromis niloticus) Under Different Salinity Stresses" Fishes 9, no. 12: 498. https://doi.org/10.3390/fishes9120498
APA StyleLi, P., Li, T., Xing, S., Liu, L., & Li, Z.-H. (2024). Physiological Function Disturbances and Adaptive Responses in Nile Tilapia (Oreochromis niloticus) Under Different Salinity Stresses. Fishes, 9(12), 498. https://doi.org/10.3390/fishes9120498

