Next Article in Journal
Lactococcus garvieae as a Novel Pathogen in Cultured Pufferfish (Takifugu obscurus) in China
Previous Article in Journal
Construction of a Growth Model and Screening of Growth-Related Genes for a Hybrid Puffer (Takifugu obscurus ♀ × Takifugu rubripes ♂)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 9
Issue 10
10.3390/fishes9100405
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Taurine and Enzymatic Cottonseed Protein Concentrate Supplementation in Low-Fishmeal Diet on Growth, Liver Antioxidant Capacity, and Intestinal Health of Golden Pompano (Trachinotus ovatus)

by
Zhanzhan Wang
1,2,3,
Shuling Liao
4,
Zhong Huang
2,3,
Jun Wang
2,3,
Yun Wang
2,3,
Wei Yu
2,3,
Heizhao Lin
2,3,
Zhenhua Ma
3,
Zhenyan Cheng
1,* and
Chuanpeng Zhou
2,*
1
College of Fisheries, Tianjin Agricultural University, Tianjin 300392, China
2
Key Laboratory of Aquatic Product Processing, Ministry of Agriculture and Rural Affairs, South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou 510300, China
3
Key Laboratory of Efficient Utilization and Processing of Marine Fishery Resources of Hainan Province, Sanya Tropical Fisheries Research Institute, Sanya 572018, China
4
School of Life Science, Guangzhou University, Guangzhou 510006, China
*
Authors to whom correspondence should be addressed.
Fishes 2024, 9(10), 405; https://doi.org/10.3390/fishes9100405
Submission received: 10 September 2024 / Revised: 3 October 2024 / Accepted: 4 October 2024 / Published: 9 October 2024
(This article belongs to the Section Nutrition and Feeding)
Browse Figures
Versions Notes

Abstract

:
This study was conducted to investigate the impacts of the dietary addition of taurine and enzymatic cottonseed protein concentrate (ECPC) in low-fishmeal diet on the growth performance, plasma biochemical indices, hepatic antioxidant capacity, intestinal anti-inflammatory capacity, intestinal microflora, and muscle quality of golden pompano (Trachinotus ovatus). A total of three isonitrogenous diets were given to 225 golden pompanos (5.6 ± 0.14 g). They were randomly divided into nine cages (1.0 m × 1.0 m × 1.5 m; three cages per treatment) with equal stocking numbers of twenty-five fish per cage. The results indicated that the CSM-TC group significantly increased the growth performance of juvenile T. ovatus (p < 0.05). The results indicated that compared with other groups, the addition of 1% ECPC and 0.25% taurine has been found to enhance the WGR (weight gain rate), SGR (specific growth rate), and CF (condition factor). Compared with other groups, the relative expressions of GH, GHR1, GHR2, IGF1, IGF2, and MyoG were significantly higher in fish fed with CSM-TC. The results showed that CSM-TC significantly increased the activities of alkaline phosphatase, complement 3, and complement 4 enzymes (p < 0.05). The results showed that dietary CSM-TC increased the activities of hepatic superoxide dismutase and total antioxidant capacity enzymes. Compared with other groups, the hepatic relative expressions of Nrf2, HO-1, and GSH-Px were significantly higher in fish fed with CSM-TC. The results showed that dietary CSM-TC increased the activities of intestinal chymotrypsin, lipase, and α-amylase enzymes. A CSM-TC diet significantly increased the relative expressions of IL-10, ZO-1, Occludin, Claudin-3, and Claudin-15 (p < 0.05). The results showed that CSM-C significantly increased the index of Ace and Chao1 (p < 0.05). In conclusion, a high-fermented cottonseed meal diet can have detrimental effects on physiological health in golden pompano, while adding 1% ECPC and 0.25% taurine can improve hepatic and intestinal health via attenuating inflammation and oxidative stress.
Keywords:
high-fermented cottonseed meal; taurine; enzymatic cottonseed protein concentrate; low fishmeal
Key Contribution: This study aimed to determine the effects of adding taurine and enzymatic cottonseed protein concentrate into a low-fishmeal diet on the hepatic antioxidant capacity, intestinal anti-inflammatory capacity, and meat quality of golden pompano.

1. Introduction

The global production of fisheries and aquaculture has notably increased, which may be primarily attributed to the substantial expansion of aquaculture production on a global scale, with Asia emerging as a prominent contributor to this rise [1]. Consequently, there has been a substantial surge in the demand for feed ingredients, notably fishmeal. In order to ensure the continued sustainability of aquaculture, it is imperative to incorporate alternative proteins that can either complement or replace fishmeal in aquafeeds [2]. Cottonseed meal emerges as a highly attractive alternative in comparison to other plant protein sources owing to its notable protein content, extensive accessibility, and cost-effectiveness [3]. Nevertheless, the presence of gossypol and the insufficient levels of critical amino acids in cottonseed meal pose restrictions on its application in aquaculture feeds [4]. The intestine plays a crucial role in the digestive system of fish, serving as the primary organ responsible for the process of digestion and the absorption of nutrients [5]. Substituting fishmeal with a large amount of plant proteins in fish feed might cause harm to the intestines of carnivorous fish because of the elevated presence of antinutritional substances found in plant protein sources [6]. Many studies have previously shown that dietary gossypol addition can reduced intestinal immunity and aggravated inflammation in growing grass carp (Ctenopharyngodon idella) [7]. The hepatic antioxidant defense system plays a crucial role in maintaining the proper physiological function and overall health of an animal body [8].The Keap1–Nrf2 system is currently recognized as the major cellular defense mechanism under oxidative stress [9]. It has been reported that a high-gossypol acetic diet induced excessive hepatocyte injures in carp (Carassius auratus gibelio) [10]. Previous studies have shown that replacing 70% of dietary fishmeal with cottonseed protein concentrate produced negative effects on the growth performance and flesh quality of largemouth bass (Micropterus salmoides) [11]. Fermentation is characterized by the absence of free water inside the fermentation medium, since water is assimilated into the solid substrate to facilitate microbial growth and metabolic processes. Fermented components provide the ability to be incorporated directly into formulations or employed as additions in animal feed [12]. Fermentation with Bacillus subtilis can digest free cotton phenol and improve the nutritional quality of cottonseed meal [13]. Therefore, fermented cottonseed meal was selected as a feasible substitute for fishmeal. Previous studies have shown that the FI (feed intake) and WGR (weight gain rate) of crucian carp (Carassius auratus) increased as the proportion of fermented cottonseed meal was gradually increased compared with the control group [14].
Animal tissues are amply populated with taurine, a sulfonic acid [15]. In recent years, several studies have demonstrated the indispensability of dietary taurine for various economically significant species, with a special emphasis on marine teleost fish [16]. As a result, the elimination of dietary components that are high in taurine, such as fishmeal, can lead to deficits characterized by various symptoms, including diminished growth and survival rates, heightened vulnerability to diseases, and hindered development [12]. In cases when taurine is insufficiently provided by feed, its deficiency mostly manifests as sluggish growth, diminished survival rates, and compromised antioxidant and immunological capabilities [17]. When taurine was added to the diet of golden pompano, there were significant improvements in growth performance and antioxidant status, as well as a significant reduction in lipid peroxidation [18]. Adding taurine at a dosage of 0.8% has been shown to significantly improve carbohydrate synthesis, protein digestion and absorption, and fat deposition in tilapia. Therefore, this supplementation enhances the general growth and development of tilapia [19]. Taurine is an essential β-amino acid that serves several biological functions and has significant importance in the growth and development of fish [20].
Cottonseed protein concentrate (CPC) is a recently developed form of cottonseed protein that is obtained through a process of extraction from cottonseed meal by solvent through a pressing process extraction occurring during cottonseed meal production [11]. CPC has the advantage of containing low levels of free gossypol and a high crude protein content ranging from 60 to 70% [11]. Research indicates that cottonseed protein antimicrobial peptides have the ability to cause harm to the cell membrane by interacting with its surface. Additionally, cottonseed protein hydrolysate shows great potential as a natural source of antimicrobial agents [21]. Studies suggest that replacing fishmeal with enzymatic cottonseed protein has a positive effect on the growth, immunity, and intestinal health of Chinese Soft-Shelled Turtles (Pelodiscus sinensis) [22]. Studies suggest that replacing fishmeal with enzymatic cottonseed protein has a positive effect on the liver antioxidant capacity and immune status of largemouth bass (Micropterus salmoides) [23]. Therefore, we selected taurine and enzymatic cottonseed protein concentrate to assess the impact of low-fishmeal and high-fermented cottonseed meal diets on the growth performance and feed utilization of golden pompano.
Trachinotus ovatus (T. ovatus), also referred to as the golden pompano, possesses a soft and fatty flesh, devoid of intermuscular spines. This species holds significant economic value in the field of marine aquaculture and enjoys widespread consumer popularity [24]. In this experiment, golden pompano was fed with 0.5% taurine (CSM-T), 2% enzymatic cottonseed protein (CSM-C), 1% enzymatic cottonseed protein, and 0.25% taurine (CSM-TC) diets. Therefore, the present study aimed at evaluating the effect of ECPC and taurine supplementation to a plant-based diet on growth performance, body composition, antioxidant capacity, and intestinal flora in golden pompano. The findings of this study can serve as a theoretical basis for the appropriate use of these additives in T. ovatus diets.

2. Materials and Methods

2.1. Ethical Statement

The present study was approved by the Animal Care and Use Committee of South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences (Approval number nhdf2024-09). All procedures were strictly carried out according to the regulations and guidelines approved by the committee.

2.2. Preparation of Experimental Diets

Table 1 displays the components and proximate composition of the experimental diets. The ingredients were sourced from enterprises based in the People’s Republic of China. The diets were named CSM-T, CSM-C, and CSM-TC. The CSM-T group was supplemented with 0.5% taurine, sourced from Qianjiang Yong’an Pharmaceuticals Co. Ltd. in China, with a purity of 98.5%. The CSM-C group was supplemented with 2% enzymatic cottonseed protein concentrate (ECPC). The CSM-TC group was enhanced with a 1% addition of ECPC and a 0.25% addition of taurine. After drying, the cottonseed meal was milled into a powder. Furthermore, 0.5 g of complex probiotics (Lactobacillus plantarum (3.7 × 109 CFU/g) and Bacillus subtilis (7.7 × 108 CFU/g)) was dissolved in 29 mL of sterile water and mixed with 100 g of FCSM powder [25]. After being fermented at 35 °C for 5 days, the moisture content was 3.74%. The fermentation bacteria were all sourced from Jiangsu Su Wei Institute of Microbiology Co., Ltd. (WuXi 214063, China). Protein sources included soybean meal, soybean protein concentrate, casein, and fishmeal. Lipid sources included soybean lecithin and fish oil. All the ingredients were ground into powder, sieved through 60 mesh, and thoroughly mixed with oil and water. The 2.0 and 2.5 mm diameter pellets were obtained by a pelletizer (F26, South China University of Technology, Guangzhou, China) [26] and were then stored at −20 °C in the refrigerator until used.

2.3. Fish Rearing and Experimental Conditions

The feeding trial was conducted in a seawater pond at the Shenzhen Base of the South China Sea Fisheries Research Institute of the Chinese Academy of Fishery Sciences (Shenzhen, China). Golden pompano was acclimated to the experimental system and fed with a commercial diet (crude protein ≥ 43.0%, crude fat ≥ 8.0%, Guangdong Yuequn Biotechnology Co., Ltd., Guangzhou, China) for 2 weeks. Before the feeding trial, fish were starved for 24 h. After that, 225 fish with an average starting weight of 5.6 ± 0.14 g were picked at random and put into 9 net cages. The net cages were then randomly split into three groups, with three copies in each group [25]. Fish were manually fed two times daily at 8:00 and 17:00 until apparent satiation for 8 weeks. Throughout the feeding trial, the temperature was consistently maintained within the range of 28.3–33.3 °C. The concentration of dissolved oxygen exceeded 6.0 mg/L. The salinity and ammonia levels ranged from 20 to 25 parts per thousand (‰) and from 0.05 to 0.1 milligrams per liter (mg/L), respectively. The photoperiod during the testing period corresponded to the natural cycle of daylight.

2.4. Calculations

The parameters were calculated as per the following formulae:
Survival rate (SR, %) = 100 × (finial number of fish)/(initial number of fish).
Weight gain rate (WGR, %) = 100 × (final body weight-initial body weight)/initial body weight.
Specific growth rate (SGR, % day−1) = 100 × (Ln finial individual weight − Ln initial individual weight)/number of days.
Viscerosomatic index (VSI, %) = 100 × (viscera weight, g)/(whole body weight, g).
Hepatosomatic index (HSI, %) = 100 × (liver weight, g)/(whole body weight, g).
Condition factor (CF, g/cm3) = 100 × (body weight, g)/(body length, cm)3.
Feed intake (FI, % day−1) = 100 × (crude feed intake/ABW/day) (where ABW (g) = average body weight = (Final body weight + Initial body weight)/2).
Feed conversion ratio (FCR) = dry feed weight (g)/(total final body weight − total initial body weight).
Protein efficiency ratio (PER) = fish weight gain (g)/protein intake (g)

2.5. Sample Collection

The fish were rendered unconscious using a 0.01% overdose of eugenol (Shanghai Reagent Corp., Shanghai, China), and then the fish in each net cage were tallied and their weight was measured. A sample of five fish was randomly chosen from each net cage, and their weight and body length were measured in order to determine the morphological index. Three fish from each cage were sampled and stored at −20 °C for whole body composition analysis. Blood samples were collected from the caudal vein of ten fish per cage. The plasma was taken after being centrifuged at 4 °C for 10 min at 3000× g. This was carried out so that the blood biochemical values could be found. Part of the liver samples from three fish in each cage were immediately frozen in liquid nitrogen and then stored in a −80 °C refrigerator for the subsequent determination of enzyme activity. Liver and muscle from three fish in each cage were frozen in liquid nitrogen and then stored at 80 °C until total RNA extraction. Squeeze out the intestinal contents immediately into liquid nitrogen after intestinal isolation and freeze them for subsequent flora determination. A fraction of the intestinal samples was promptly cryopreserved in liquid nitrogen and thereafter maintained in a −80 °C freezer for further assessment of enzyme activity. The liver, intestine, and muscular tissues from three fish in each cage were rapidly frozen in liquid nitrogen and thereafter held at a temperature of −80 °C until the total RNA was extracted.

2.6. Parameters Measurement and Analysis

2.6.1. Proximate Composition Analysis

The diets and ingredients underwent chemical analysis using the approved standard procedures of the Association of Official Analytical Chemists (2005) [27]. To evaluate the moisture content, the samples were subjected to a drying process in an oven at a temperature of 105 °C for a duration of 72 h. The determination of crude protein (N × 6.25) was conducted using an automated Kjeldahl analyzer (Kjeltec 8400, FOSS, Hoganos, Sweden). Lipid levels were quantified by ether extraction using a Soxhlet apparatus (Soxtec 2055, FOSS, Hoganos, Sweden). Ash was obtained by subjecting the sample to a muffle furnace (FO610C, Yamato Scientific Co., Ltd., Tokyo, Japan) at a temperature of 550 °C for a duration of 5 h.

2.6.2. Enzyme Activity Assay Analysis

The levels of total protein (TP), glutamic oxaloacetic transaminase (ALT), alkaline phosphatase (ALP), superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GSH-Px), total antioxidant capacity (T-AOC), malondialdehyde (MDA), amylase (AMY), lipase (LPS), chymotrypsin, complement 3 (C3), and complement 4 (C4) were determined using an automated analyzer (DR-200BS, Wuxi Huawei Delong Instrument Co., Ltd., Wuxi, China).

2.6.3. Gene Expression Level Analysis

The process referred to our previous methods [25]. The mid intestine’s total RNA was isolated using the Animal Total RNA Isolation Kit (FOREGENE Co., Ltd., Chengdu, China) following the directions provided by the manufacturer. Electrophoresis with 1% agarose gel was used to evaluate the quality of total RNA, and a NanoDrop 2000 ultra micro spectrophotometer (manufactured by Thermo Fisher Scientific Co., Ltd., Waltham, MA, USA) was utilized to ascertain the quantity of total RNA. The cDNA was produced from 1 μg of total RNA using the Prime Script TM RT Reagent Kit in combination with a gDNA Eraser Kit (Takara Co., Ltd., Osaka City, Japan), following the instructions provided by the manufacturer. cDNA was kept at a temperature of 20 degrees Celsius for quantitative real-time PCR. Table 2 shows the primers for the target genes and the reference gene β-actin. Sangon Biotech (Shanghai, China) Co., Ltd. was responsible for the successful synthesis of all quantitative real-time fluorescence PCR primer pairs. The Light Cycler ® 480 II Real-Time PCR System (Roche, Switzerland) was used to conduct a quantitative real-time PCR experiment, utilizing the S Dx PCR equipment (Applied Biosystems Co., Ltd., Foster City, CA, USA). The reaction mechanism for quantitative real-time PCR is as outlined: The mixture contains 2× SYBR Green Pro Taq HS Premix in a volume of 6.25 μL, cDNA template in a volume of 1 μL, forward primer in a volume of 0.5 μL, reverse primer in a volume of 0.5 μL, and RNase-free water in a volume of 4.25 μL. The qPCR methodology started with a pre-denaturation step at 95 °C for 30 s, followed by 40 cycles consisting of denaturation at 95 °C for 5 s and annealing and extension at 60 °C for 30 s. Finally, a melting curve was increased from 60 °C to 95 °C, gradually increasing by 0.5 °C/s. The relative expression of the target gene was calculated using the 2−ΔΔCT [28]. method.

2.6.4. Intestinal Microbiota Communities

The extraction of microbial DNA was conducted using Hi Pure Soil DNA Kits (Magen, Guangzhou, China). Polymerase chain reaction (PCR) was employed to amplify the V4 region of the ribosomal RNA gene, namely the 16S rDNA. The primers used for this amplification were Arch519 (CAGCMGCCGCGGTAA) and Arch915R (GTGCTCCCCCGCCAATTCCT). For the PCR procedures, a 50 μL mixture was prepared by combining 5 μL of 10× KOD Buffer, 5 μL of 2.5 mM dNTPs, 1.5 μL of each primer (5 μM), 1 μL of KOD Polymerase, and 100 ng of template DNA. This combination was prepared in triplicate. Amplicons were extracted from agarose gels at a concentration of 2% using the AxyPrep DNA Gel Extraction Kit, which is produced by Axygen Biosciences in Union City, CA, USA. The quantification procedure employed the ABI Step One Plus Real-Time PCR System, manufactured by Life Technologies in Foster City, CA, USA. The purified amplicons were combined in equal proportions and subsequently underwent paired-end sequencing (2 × 250) on an Illumina platform, using established techniques. The ACE index is used to estimate the abundance of operational taxonomic units (OTUs) in a specific ecological community. Research has shown that greater ACE values are associated with a positive link with the total variety and richness of the microbial population. The Chao1 technique was used to determine the number of OTUs in the community, and the value of Chao1 showed a positive correlation with the total number of species. The Shannon index takes into account both the abundance and even the distribution of the community, and there is a direct relationship between its value and the diversity, and distribution, of the community. The Simpson index was utilized to approximate microbial diversity in the samples, and the values exhibited a negative correlation with community diversity.

2.7. Statistical Analysis

Experimental data are presented as mean ± SEM. Statistical analysis was performed using SPSS 26.0 software (SPSS et al., USA) for Windows. All evaluated variables were subjected to an analysis of variance (ANOVA) to determine the significantly (p < 0.05) affected the observed responses. After passing the test, the experimental data were subjected to a one-way analysis of variance. If there were significant differences, the group means were further compared using Duncan’s multiple-range test, and a probability p < 0.05 was considered significant.

3. Results

3.1. Growth, Body Indices, and Feed Performance

As shown in Table 3, the SRs of fish were all >95% and were not significantly different among treatments (p > 0.05). None significantly affected the WGR, SGR, FCR, PER, VSI, HSI, and CF (p > 0.05). However, the FI was significantly affected (p < 0.05). The FI in CSM-TC was significantly higher than in other treatments (p < 0.05).

3.2. Effects of Muscle Genes

As presented in Figure 1, the relative gene expression of GH, GHR1, GHR2, IGF1, IGF2, and MyoG in fish fed with CSM-TC were significantly higher than those of the other groups (p < 0.05). The relative gene expression of Mstn, CatB, and CatL in fish fed with the CSM-T diet was significantly higher than those of the other groups (p < 0.05).

3.3. Plasma Parameters

As displayed in Table 4, AKP, C3, and C4 in CSM-TC were significantly higher than in other treatments (p < 0.05). ALT in CSM-TC was significantly lower than in other treatments (p < 0.05).

3.4. Hepatic Enzyme Activities

As displayed in Table 5, the SOD and T-AOC levels in fish fed with the CSM-TC diet were significantly higher than those of the other groups (p < 0.05). None significantly affected the GSH-Px and MDA (p > 0.05). CAT in CSM-C was significantly lower than in other treatments (p < 0.05).

3.5. Effects of Hepatic Antioxidant Genes

As shown in Figure 2, the relative gene expression of Nrf2, HO-1, and GSH-Px in fish fed with the CSM-TC diet was significantly higher than those of the other groups (p < 0.05). The relative gene expression of Keap-1 in fish fed with CSM-TC was significantly lower than those of the other groups (p < 0.05). None significantly affected the relative gene expression of SOD (p > 0.05). The relative gene expression of CAT in fish fed with CSM-C was significantly higher than those of the other groups (p < 0.05).

3.6. Intestinal Enzymes Activities Measurements

As displayed in Table 6, AMY in fish fed with CSM-TC was significantly higher than those of the other groups (p < 0.05). None significantly affected the chymotrypsin and LPS levels (p > 0.05).

3.7. Effects of Intestinal Immune-Related and Physical Barrier-Related Genes

As presented in Figure 3, the relative gene expression of IL-10, ZO-1, Occludin, Claudin-3, and Claudin-15 in fish fed with CSM-TC were significantly higher than those of the other groups (p < 0.05). The relative gene expression of NF-κB, TNF-α, IL-1β, and IL-8 in fish fed with CSM-TC were significantly lower than those of the other groups (p < 0.05).

3.8. Intestinal Microflora

3.8.1. Analysis of Microbial OUT and Alpha Diversity of Intestinal Flora

A Venn diagram analysis based on bacterial OTUs is presented in Figure 4. The analysis identified the bacterial operational taxonomic units (OTUs) that were present in all samples of the four different treatment groups, as well as those that were unique to each treatment group. The number of OTUs shared was 37 for the intersection of all groups. The golden pompano that was given the CSM-T had the lowest levels of ACE and Chao1 among all the treatments. It was shown that the dietary supplementation of taurine had an observable influence on Shannon and Simpson (p < 0.05) (Table 7). The levels of Shannon in golden pompano that were fed the CSM-T diet exhibited the highest values among all the experimental treatments.

3.8.2. Analysis of Differences between Groups of Intestinal Bacteria

The examination of the digestive contents of the golden pompano involved the assessment of various taxonomic ranks, including phylum, order, family, and genus. The taxonomic levels of the phylum and genus were selected as representative categories for the purposes of this study.
As presented in Figure 5, the phylum Fusobacteria exhibited the highest abundance within the CSM-TC group. The phylum Tenericutes exhibited the highest abundance within the CSM-TC group. As presented in Figure 6, the genera Pseudomonas, Cetobacterium, Acinetobacter, Clostridium_sensu_stricto_13, Lysinibacillus, Bhargavaea, and Corynebacterium_1 exhibited the highest abundance within the CSM-TC group. The genera Mycoplasma, Clostridium_sensu_stricto_1, and Terrisporobacter exhibited the highest abundance within the CSM-TC group.

4. Discussion

Taurine assumes a significant role in the nutritional aspects, metabolic processes, immune control, as well as growth and developmental mechanisms in fish [34,35]. The addition of taurine can improve the performance of channel catfish (Ictalurus punetaus) [36], senegalese sole (Solea senegalensis) [37], and rainbow trout (Oncorhynchus mykiss) [38] by increasing feed conversion, protein efficiency, fish protein, and growth performance. A study investigating the use of ECPC as a replacement for fishmeal found that adding moderate amounts of this concentrate did not have any noticeable effect on the growth of largemouth bass [23]. In the current investigation, the inclusion of taurine and ECPC did not negatively affect golden pompano. The results indicated that compared with other groups, the addition of 1% ECPC and 0.25% taurine has been found to enhance the WGR, SGR, and CF. The variation may be attributable to the simultaneous addition of taurine and ECPC, the fish species, or the experimental conditions. The underlying mechanisms in fish species need further detailed studies.
The primary consumable component of fish is muscle tissue, and research has demonstrated that the quality of fish muscle can be enhanced by nutritional management [39]. According to the research conducted by Yan Liangchao, it was found that taurine has the potential to enhance the muscular characteristics of fish. The enhancement in muscle quality was correlated with an augmentation in muscle nutrition, taste amino acids, and healthy fatty acids, with improvements in muscle physical qualities such as shear, water holding capacity, pH, and antioxidant capacity [40]. In the present study, the relative gene expression of GH, GHR1, GHR2, IGF1, IGF2, and MyoG in fish fed with CSM-TC were significantly higher than those of the other groups. The trait of growth is determined by multiple genes and is also influenced by environmental factors. Among these genes, the most significant ones are those responsible for growth hormone (GH) and insulin-like growth factor-I (IGF-I), as they play a central role in the hypothalamic–pituitary–somatotropic (HPS) axis [41]. The primary control of somatic growth is regulated by the growth hormone (GH)/insulin-like growth factor (IGF) axis. This crucial process is facilitated by a singular transmembrane receptor known as the growth hormone receptor (GHR). These subtypes are regulated by distinct genes, leading to divergent physiological outcomes. This review centers on the examination of IGF-I, a crucial component of the GH/IGF-I axis that plays a significant role in the process of growth [41]. The gene expressions of growth hormone (GH), growth hormone receptor 1 (GHR1), growth hormone receptor 2 (GHR2), insulin-like growth factor 1 (IGF1), and insulin-like growth factor 2 (IGF2) in the CSM-TC group exhibited greater levels compared with other groups. This suggests that the inclusion of 1% ECPC and 0.25% taurine in the diet may enhance fish growth. MRFs are transcription factors that belong to the basic helix–loop–helix (bHLH) family. These factors play a crucial role in controlling muscle hyperplasia and hypertrophy, which include the gene Myog [42]. The mechanism by which MSTN exerts its effects is widely accepted to involve the suppression of satellite cell activation, self-renewal, and proliferation [43]. Cathepsin B (CatB) and Cathepsin L (CatL) are significant constituents of the cysteine protease family, predominantly localized within lysosomes and implicated in a diverse range of physiological processes. Upon liberation from lysosomes, they possess the capability to impair the structural integrity of muscle proteins and expedite the process of muscle softening [44]. There is limited literature available regarding the potential effects of incorporating taurine and ECPC on muscle quality. In the present study, the relative gene expressions of Mstn, CatB, and CatL in fish fed with the CSM-TC diet were significantly lower than those of the other groups. This study’s findings that the addition of 1% ECPC and 0.25% taurine has increased muscle development and reduced quality degradation in fish.
AKP holds significant regulatory importance and is closely linked to various critical processes. It plays a crucial role in facilitating the absorption of important nutrients such as lipids, glucose, calcium, and inorganic phosphates [45]. In the present study, CSM-TC significantly improved plasma AKP activity, which indicated that the process of nutrient absorption in golden pompano improved [46]. C4 is a globulin found in fish that displays zymogenic activity, enabling it to effectively eliminate or eliminate harmful bacteria [47]. In the present study, compared with the other groups, plasma AKP, C3, and C4 activity in the CSM-TC group were significantly higher. These findings suggest that the appropriate inclusion of taurine can enhance the fish’s immune response, which may be compromised when fishmeal is replaced with FCSM. This is similar to the findings of Zhang et al. [48]. Hence, the findings of this study demonstrated that the incorporation of 1% ECPC and 0.25% taurine enhanced plasma nutritional absorption mechanisms when FCSM replaced 50% of fishmeal.
If the reactive oxygen radicals (ROS) that are produced during animal metabolism are not effectively eliminated, they can cause the oxidation of lipids, specifically ω-3 and ω-6 fatty acids. This oxidation process results in the formation of lipid oxidation products, such as MDA [49]. In severe cases, this can lead to apoptosis. The level of reactive oxygen species (ROS) can be used as an indirect measure of the amount of reactive oxygen radicals and the degree of lipid peroxidation in tissues and cells [50]. In the present study, MDA in fish fed with CSM-TC was lower than other groups. Consequently, the inclusion of 1% ECPC and 0.25% taurine can effectively mitigate the occurrence of lipid oxidation. Similar results were also found in marine carnivorous fish, Scophthalmus maximus L. [51]. Superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), and catalase (CAT) are essential intracellular enzymes that play a critical role in antioxidant defense systems [52]. SOD is responsible for scavenging superoxide anion radicals, while CAT eliminates hydrogen peroxide within the organism [50]. The activity of these enzymes can serve as an indicator of the organism’s capacity to counteract oxygen radicals. In the present study, SOD, GSH-Px, and T-AOC in fish fed with the CSM-TC diet were significantly higher than those of the other groups. Similar results were also found in Litopenaeus vannamei [53]. The transcription factor Nrf-2, which acts as a mediator in the Keap1-Nrf2-ARE signaling pathway, plays a substantial role in modulating inflammatory responses [54]. The primary line of enzymatic defense against free radicals in organisms consists of the antioxidant enzymes CAT, SOD, and GSH-Px [45]. Previous studies showed that taurine binds to hypochlorous acid to form tauroch loramine, which activates the Nrf2/ARE signaling pathway and upregulates the relative gene expression of antioxidant enzymes [55]. In the present study, the relative gene expression of Nrf-2, HO-1, and GSH-Px in fish fed with CSM-TC were significantly higher than those of the other groups. Similar results were also found in Rhynchocypris lagowskii Dybowski [56].
It has been reported that the growth performance and enzymatic activity of lipase and amylase in Anguilla were significantly affected by the addition of a certain amount of taurine [57]. In the current study, the activities of chymotrypsin and AMY were found to increase in CSM-T and CSM-TC compared to CSM-C. Similarly, the previous analysis on Lateolabrax maculatus indicated that taurine supplementation resulted in an elevation of lipase activity and a reduction in hepatic fat content [58]. Research has demonstrated that the reduction in the relative gene expression of proinflammatory factors TNF-a and IL-8, along with the increase in the mRNA level of the anti-inflammatory factor IL-10, can effectively impede inflammation within immunological organs [59]. In the present investigation, the relative gene expression of IL-10 in fish fed with CSM-TC were significantly higher than those of the other groups. These results suggest that the appropriate inclusion of taurine and ECPC can ameliorate the inflammatory damage caused by the substitution of fishmeal with fermented cotton meal in the intestinal tract. The previous study showed that taurine may possess the ability to mitigate intestinal inflammation induced by high levels of phytoalexins. This is achieved through the modulation of the TLRs/NF-κB signaling pathway [60]. The role of NF-κB, a crucial regulator of gene expression associated with proinflammatory processes, has been documented to have a substantial impact on inflammation [61]. TNF-α and IL-1β are recognized as potent proinflammatory factors that play a crucial role in the initiation and progression of inflammation organisms. These molecules exhibit a high sensitivity to changes in tissue damage and are considered the primary mediators of the inflammatory response [62]. In the present study, the relative gene expression of NF-κB, TNF-α, and IL-1β in fish fed with CSM-TC were significantly lower than those of the other groups. These findings suggest that the inclusion of 1% ECPC and 0.25% taurine in the diet led to an improvement in intestinal inflammation in golden pompano. Intestinal permeability has traditionally been regarded as a reliable measure of the integrity and functionality of the intestinal epithelial barrier. The regulation of this barrier was predominantly governed by a highly organized system of an epithelial junctional complex known as the tight junction [63,64]. Occludin and ZO-1 play pivotal roles in the structural and functional organization of tight junctions, making them very significant components [65]. Claudin-3 protein is essential for strengthening the integrity of the paracellular intestinal barrier by facilitating the establishment of tight junctions (TJ) [66]. Claudin-15 is widely present in the tight junctions of both the villi and crypt cells in the small and large intestines [67]. The relative gene expression of ZO-1, Claudin-3, Claudin-15, and Occludin in fish fed with CSM-TC were significantly higher than those of the other groups. These results suggest that the addition of 1% ECPC and 0.25% taurine can enhance the fish gut’s physical barrier capacity. This suggests that the inclusion of taurine and ECPC may have a beneficial effect on intestinal protection.
This study examined the effects of adding taurine and ECPC to the diet on the analysis of gut flora’s Alpha diversity. The findings revealed that this dietary intervention effectively regulated the abundance and diversity of intestinal microflora, thereby leading to alterations in the structure of the intestinal flora. The predominant microbial community inhabiting the intestines of golden pompano is composed of Proteobacteria, a finding that aligns with previous research conducted on this species [18]. The findings of this experiment indicate that the phylum Proteobacteria displayed the highest prevalence within the CSM-TC group. This finding implies that the incorporation of taurine into the diet has the potential to modulate the richness and composition of the gut microbiota. These results align with the research conducted by Ma Qiwei et al. [68]. The alterations in the makeup of gut microbiota have the potential to play a role in the development of gastrointestinal illnesses. Further research is needed to confirm their impact on the intestinal tract of fish.

5. Conclusions

In summary, our research showed that adding 1% ECPC and 0.25% taurine to the diet reduced the hepatic oxidative damage caused by fermented cottonseed meal. Furthermore, the present study revealed that the supplementation of 1% ECPC and 0.25% taurine increased resistance to inflammation in the intestines and improved the quality of the muscles. We suggest an appropriate supplementation of 1% ECPC and 0.25% taurine in low fishmeal diets based on the present experimental conditions.

Author Contributions

Conceptualization, C.Z.; methodology, Z.W., C.Z. and Z.C.; Validation, C.Z. and Z.C.; investigation, Z.W., S.L., Z.H., J.W., Y.W., W.Y., H.L. and Z.M.; Formal analysis, Z.W. and C.Z.; data curation, Z.W.; writing—original draft preparation, Z.W.; writing—review and editing, C.Z.; supervision and project administration, C.Z. and Z.C.; funding acquisition, C.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by Hainan Provincial Natural Science Foundation of China (324MS133; 321QN0942) and the Central Public-interest Scientific Institution Basal Research Fund, CAFS (2023TD58), the National Natural Science Foundation of China (32172984), Guangdong Basic and Applied Basic Research Foundation (2024A1515010084), Southern Marine Science and Engineering Guangdong Laboratory (Zhuhai) (No. SML2023SP236).

Data Availability Statement

Data for this research article were available from the corresponding authors by reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. The State of World Fisheries and Aquaculture; FAO: Rome, Italy, 2022.
  2. Johnson, R.B.; Kim, S.-K.; Watson, A.M.; Barrows, F.T.; Kroeger, E.L.; Nicklason, P.M.; Giles, W.G.; Place, A.R. Effects of dietary taurine supplementation on growth, feed efficiency, and nutrient composition of juvenile sablefish (Anoplopoma fimbria) fed plant based Feeds. Aquaculture 2015, 445, 79–85. [Google Scholar] [CrossRef]
  3. Sun, H.; Tang, J.; Yao, X.; Wu, Y.; Wang, X.; Liu, Y. Effects of replacement of fish meal with fermented cottonseed meal on growth performance, body composition and haemolymph indexes of Pacific white shrimp, Litopenaeus vannamei Boone, 1931. Aquac. Res. 2016, 47, 2623–2632. [Google Scholar] [CrossRef]
  4. Li, M.H.; Robinson, E.H. Use of Cottonseed Meal in Aquatic Animal Diets: A Review. N. Am. J. Aquac. 2006, 68, 14–22. [Google Scholar] [CrossRef]
  5. Estruch, G.; Martínez-Llorens, S.; Tomás-Vidal, A.; Monge-Ortiz, R.; Jover-Cerdá, M.; Brown, P.B.; Peñaranda, D.S. Impact of high dietary plant protein with or without marine ingredients in gut mucosa proteome of gilthead seabream (Sparus aurata L.). J. Proteom. 2020, 216, 103672. [Google Scholar] [CrossRef]
  6. Gomes, E.F.; Rema, P.; Gouveia, A.; Teles, A.O. Replacement of fish meal by plant proteins in diets for rainbow trout (Oncorhynchus mykiss): Effect of the quality of the fishmeal based control diets on digestibility and nutrient Balances. Water Sci. Technol. 1995, 31, 205–211. [Google Scholar] [CrossRef]
  7. Wang, K.Z.; Feng, L.; Jiang, W.D.; Wu, P.; Liu, Y.; Jiang, J.; Kuang, S.Y.; Tang, L.; Zhang, Y.A.; Zhou, X.Q. Dietary gossypol reduced intestinal immunity and aggravated inflammation in On-growing grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2019, 86, 814–831. [Google Scholar] [CrossRef]
  8. Wang, Z.; Tao, J.; Xie, R.; Zhang, Y.; Zhang, H.; Chen, N.; Li, S. Effects of Fish Meal Replacement with Composite Mixture of Soybean Protein Hydrolysates and Other Plant Proteins on Growth Performance, Antioxidant Capacity, and Target of Rapamycin Pathway in Largemouth Bass. N. Am. J. Aquac. 2023, 85, 178–187. [Google Scholar] [CrossRef]
  9. Zhou, C.; Huang, Z.; Lin, H.; Ma, Z.; Wang, J.; Wang, Y.; Yu, W. Rhizoma curcumae Longae ameliorates high dietary Carbohydrate-induced hepatic oxidative stress, inflammation in golden pompano Trachinotus ovatus. Fish Shellfish Immunol. 2022, 130, 31–42. [Google Scholar] [CrossRef]
  10. Zhang, Y.; Zhang, J.; Ren, Y.; Zhang, M.; Liang, J. Lipotoxic Effects of Gossypol Acetate Supplementation on Hepatopancreas Fat Accumulation and Fatty Acid Profile in Cyprinus Carpio. Aquac. Nutr. 2022, 2022, 2969246. [Google Scholar] [CrossRef]
  11. Xu, X.; Yang, H.; Zhang, C.; Bian, Y.; Yao, W.; Xu, Z.; Wang, Y.Y.; Li, X.Q.; Leng, X.J. Effects of replacing fishmeal with cottonseed protein concentrate on growth performance, flesh quality and gossypol deposition of largemouth bass (Micropterus salmoides). Aquaculture 2022, 548, 737551. [Google Scholar] [CrossRef]
  12. Hemansi; Chakraborty, S.; Yadav, G.; Kuhad, R.C. Comparative Study of Cellulase Production Using Submerged and Solid-State Fermentation. In New and Future Developments in Microbial Biotechnology and Bioengineering; Elsevier: Amsterdam, The Netherlands, 2019; pp. 99–113. [Google Scholar]
  13. Li, J.; Gao, T.; Hao, Z.; Guo, X.; Zhu, B. Anaerobic solid-state fermentation with Bacillus subtilis for digesting free gossypol and improving nutritional quality in cottonseed meal. Front. Nutr. 2022, 9, 1017637. [Google Scholar] [CrossRef] [PubMed]
  14. Zhang, X. Study on Solid Fermentation Techniques of Cottonseed Protein and Effects of Application of Its Product in Carassius auratus. Master’s Thesis, Nanjing Aquaculture University, Nanjing, China, 2014. [Google Scholar]
  15. Matias, A.C.; Dias, J.; Barata, M.; Araujo, R.L.; Bragança, J.; Pousão-Ferreira, P. Taurine modulates protein turnover in several tissues of meagre Juveniles. Aquaculture 2020, 528, 735478. [Google Scholar] [CrossRef]
  16. El-Sayed, A.M. Is dietary taurine supplementation beneficial for farmed fish and shrimp? A comprehensive Review. Rev. Aquac. 2014, 6, 241–255. [Google Scholar] [CrossRef]
  17. Hongmanee, P.; Wongmaneeprateep, S.; Boonyoung, S.; Yuangsoi, B. The optimal dietary taurine supplementation in zero fish meal diet of juvenile snakehead fish (Channa Striata). Aquaculture 2022, 553, 738052. [Google Scholar] [CrossRef]
  18. Ma, Q.W.; Guo, H.Y.; Zhu, K.C.; Guo, L.; Liu, B.S.; Zhang, N.; Liu, B.; Yang, J.W.; Jiang, S.G.; Zhang, D.C. Dietary taurine intake affects growth and taurine synthesis regulation in golden pompano, Trachinotus ovatus (Linnaeus 1758). Aquaculture 2021, 530, 735918. [Google Scholar] [CrossRef]
  19. Shen, G.P.; Ding, Z.N.; Dai, T.; Feng, J.H.; Dong, J.Y.; Xia, F.; Xu, J.J.; Ye, J.D. Effect of dietary taurine supplementation on metabolome variation in plasma of Nile Tilapia. Animal 2021, 15, 100167. [Google Scholar] [CrossRef]
  20. Ben-Azu, B.; Adebayo, O.G.; Jarikre, T.A.; Oyovwi, M.O.; Edje, K.E.; Omogbiya, I.A.; Emuesiri, A.T.; Moke, G.E.; Chijioke, B.S.; Odili, O.S.; et al. Taurine, an essential β-amino acid insulates against ketamine-induced experimental psychosis by enhancement of cholinergic neurotransmission, inhibition of oxidative/nitrergic imbalances, and suppression of COX-2/iNOS immunoreactions in Mice. Metab. Brain Dis. 2022, 37, 2807–2826. [Google Scholar] [CrossRef]
  21. Song, W.; Kong, X.; Hua, Y.; Chen, Y.; Zhang, C.; Chen, Y. Identification of antibacterial peptides generated from enzymatic hydrolysis of cottonseed Proteins. LWT 2020, 125, 109199. [Google Scholar] [CrossRef]
  22. Qiu, Z.; Zhao, J.; Xie, D.; de Cruz, C.R.; Zhao, J.; Xu, H.; Xu, Q. Effects of Replacing Fish Meal with Enzymatic Cottonseed Protein on the Growth Performance, Immunity, Antioxidation, and Intestinal Health of Chinese Soft-Shelled Turtle (Pelodiscus sinensis). Aquac. Nutr. 2023, 2023, 6628805. [Google Scholar] [CrossRef]
  23. Zhang, Q.; Liang, H.; Xu, P.; Xu, G.; Zhang, L.; Wang, Y.; Ren, M.C.; Chen, X. Effects of Enzymatic Cottonseed Protein Concentrate as a Feed Protein Source on the Growth, Plasma Parameters, Liver Antioxidant Capacity and Immune Status of Largemouth Bass (Micropterus salmoides). Metabolites 2022, 12, 1233. [Google Scholar] [CrossRef]
  24. Tutman, P.; Glavić, N.; Kožul, V.; Skaramuca, B.; Glamuzina, B. Preliminary Information on Feeding and Growth of Pompano, Trachinotus ovatus (Linnaeus, 1758) (Pisces; Carangidae) in Captivity. Aquac. Int. 2004, 12, 387–393. [Google Scholar] [CrossRef]
  25. Wang, Z.; Liao, S.; Wang, J.; Wang, Y.; Huang, Z.; Yu, W.; Huang, X.L.; Lin, H.Z.; Luo, M.L.; Cheng, Z.Y.; et al. Effects of Fermented Cottonseed Meal Substitution for Fish Meal on Intestinal Enzymatic Activity, Inflammatory and Physical-Barrier-Related Gene Expression, and Intestinal Microflora of Juvenile Golden Pompano (Trachinotus ovatus). Fishes 2023, 8, 466. [Google Scholar] [CrossRef]
  26. Huang, J.; Zhou, C.; Xu, F.; Luo, X.B.; Huang, X.L.; Huang, Z.; Yu, W.; Xun, P.W.; Wu, Y.; Lin, H.Z. Effects of partial replacement of fish meal with porcine meat meal on growth performance, antioxidant status, intestinal morphology, gut microflora and immune response of juvenile golden pompano (Trachinotus ovatus). Aquaculture 2022, 561, 738646. [Google Scholar] [CrossRef]
  27. Association of Official Analytical Chemists (AOAC). Official Methods of Analysis of AOAC International, 18th ed.; AOAC International: Gaithersburg, MD, USA, 2005. [Google Scholar]
  28. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
  29. Liang, Y. Characterization of Growth-Related Genes from Trachinotus ovatus and Their Expression Responses to the Feed Types. Master’s Thesis, Shanghai Ocean University, Shanghai, China, 2018. [Google Scholar]
  30. Zhong, W.; Yu, J.; Li, Y.; Li, Y.X.; Yang, Z.X.; Song, F.; Fu, S.L.; Chen, Y.H.; Wang, L. Effects of Dietary Fat Levels on Muscle Quality, Antioxidant Capacity and Expression of Related Genes of Golden Pompano (Trachinotus ovatus). J. Feed Ind. 2023, 44, 98–106. [Google Scholar]
  31. Xie, J.; Chen, X.; Niu, J. Cloning, functional characterization and expression analysis of nuclear factor erythroid-2-related factor-2 of golden pompano (Trachinotus ovatus) and its response to air-Exposure. Aquac. Rep. 2021, 19, 100580. [Google Scholar] [CrossRef]
  32. Liu, M.J.; Guo, H.Y.; Liu, B.; Zhu, K.C.; Guo, L.; Liu, B.S.; Zhang, N.; Yang, J.W.; Jiang, S.G.; Zhang, D.C. Gill oxidative damage caused by acute ammonia stress was reduced through the HIF-1α/NF-κb signaling pathway in golden pompano (Trachinotus ovatus). Ecotoxicol. Environ. Saf. 2021, 222, 112504. [Google Scholar] [CrossRef] [PubMed]
  33. Liu, X.J.; Luo, Z.; Xiong, B.X.; Liu, X.; Zhao, Y.H.; Hu, G.F.; Lv, G.J. Effect of waterborne copper exposure on growth, hepatic enzymatic activities and histology in Synechogobius Hasta. Ecotoxicol. Environ. Saf. 2010, 73, 1286–1291. [Google Scholar] [CrossRef]
  34. Rotman, F.; Stuart, K.; Drawbridge, M. Effects of taurine supplementation in live feeds on larval rearing performance of California yellowtail Seriola lalandi and white seabass Atractoscion Nobilis. Aquac. Res. 2017, 48, 1232–1239. [Google Scholar] [CrossRef]
  35. Velasquez, A.; Pohlenz, C.; Barrows, F.T.; Gaylord, T.G.; Gatlin III, D.M. Assessment of taurine bioavailability in pelleted and extruded diets with red drum Sciaenops Ocellatus. Aquaculture 2015, 449, 2–7. [Google Scholar] [CrossRef]
  36. Peterson, B.C.; Li, M.H. Effect of supplemental taurine on juvenile channel catfish Ictalurus punctatus growth Performance. Aquac. Nutr. 2018, 24, 310–314. [Google Scholar] [CrossRef]
  37. Matsunari, H.; Takeuchi, T.; Takahashi, M.; Mushiake, K. Effect of dietary taurine supplementation on growth performance of yellowtail juveniles Seriola quinqueradiata. Fish. Sci. 2005, 71, 1131–1135. [Google Scholar] [CrossRef]
  38. Gibson Gaylord, T.; Barrows, F.T.; Teague, A.M.; Johansen, K.A.; Overturf, K.E.; Shepherd, B. Supplementation of taurine and methionine to All-plant protein diets for rainbow trout (Oncorhynchus mykiss). Aquaculture 2007, 269, 514–524. [Google Scholar] [CrossRef]
  39. Zhao, H.F.; Feng, L.; Jiang, W.D.; Liu, Y.; Jiang, J.; Wu, P.; Zhao, J.; Kuang, S.Y.; Tang, L.; Tang, W.N.; et al. Flesh Shear Force, Cooking Loss, Muscle Antioxidant Status and Relative Expression of Signaling Molecules (Nrf2, Keap1, TOR, and CK2) and Their Target Genes in Young Grass Carp (Ctenopharyngodon idella) Muscle Fed with Graded Levels of Choline. PLoS ONE 2015, 10, e0142915. [Google Scholar] [CrossRef]
  40. Yan, L. Effects of Dietary Taurine Supplementation on the Growth Performanceand Health Status of Intestinal, Gill and Body, and Flesh Quality of Younggrass Carp (Ctenopharyngodon idella) and the Related Mechanisms. Master’s thesis, Sichuan Agricultural University, Ya’an, China, 2017. [Google Scholar]
  41. Triantaphyllopoulos, K.A.; Cartas, D.; Miliou, H. Factors influencing GH and IGF-I gene expression on growth in teleost fish: How can aquaculture industry Benefit? Rev. Aquac. 2020, 12, 1637–1662. [Google Scholar] [CrossRef]
  42. Zanou, N.; Gailly, P. Skeletal muscle hypertrophy and regeneration: Interplay between the myogenic regulatory factors (MRFs) and insulin-like growth factors (IGFs) Pathways. Cell. Mol. Life Sci. 2013, 70, 4117–4130. [Google Scholar] [CrossRef]
  43. Roberts, S.B.; Goetz, F.W. Myostatin protein and RNA transcript levels in adult and developing brook Trout. Mol. Cell. Endocrinol. 2003, 210, 9–20. [Google Scholar] [CrossRef]
  44. Ahmed, Z.; Donkor, O.; Street, W.A.; Vasiljevic, T. Calpains- and cathepsins-induced myofibrillar changes in post-mortem fish: Impact on structural softening and release of bioactive Peptides. Trends Food Sci. Technol. 2015, 45, 130–146. [Google Scholar] [CrossRef]
  45. Zhou, C. Effects of dietary leucine levels on intestinal antioxidant status and immune response for juvenile golden pompano (Trachinotus ovatus) involved in Nrf2 and NF-κB signaling Pathway. Fish Shellfish Immunol. 2020, 107, 336–345. [Google Scholar] [CrossRef]
  46. Habte-Tsion, H.M.; Ren, M.; Liu, B.; Ge, X.; Xie, J.; Chen, R.; Zhou, Q.L.; Pan, L. Threonine influences the absorption capacity and Brush-border enzyme gene expression in the intestine of juvenile blunt snout bream (Megalobrama amblycephala). Aquaculture 2015, 448, 436–444. [Google Scholar] [CrossRef]
  47. Yu, W.; Yang, Y.; Lin, H.; Huang, X.L.; Huang, Z.; Li, T.; Zhou, C.; Ma, Z.; Xun, P.W.; Yang, Q.P. Effects of taurine on growth performance, digestive enzymes, antioxidant capacity and immune indices of Lateolabrax maculatus. South China Fish. Sci. 2021, 17, 78–86. [Google Scholar]
  48. Zhang, M.; Li, M.; Wang, R.; Qian, Y. Effects of acute ammonia toxicity on oxidative stress, immune response and apoptosis of juvenile yellow catfish Pelteobagrus fulvidraco and the mitigation of exogenous Taurine. Fish Shellfish. Immunol. 2018, 79, 313–320. [Google Scholar] [CrossRef]
  49. Ayala, A.; Muñoz, M.F.; Argüelles, S. Lipid Peroxidation: Production, Metabolism, and Signaling Mechanisms of Malondialdehyde and 4-Hydroxy-2-Nonenal. Oxidative Med. Cell. Longev. 2014, 2014, 360438. [Google Scholar] [CrossRef] [PubMed]
  50. Zhou, J.; Wang, X.; Liu, X.; Chen, M.K.; Han, Y.Z.; Jiang, C. Effects of taurine level in feeds on immunity and digestive enzymes in redfin puffer immunity and digestive enzymes. J. Dalian Ocean. Univ. 2019, 34, 101–108. [Google Scholar]
  51. Liu, Y.; Yang, P.; Hu, H.; Li, Y.; Dai, J.; Zhang, Y.; Ai, Q.; Xu, W.; Zhang, W.; Mai, K. The tolerance and safety assessment of taurine as additive in a marine carnivorous fish, Scophthalmus maximus L. Aquac. Nutr. 2018, 24, 461–471. [Google Scholar] [CrossRef]
  52. Rahal, A.; Kumar, A.; Singh, V.; Yadav, B.; Tiwari, R.; Chakraborty, S.; Dhama, K. Oxidative Stress, Prooxidants, and Antioxidants: The Interplay. BioMed Res. Int. 2014, 2014, 761264. [Google Scholar] [CrossRef] [PubMed]
  53. Shi, M.; Yao, X.; Qu, K.; Liu, Y.; Tan, B.; Xie, S. Effects of taurine supplementation in low fishmeal diet on growth, immunity and intestinal health of Litopenaeus Vannamei. Aquac. Rep. 2023, 32, 101713. [Google Scholar] [CrossRef]
  54. Sun, T.; Gao, J.; Han, D.; Shi, H.; Liu, X. Fabrication and characterization of solid lipid Nano-formulation of astraxanthin against DMBA-induced breast cancer via Nrf-2-Keap1 and NF-kB and mTOR/Maf-1/PTEN Pathway. Drug Deliv. 2019, 26, 975–988. [Google Scholar] [CrossRef]
  55. Sun Jang, J.; Piao, S.; Cha, Y.-N.; Kim, C. Taurine Chloramine Activates Nrf2, Increases HO-1 Expression and Protects Cells from Death Caused by Hydrogen Peroxide. J. Clin. Biochem. Nutr. 2009, 45, 37–43. [Google Scholar] [CrossRef]
  56. Zhu, R.; Wu, X.Q.; Zhao, X.Y.; Qu, Z.H.; Quan, Y.N.; Lu, M.H.; Liu, Z.Y.; Wu, L.F. Taurine can improve intestinal function and integrity in juvenile Rhynchocypris lagowskii Dybowski fed High-dose Glycinin. Fish Shellfish Immunol. 2022, 129, 127–136. [Google Scholar] [CrossRef]
  57. He, M.; Liu, L.P.; Qu, H.C.; Zhang, X.X.; Gao, J.Z. Effects of taurine on the growth and digestive enzyme activity of the flower eel Anguilla anguilla (Anguilla anguilla). J. Shanghai Ocean. Univ. 2017, 26, 227–234. [Google Scholar]
  58. Feidantsis, K.; Kaitetzidou, E.; Mavrogiannis, N.; Michaelidis, B.; Kotzamanis, Y.; Antonopoulou, E. Effect of Taurine-enriched diets on the Hsp expression, MAPK activation and the antioxidant defence of the European sea bass (Dicentrarchus Labrax). Aquac. Nutr. 2014, 20, 431–442. [Google Scholar] [CrossRef]
  59. Rymuszka, A.; Adaszek, Ł. Pro- and anti-inflammatory cytokine expression in carp blood and head kidney leukocytes exposed to cyanotoxin stress—An in vitro Study. Fish Shellfish Immunol. 2012, 33, 382–388. [Google Scholar] [CrossRef] [PubMed]
  60. Wei, L.B.; Peng, Z.X.; Yan, L.; Gao, X.; Zhai, Z.J.; Wang, W.; Ren, T.J.; Han, Y.Z. Effects of Taurine Supplementation in Low Fishmeal Diet on Intestinal Structure, Immunity and Antioxidant Capacity of Sebastes schlegeli. Siliao Gongye 2022, 43, 35–40. [Google Scholar]
  61. Tak, P.P.; Firestein, G.S. NF-κB: A key role in inflammatory Diseases. J. Clin. Investig. 2001, 107, 7–11. [Google Scholar] [CrossRef]
  62. Pan, J.H.; Feng, L.; Jiang, W.D.; Wu, P.; Kuang, S.Y.; Tang, L.; Zhang, Y.A.; Zhou, X.Q.; Liu, Y. Vitamin E deficiency depressed fish growth, disease resistance, and the immunity and structural integrity of immune organs in grass carp (Ctenopharyngodon idella): Referring to NF-κB, TOR and Nrf2 Signaling. Fish Shellfish Immunol. 2017, 60, 219–236. [Google Scholar] [CrossRef]
  63. Kotzamanis, Y.; Kumar, V.; Tsironi, T.; Grigorakis, K.; Ilia, V.; Vatsos, I.; . Vatsos, I.; Brezas, A.; Eys, J.V.; Gisbert, E. Taurine supplementation in High-soy diets affects fillet quality of European sea bass (Dicentrarchus Labrax). Aquaculture 2020, 520, 734655. [Google Scholar] [CrossRef]
  64. Gumbiner, B.M. Breaking through the tight junction Barrier. J. Cell Biol. 1993, 123, 1631–1633. [Google Scholar] [CrossRef]
  65. Fanning, A.S.; Jameson, B.J.; Jesaitis, L.A.; Anderson, J.M. The Tight Junction Protein ZO-1 Establishes a Link between the Transmembrane Protein Occludin and the Actin Cytoskeleton. J. Biol. Chem. 1998, 273, 29745–29753. [Google Scholar] [CrossRef]
  66. Patel, R.M.; Myers, L.S.; Kurundkar, A.R.; Maheshwari, A.; Nusrat, A.; Lin, P.W. Probiotic Bacteria Induce Maturation of Intestinal Claudin 3 Expression and Barrier Function. Am. J. Pathol. 2012, 180, 626–635. [Google Scholar] [CrossRef]
  67. Tamura, A.; Kitano, Y.; Hata, M.; Katsuno, T.; Moriwaki, K.; Sasaki, H.; Hayashi, H.; Suzuki, Y.; Noda, T.; Furuse, M.; et al. Megaintestine in Claudin-15–Deficient Mice. Gastroenterology 2008, 134, 523–534.e3. [Google Scholar] [CrossRef] [PubMed]
  68. Ma, Q. Dietary Taurine Intake Affects Growth and Taurine Synthesis Regulation in Trachinotus ovatus. Master’s Thesis, Shanghai Ocean University, Shanghai, China, 2021. [Google Scholar]
Fishes 09 00405 g001
Figure 1. Relative mRNA expressions of golden pompano fed with the experimental diets in muscle. The data include triplicate means. Means in the same row that have distinct superscript letters are substantially different, as determined by Duncan’s test (p < 0.05).
Figure 1. Relative mRNA expressions of golden pompano fed with the experimental diets in muscle. The data include triplicate means. Means in the same row that have distinct superscript letters are substantially different, as determined by Duncan’s test (p < 0.05).
Fishes 09 00405 g001
Fishes 09 00405 g002
Figure 2. Relative mRNA expressions of antioxidant-related genes of golden pompano fed with the experimental diets in hepatic. The data include triplicate means. Means in the same row that have distinct superscript letters are substantially different, as determined by Duncan’s test (p < 0.05).
Figure 2. Relative mRNA expressions of antioxidant-related genes of golden pompano fed with the experimental diets in hepatic. The data include triplicate means. Means in the same row that have distinct superscript letters are substantially different, as determined by Duncan’s test (p < 0.05).
Fishes 09 00405 g002
Fishes 09 00405 g003
Figure 3. Relative mRNA expressions of immune-related and physical barrier-related genes of golden pompano fed with the experimental diets in intestinal. The data include triplicate means. Means in the same row that have distinct superscript letters are substantially different, as determined by Duncan’s test (p < 0.05).
Figure 3. Relative mRNA expressions of immune-related and physical barrier-related genes of golden pompano fed with the experimental diets in intestinal. The data include triplicate means. Means in the same row that have distinct superscript letters are substantially different, as determined by Duncan’s test (p < 0.05).
Fishes 09 00405 g003
Fishes 09 00405 g004
Figure 4. Venus map of OTUs of the intestinal flora of golden pompano fed with the experimental diets. The data include triplicate means. Means in the same row that have distinct superscript letters are substantially different, as determined by Duncan’s test (p < 0.05).
Figure 4. Venus map of OTUs of the intestinal flora of golden pompano fed with the experimental diets. The data include triplicate means. Means in the same row that have distinct superscript letters are substantially different, as determined by Duncan’s test (p < 0.05).
Fishes 09 00405 g004
Fishes 09 00405 g005
Figure 5. Heatmap of phylum of the intestinal flora of golden pompano fed with the experimental diets.
Figure 5. Heatmap of phylum of the intestinal flora of golden pompano fed with the experimental diets.
Fishes 09 00405 g005
Fishes 09 00405 g006
Figure 6. Heatmap of the genera of the intestinal flora of golden pompano fed with the experimental diets.
Figure 6. Heatmap of the genera of the intestinal flora of golden pompano fed with the experimental diets.
Fishes 09 00405 g006
Table 1. Ingredient composition and nutrient levels of the experimental diets (% dry matter).
Table 1. Ingredient composition and nutrient levels of the experimental diets (% dry matter).
ItemDiets
CSM-TCSM-CCSM-TC
Ingredients
Fishmeal202020
Soy protein concentrate161616
Soybean meal444
Fermented cottonseed meal20.5018.5419.52
Corn starch11.7011.7011.70
Porcine blood cell protein powder222
Beer yeast powder222
Fish oil8.98.98.9
Vitamin and mineral premix 1 111
Ca(H2PO4)20.50.50.5
Choline chloride0.50.50.5
Lecithin111
Microcrystalline cellulose10.2010.6610.43
Betaine0.50.50.5
Lysine0.50.50.5
Methionine0.20.20.2
Enzymatic cottonseed protein concentrate021
Taurine0.500.25
Total100100100
Nutrient levels
Crude protein43.7643.3943.66
Crude fiber10.2910.4210.49
Crude lipid11.911.8111.9
Ash10.2110.4310.42
Energy (kJ/g)16.8 16.7 16.8
Nitrogen free extract23.8423.9523.52
1 Vitamin premix and mineral premix (mg or g/kg diet): thiamin, 25 mg; riboflavin, 45 mg; pyridoxine HCl, 20 mg; vitamin B12, 0.1 mg; vitamin K3, 10 mg; inositol, 800 mg; pantothenic acid, 60 mg; niacin acid, 200 mg; folic acid, 20 mg; biotin, 1.20 mg; retinal acetate, 32 mg; cholecalciferol, 5 mg; α-tocopherol, 120 mg; ascorbic acid, 2000 mg; choline chloride, 2500 mg; ethoxyquin, 150 mg; wheat middling, 14.012 g, NaF, 2 mg; KI, 0.8 mg; CoCl2·6H2O (1%), 50 mg; CuSO4·5H2O, 10 mg; FeSO4·H2O, 80 mg; ZnSO4·H2O, 50 mg; MnSO4·H2O, 60 mg; MgSO4·7H2O, 1200 mg; Ca(H2PO4)2·H2O, 3000 mg; NaCl, 100 mg; zeolite, 15.447 g [9].
Table 2. The primers for real-time fluorescence quantification PCR.
Table 2. The primers for real-time fluorescence quantification PCR.
GeneSequenceReference
β-Actin-qFTACGAGCTGCCTGACGGACA[9]
β-Actin-qRGGCTGTGATCTCCTTCTGCA
GH-qFGCCAGTCAGGACGGAG[29]
GH-qRAGGAGGCGGGGCTACA
GHR1-qFGGTGGAGTTCATTGAGGTGGAT[29]
GHR1-qRTGGTGGCTGACAGGTTGG
GHR2-qFCACCACCTCTACCTCCTCTG[29]
GHR2-qRCCCTCTTCGGCGTTCATA
IGF1-qFGACGCTTACAGGAGGAGAA[29]
IGF1-qRGCTGCTGGATGTGTTCAC
IGF2-qFCTGTGACCTCAACCTGCT[29]
IGF2-qRCTCTGCCACTCCTCGTATT
myoG-qFAACCAGAGGCTGCCCAAGG[30]
myoG-qRGCTGTCCCGTCTCAGTGTCC
MSTN-qFGACGGGAACAGGCACATACG[30]
MSTN-qRGCAGCCACACGGTCAACACT
CatL-qFCCACTGGCACCTCTGCAAGA[30]
CatL-qRGCCCGTAGCACTGTTTGCCC
catB-qFTCTGCCTGGGACTTCTGGACCA[30]
catB-qRACACTTGAGGACGCACTGAG
Nrf2-qFTTGCCTGGACACAACTGCTGTTAC[31]
Nrf2-qRTCTGTGACGGTGGCAGTGGAC
Keap1-qFCAGATAGACAGCGTGGTGAAGGC[31]
Keap1-qRGACAGTGAGACAGGTTGAAGAACTCC
HO-1-qFAGAAGATTCAGACAGCAGCAGAACAG[31]
HO-1-qRTCATACAGCGAGCACAGGAGGAG
SOD-qFCCTCATCCCCCTGCTTGGTA[32]
SOD-qRCCAGGGAGGGATGAGAGGTG
GSH-Px-qFGCTGAGAGGCTGGTGCAAGTG[33]
GSH-Px-qRTTCAAGCGTTACAGCAGGAGGTTC
CAT-qFGGATGGACAGCCTTCAAGTTCTCG[32]
CAT-qRTGGACCGTTACAACAGTGCAGATG
ZO-1-qFTTTGTGGCAGGAGTTCT[25]
ZO-1-qRTTCTTGTTGGGGATGAT
Claudin-15-qFAAGGTATGAAATAGGAGAAGGGC[25]
Claudin-15-qRTGGTTTGATAAGGCAGAGGGTA
Occludin-qFTACGCCTACAAGACCCGCA[25]
Occludin-qRCACCGCTCTCTCTGATAAA
Claudin-3-qFCTCCTCTGCTGCTCCTGTCC[25]
Claudin-3-qRCGTAGTCTTTCCTTTCTAACCCTG
NF-κB-qFTGCGACAAAGTCCAGAAAGAT [9]
NF-κB-qRCTGAGGGTGGTAGGTGAAGGG
TNF-α-qFCGCAATCGTAAAGAGTCCCA [9]
TNF-α-qRAAGTCACAGTCGGCGAAATG
IL-10-qFCTCCAGACAGAAGACTCCAGCA [9]
IL-10-qRGGAATCCCTCCACAAAACGAC
IL-8-qFTGCATCACCACGGTGAAAAA [9]
IL-8-qRGCATCAGGGTCCAGACAAATC
il-1β-qFCGGACTCGAACGTGGTCACATTC [9]
il-1β-qRAATATGGAAGGCAACCGTGCTCAG
Table 3. Growth performance and feed utilization of golden pompano fed with the experimental diets.
Table 3. Growth performance and feed utilization of golden pompano fed with the experimental diets.
ItemInitial WeightFinal WeightSR (%)WGR (%)SGR (% Day−1)Per Fish FI (g/Fish)FCR PER (%)VSI (%)HSI (%)CF (g/cm3)
CSM-T141.87 ± 0.43891.6 ± 24.0696 ± 2.3554.83 ± 12.973.36 ± 0.0420.1 ± 0.6 b1.37 ± 0.061.78 ± 0.097 ± 0.531.43 ± 0.063.97 ± 0.31
CSM-C140.87 ± 1.39880.1 ± 13.5598.7 ± 1.3533.3 ± 6.143.3 ± 0.0219.9 ± 0.3 b1.41 ± 0.031.71 ± 0.047.5 ± 0.261.1 ± 0.174.33 ± 0.47
CSM-TC140.17 ± 1.87961 ± 34.897.3 ± 1.3605.47 ± 35.373.48 ± 0.0921.8 ± 0.2 a1.37 ± 0.071.77 ± 0.107.23 ± 0.551.4 ± 0.264.43 ± 0.42
ANOVA0.3740.1200.5790.1370.1310.0250.8790.8330.2510.0780.22
SR: survival rate; WGR: weight gain rate; SGR: specific growth rate; FI: feed intake; FCR: feed conversion ratio; PER, protein efficiency ratio; VSI: viscerosomatic index; HSI: hepatosomatic index; CF: condition factor. The data include triplicate means. Means in the same row that have distinct superscript letters are substantially different, as determined by Duncan’s test (p < 0.05).
Table 4. Plasma parameters of golden pompano fed with the experimental diets.
Table 4. Plasma parameters of golden pompano fed with the experimental diets.
ItemALT (U/L)AKP (U/L)C3 (g/L)C4 (g/L)
CSM-T4.26 ± 0.16 a21.5 ± 0.2 b0.043 ± 0.001 c0.0165 ± 0.0005 c
CSM-C4.9 ± 0.51 a22.6 ± 0.4 b0.057 ± 0.001 b0.0258 ± 0.0014 b
CSM-TC2.8 ± 0.43 b34.2 ± 0.6 a0.088 ± 0.002 a0.0328 ± 0.0011 a
ANOVA<0.0010.013<0.001<0.001
ALT, alanine aminotransferase; AKP, alkaline phosphatase; C3, complement 3; C4, complement 4. The data include triplicate means. Means in the same row that have distinct superscript letters are substantially different, as determined by Duncan’s test (p < 0.05).
Table 5. Hepatic enzyme activities of golden pompano fed with the experimental diets.
Table 5. Hepatic enzyme activities of golden pompano fed with the experimental diets.
ItemT-AOC/(U/mg)SOD (U/mg)CAT/(U/mg)GSH-Px/(U/mg)MDA (nmol/mg)
CSM-T0.31 ± 0.01 b3.73 ± 0.02 b1.9 ± 0.05 a10.78 ± 0.820.39 ± 0.07
CSM-C0.26 ± 0.01 c3.62 ± 0.03 b1.46 ± 0.02 c11.19 ± 0.150.38 ± 0.07
CSM-TC0.34 ± 0 a3.91 ± 0.07 a1.72 ± 0.02 b11.91 ± 0.260.33 ± 0
ANOVA<0.0010.013<0.0010.3410.717
SOD: superoxide dismutase; CAT: catalase; Gpx: glutathione peroxidase; T-AOC: total antioxidant capacity; MDA: malondialdehyde. The data include triplicate means. Means in the same row that have distinct superscript letters are substantially different, as determined by Duncan’s test (p < 0.05).
Table 6. Intestinal enzymes activities measurements of golden pompano fed with the experimental diets.
Table 6. Intestinal enzymes activities measurements of golden pompano fed with the experimental diets.
ItemAMY (U/mg)LPS (U/mg)Chymotrypsin (U/mg)
CSM-T338.37 ± 10.28 b21.14 ± 0.7648.46 ± 3.16
CSM-C295.54 ± 16.68 c21.76 ± 0.3248.46 ± 0.93
CSM-TC474.26 ± 8.07 a25.64 ± 6.0151.41 ± 1.36
ANOVA<0.0010.6380.539
AMY, amylase; LPS, lipase. The data include triplicate means. Means in the same row that have distinct superscript letters are substantially different, as determined by Duncan’s test (p < 0.05).
Table 7. Diversity statistics of intestinal samples of golden pompano fed with the experimental diets.
Table 7. Diversity statistics of intestinal samples of golden pompano fed with the experimental diets.
ItemAceChao1ShannonSimpson
CSM-T1.59 ± 0.09 b0.48 ± 0.04 c167.02 ± 3.77 a171.06 ± 3.17
CSM-C2.05 ± 0.01 a0.7 ± 0 a130.55 ± 8.08 b158.26 ± 15.86
CSM-TC1.81 ± 0.12 ab0.59 ± 0.01 b161.51 ± 15.03 ab169.71 ± 15.1
ANOVA0.0280.0020.0860.749
Data are means of quadruplicate. Means in the same row that have distinct superscript letters are substantially different, as determined by Duncan’s test (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, Z.; Liao, S.; Huang, Z.; Wang, J.; Wang, Y.; Yu, W.; Lin, H.; Ma, Z.; Cheng, Z.; Zhou, C. Effects of Taurine and Enzymatic Cottonseed Protein Concentrate Supplementation in Low-Fishmeal Diet on Growth, Liver Antioxidant Capacity, and Intestinal Health of Golden Pompano (Trachinotus ovatus). Fishes 2024, 9, 405. https://doi.org/10.3390/fishes9100405

AMA Style

Wang Z, Liao S, Huang Z, Wang J, Wang Y, Yu W, Lin H, Ma Z, Cheng Z, Zhou C. Effects of Taurine and Enzymatic Cottonseed Protein Concentrate Supplementation in Low-Fishmeal Diet on Growth, Liver Antioxidant Capacity, and Intestinal Health of Golden Pompano (Trachinotus ovatus). Fishes. 2024; 9(10):405. https://doi.org/10.3390/fishes9100405

Chicago/Turabian Style

Wang, Zhanzhan, Shuling Liao, Zhong Huang, Jun Wang, Yun Wang, Wei Yu, Heizhao Lin, Zhenhua Ma, Zhenyan Cheng, and Chuanpeng Zhou. 2024. "Effects of Taurine and Enzymatic Cottonseed Protein Concentrate Supplementation in Low-Fishmeal Diet on Growth, Liver Antioxidant Capacity, and Intestinal Health of Golden Pompano (Trachinotus ovatus)" Fishes 9, no. 10: 405. https://doi.org/10.3390/fishes9100405

APA Style

Wang, Z., Liao, S., Huang, Z., Wang, J., Wang, Y., Yu, W., Lin, H., Ma, Z., Cheng, Z., & Zhou, C. (2024). Effects of Taurine and Enzymatic Cottonseed Protein Concentrate Supplementation in Low-Fishmeal Diet on Growth, Liver Antioxidant Capacity, and Intestinal Health of Golden Pompano (Trachinotus ovatus). Fishes, 9(10), 405. https://doi.org/10.3390/fishes9100405

Article Metrics

Back to TopTop