Next Article in Journal
Transcriptome Sequencing Analysis of Sex-Related Genes in the Gonads of Mytilus unguiculatus
Previous Article in Journal
Cleaner Fish Do Not Impact the Pigmentation of Salmon Lice (Lepeophtheirus salmonis) in Commercial Aquaculture Cages
Previous Article in Special Issue
Effect of the Flagellar Gene fliL on the Virulence of Pseudomonas plecoglossicida to Hybrid Grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 8
Issue 9
10.3390/fishes8090454
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Astragalus membranaceus on Transcriptome and Survival of Hybrid Yellow Catfish (Pseudobagrus vachellii ♂ × Tachysurus fulvidraco ♀) in Response to Aeromonas hydrophila Challenge

by
Tingshuang Pan
1,2,
Min Yang
1,2,
He Jiang
1,2,
Tong Li
1,2,
Guoqing Duan
1,2,
Jun Ling
1,2,* and
Qian Gao
3,*
1
Fishery Institute of Anhui Academy of Agricultural Sciences, Hefei 230031, China
2
Key Laboratory of Aquaculture & Stock Enhancement in Anhui Province, Hefei 230031, China
3
Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Ministry of Education, Shanghai Ocean University, Shanghai 201306, China
*
Authors to whom correspondence should be addressed.
Fishes 2023, 8(9), 454; https://doi.org/10.3390/fishes8090454
Submission received: 3 August 2023 / Revised: 3 September 2023 / Accepted: 8 September 2023 / Published: 10 September 2023
(This article belongs to the Special Issue Interactions between Fish and Pathogens in Aquaculture)
Browse Figures
Review Reports Versions Notes

Abstract

:
Intensive culturing of hybrid yellow catfish (Pseudobagrus vachellii ♂ × Tachysurus fulvidraco ♀) has increased their mortality. Astragalus membranaceus has been used as an immune stimulant and antioxidant in fish for several years. A. membranaceus was decocted and mixed with the diet. After feeding for 28 d, the hybrid yellow catfish were challenged with Aeromonas hydrophila. To better understand the function of A. membranaceus in the defense of hybrid yellow catfish against A. hydrophila, we analyzed the spleen transcriptome data and relative percentage survival (RPS). There were 396 differentially expressed genes (DEGs) between the A. membranaceus and control groups at 24 h after A. hydrophila stimulation, including 263 upregulated and 133 downregulated DEGs. A significant enrichment of DEGs was found in the A. membranaceus group when the GO enrichment terms in the spleen were analyzed. The qRTPCRresults for the five upregulated and two downregulated DEGs from the spleen, intestine, and liver were consistent with the transcriptome data. The relative percentage survival of A. membranaceus was 85.71% after the fish were challenged with A. hydrophila.
Keywords:
Astragalus membranaceus; Aeromonas hydrophila; genes and genomes; transcriptome; immune
Key Contribution: Astragalus membranaceus can modulate spleen transcriptomes and lower mortality in hybrid yellow catfish, indicating that A. membranaceus can protect fish against A. hydrophila and play an important role in the immune system.

1. Introduction

Hybrid yellow catfish (Tachysurus vachellii ♂ × Tachysurus fulvidraco ♀) is well-known in China for its nutrition and delicious taste [1]. Fish aresusceptible to pathogens in intensively cultured environments, and disease outbreaks have resulted in significant economic losses in recent years. Conventional and effective measures to reduce the mortality caused by fish diseases include antibiotics, chemotherapeutics, and vaccines. The first two can accumulate in fish and pollute the aquatic environment, and the latter is specific to diseases and is more expensive [2].
Immunostimulants can activate different immune system components and mechanisms in animals, reinforcing the body’s natural resistance to help it successfully cope with various bacterial and viral infections. They can also be used to treat disastrous and chronic diseases and immune suppression [3]. Immunostimulants can boost or stimulate the innate immune system of farmed fish and are considered promising alternative agents to vaccines for disease prevention in aquaculture [4]. Immunostimulants can be classified as bacterial preparations, polysaccharides, and plant extracts [5].
Traditional Chinese herbs can improve non-specific immune mechanisms and have proven to be effective as immunostimulants in aquaculture [2,6,7,8,9,10]. For example, the phagocytic index, phagocytic activity, lysozyme activities, and survival rate of Pacific white shrimp significantly increased when they were fed 2% traditional Chinese herbal extracts for 28 d and challenged with Vibrio harveyi [2]. When red drums (Sciaenops ocellatus) were fed with 2% traditional Chinese herbs, the lysozyme activity, phagocytic index, and phagocytic percentage increased significantly in most groups, and some were effective in preventing Vibrio splendidus infection [9]. When crucian carp were fed different traditional Chinese herbs, the lysozyme activity and phagocytosis increased [11].
Astragalus membranaceus (Astragali Radix), an economically important perennial traditional Chinese herb, is distributed in Asia, North America, and Europe [12]. It has many biological functions, including immune modulation, anti-inflammation, and antioxidation [13]. A. membranaceus contains polysaccharides, amino acids, flavonoids, saponins, scandium, copper, chromium, cobalt, selenium, and other compounds, some of which display bioactivity [14]. A. membranaceus has been reported to be an immunostimulant in fish [15] and an antioxidant in aquaculture [6,14,16]. For instance, after feeding A. membranaceus, the lysozyme activity, phagocytic index, and phagocytic percentage of S. ocellatus significantly increase [9]. Similarly, both the lysozyme and phagocytic activities of Nibeaalbiflora fed A. membranaceus were significantly higher, effectively protecting against Vibrio vulnificusinfection by N. albiflora [17]. Feeding A. membranaceus-supplemented diets for two months can elevate the levels of digestive enzymes and improve the growth performance of juvenile Pangasianodon hypophthalmus [18]. Astragalus polysaccharides (1 g/kg)enhance immunity, intestinal microbiota, and disease resistance in grass carp (Ctenopharyngodonidella) [19].
RNA sequencing (RNA-seq) is an accurate technology for transcriptome analysis that uses high-throughput methods [20]. Fish transcriptome data have been used to analyze immune-related genes [21,22,23], sex determination [24], gene expression patterns [25], heat stress [26], and genetic evolution [27,28]. In this study, hybrid yellow catfish were fed a formula feed containing A. membranaceus. On day 28 after feeding with A. membranaceus the, yellow catfish were challenged with A. hydrophila to determine disease resistance, and the spleen transcriptome was analyzed 24 h after A. hydrophila stimulation.

2. Materials and Methods

2.1. A. membranaceus Extract and Feeds Preparation

A. membranaceus was purchased from Tongrentang Pharmacy and used to prepare the hot water extract as previously reported [9]. A total of 20 g of A. membranaceus was merged in 400 mL water for 1 h, boiled for 30 min, filtered, and then boiled and filtered again. The filtrate (450 mL A. membranaceus filtrate) was heated, condensed to 100 mL, and mixed with 980 g of crushed feed (Tongwei Feed Co., Ltd., Hefei, China). A total of 100 mL of 0.65% sodium chloride was added to control group feed. The formula feed comprised 42% protein, 6.0% carbohydrates, 5.0% lipids, and 16.0% ash. All the feeds were stored at 4 °C in a refrigerator.

2.2. Fish

Hybrid yellow catfish (20.31 ± 0.57 g) were acclimated in 7000 L plastic tanks for 14 d and then transferred to 180 L tanks as the experiment group and control group. Each group contained three tanks (30 fish per tank). Fish were fed with A. membranaceus twice at 4% ratio for 28 d. During this experiment, water temperature of 24–26 °C, pH 7.3–7.4, and dissolved oxygen 4.8–5.9 mg/L were maintained. All experiments were conducted according to the Experimental Animal Welfare and Ethical of Anhui Academy of Agricultural Sciences guidelines for the use of animals for research (Approval Code: AAAS2021-30).

2.3. Relative Percent Survival (RPS)

Hybrid yellow catfish were challenged intraperitoneally by injecting 0.2 mL of the live A. hydrophila containing 2 × 105 cells at the LD50 dosage on day 28. The LD50 for hybrid yellow catfish was determined as previously described [29]. The mortality was recorded for 1 week. To confirm the mortality caused by A. hydrophila, the bacteria were re-isolated from dead fish. RPS was estimated using the following formula.
RPS = 100 % − { M o r t a l i t y   o f   t r e a t e d   g r o u p M o r t a l i t y   o f   c o n t r o l   g r o u p } × 100 %

2.4. RNA Extraction and Library Preparation

Each catfish was sacrificed 24 h after A. hydrophila injection. In each group, three fish from different tanks were used for RNA extraction. Total RNA from the spleen, intestine, and liver of one hybrid yellow catfish was extracted using TRIzol reagent (Sangon, Shanghai, China). Splenic RNA was used for library construction and RNA sequencing. A Nano Drop 2000 spectrophotometer was used to evaluate the RNA purity and quantity. An Agilent 2100 bioanalyzer was used to assess total RNA integrity. Full-length cDNA was constructed using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA) as per the manufacturer’s instructions. In brief, oligo (dT) magnetic beads were used to purify poly(A)-containing mRNA, and the first strand of cDNA was synthesized using the fragmented mRNA as a template with reverse transcriptase and random hexamer primers. Second-strand cDNA was synthesized using RNase H and DNA polymerase I. The remaining overhangs were converted into blunt ends via exonuclease/polymerase activity. After adenylation of the 3′ ends of DNA fragments, the NEBNext Adaptor with hairpin loop structure was ligated for hybridization (NEB, Ipswich, MA, USA). Library fragments were purified using AMPure XP beads to screen 150–200 bp cDNA fragments (Beckman, Brea, CA, USA). Finally, polymerase chain reaction (PCR) enrichment was performed to obtain cDNA.

2.5. RNA Sequencingand Function Annotation

The Illumina HiSeq X Ten platform was used to sequence cDNA libraries of A. membranaceus and control groups, and 150 bp paired-end reads were obtained. Trimmomatic [30] was used to process the raw reads (47 M), and 46 M clean reads were obtained. Clean reads were aligned to the Tachysurus fulvidraco reference genome (NCBI_ASM372403v1).
Gene functional annotations were based on the following databases: NCBI non-redundant protein (Nr) (https://www.ncbi.nlm.nih.gov/ accessed on 6 December 2021); NCBI non-redundant nucleotide sequences (NT) (https://www.ncbi.nlm.nih.gov/, accessed on 6 December 2021); protein family (Pfam) (http://pfam.xfam.org/, accessed on 6 December 2021); Swiss-Prot(http://www.ebi.ac.uk/uniprot, accessed on 6 December 2021); Clusters of Orthologous Groups of proteins/EuKaryotic Ortholog Groups (COG/KOG, accessed on 7 December 2021) (https://www.ncbi.nlm.nih.gov/COG/, accessed on 7 December 2021) [31]; Gene Ontology (GO) (http://www.geneontology.org/, accessed on 8 December 2021) [32]; and Kyoto Encyclopedia of Genes and Genomes(KEGG) (http://www.genome.jp/kegg/, accessed on 8 December 2021) [33]. According to the Nr annotation, the Blast2GO software (http://www.blast2go.org/, accessed on 8 December 2021) was used to specify GO annotations, including the major categories of molecular function, cellular components, and biological processes.

2.6. DEGs Identification

All genes were identified using HTSeq-count [34]. Significant DEGs were selected by using |log2foldchange| ≥ 1 and q value < 0.05 as the threshold. The DESeq (2012) R package [35] was used to analyze DEGs. All DEGs were mapped to the GO and KEGG databases [36].

2.7. RNA Sequencing and Transcriptome Assembling

To confirm the RNA-Seq validation and A. membranaceus function in the immune system, seven DEGs related to immunity, apoptosis, antigen processing, and presentation from RNA sequencing results were selected for qRTPCR analysis. The spleen, intestine, and liver of each fish were used separately to extract RNA for qRTPCR. The RNA of the spleen qRTPCR was the same as that of the transcriptome. A SYBR Premix Ex Taq kit (Invitrogen, Waltham, MA, USA) was used for qRTPCR. β-Actin acted as a housekeeping gene. The 2−ΔΔCt method was used to calculate relative expression [37]. The primer sequences for the seven DEGs and housekeeping genes are in Table 1.

3. Result and Discussion

3.1. Transcriptome and Unigene Annotation

The spleen transcriptomes were sequenced after A. hydrophila stimulation for 24 h when the hybrid yellow catfish were fed A. membranaceus-enriched formula feeds for 4 weeks. The RIN values of all specimens were tested, which ranged from 9.2 to 9.9, and qualified for library construction. In our study, when low-quality sequences were removed from the six libraries, the clean reads number was between 44.93 M and 49.17 M, and the clean bases were between 6.54 G and 7.17 G. The Q30 values of the sequenced libraries were between 91.97% and 92.54%, and the GC content was between 46.17% and 46.58% (Table 2), indicating that the transcriptome data were reliable.
The reads and percentages of the transcriptome for the control group (CS241, CS242, CS243) and A. membranaceus group (AS241, AS242, AS243) mapped to the yellow catfish genome (NCBI_ASM372403v1)were 34416346, 36342453, 37735697, 34991235, 34534151, and 36864149, and 76.60%, 76.63%, 76.74%, 75.91%, 76.61%, 76.33%, respectively (Table 3). The raw reads were deposited in the NCBI under the accession number PRJNA951209.

3.2. DEGs Analysis

DEGs between the A. membranaceus group and the control group were selected by |log2foldchange| ≥ 1 and q value < 0.05.Altogether, 396 DEGs (Table S1) were identified between the control group and A. membranaceus group, containing 263 upregulated and 133 downregulated DEGs. The magnitude change levels in the upregulated DEGs were higher than those in the downregulated DEGs (Figure 1). When the hybrid catfish were fed A. membranaceus, the DEGs related to immunity, apoptosis, and antigen processing and presentation accounted for a large proportion of the total DEGs. In the head kidney of the yellow catfish challenged with lipopolysaccharides, immune- and transcription-related genes, cytoskeleton-related genes, apoptosis, and cell cycle-related genes were identified [38]. When challenged with poly I:C, 307 genes were upregulated, and 215 genes were downregulated in yellow catfish [21]. A previous study found that 5527 DEGs are present in yellow catfish infected with Edwardsiella ictaluri. Of these, 2265 are upregulated, and 3262 are downregulated [39]. When the Japanese flounder (Paralichthys olivaceus) was challenged with E. tarda for different stress durations, 456 and 1037 DEGs were identified in the gills at 8 h and 48 h after injection, respectively [40].
In this study, the most upregulated DEGs were interferon-inducible GTPase 5, SLAM family member 7, C-type lectin domain family 6 member A, C-type lectin domain family 10 member A, and C-type lectin domain family 4 member E (Table S1).
IFN-inducible GTPase (IRG) plays a significant role in host defense [41]. In this study, IRG was significantly upregulated in the A. membranaceus group when challenged with A. hydrophila, and the log2FoldChange was 23.79. IRG has been confirmed to defend host cells against pathogens [42]. Murine Irgm1GTPase could control the infection of mycobacterium tuberculosis by trafficking vacuolar components in IFNγ-activated macrophages [43]. The in vitro antimicrobial assays suggested that IRG can enhance host cell resistance to both intracellular and extracellular pathogens. The gene expression analysis revealed that IRG is expressed in all healthy tissues of Takifugu obscures and is upregulated in fish infected with A. hydrophila or E. tarda [44].
The SLAM family (SLAMF) is a group of type I transmembrane receptors that exist in immune cells, such as natural killercells, monocytes, B lymphocytes, macrophages, and T lymphocytes [45]. SLAMF7 plays a significant role in macrophage-related inflammatory diseases, such as COVID-19 and rheumatoid arthritis [46]. Astragalus membranaceus enhanced the expression of SLAMF7 in hybrid yellow catfish spleens when the fish were challenged with A. hydrophila. In our study, SLAMF7 was significantly upregulated in the A. membranaceus-fed group, and the log2FoldChange was 23.27. SLAMF7 can enhance the Toll-like receptor (TLR)-mediated induction of pro-inflammatory cytokines in monocytes and macrophages. Knocking down SLAMF7 significantly lowers the mRNA expression of pro-inflammatory markers induced by TLR [47].
C-type lectin is a non-specific humoral immune factor that plays an important role in innate immune responses, such as phagocytosis, complement activation, and pattern recognition [48]. In this study, the C-type lectin domain family 6 member A, C-type lectin domain family 10 member A, and C-type lectin domain family 4 member E were significantly upregulated in the A. membranaceus group after challenge with A. hydrophila. When common carp (Cyprinus carpio) were challenged with A. hydrophila, three C-type lectin genes were significantly upregulated in the kidney and spleen [49]. A Mannose-binding lectin homolog is expressed at higher levels in Nile tilapia liver than in the head kidney, hind kidney, spleen, and intestines, and it is upregulated significantly in the head kidney and spleen after challenge with Streptococcus agalactiae and A. hydrophila [50]. In grass carp challenged with A. hydrophila, the expression of the two C-type lectin genes is significantly upregulated in the muscle, spleen, gill, skin, and hepatopancreas [51].

3.3. Functional Annotation

Spleen DEGs in the A. membranaceus group were significantly enriched (p < 0.05) in 173 GO terms. The five most significantly enriched biological process (BP) items included “cell adhesion”, “adaptive immune response”, “clathrin-dependent endocytosis of virus by the host cell”, “antigen processing and presentation of endogenous peptide antigen via MHC class Ib”, and “B cell receptor signaling pathway.” The five most significantly enriched cellular component (CC) items included “extracellular space”, “extracellular region”, “MHC class I protein complex”, “integrin complex”, and “endosome lumen”. The significantly enriched five top molecular function (MF) items were “virion binding”, “peptide antigen binding”, “virus receptor activity”, “signaling receptor binding”, and “glycine n-benzoyl transferase activity” (Figure 2). The results revealed substantial immune changes in A. membranaceus-fed fish when stimulated with A. hydrophila.
The top 20 KEGG pathways were cell adhesion molecules, the B cell receptor signaling pathway, natural killer cell-mediated cytotoxicity, the NF-kappa B signaling pathway, antigen processing and presentation, pyrimidine metabolism, focal adhesion, and inflammatory mediator regulation of TRP channels (Figure 3).

3.4. qRTPCR Analysis

Five upregulated DEGs (Aatk, DAPK2, Cd63, inppl1b, Sh2d1a) and two downregulated DEGs (IL6ST and Bax) were selected for qRTPCR analysis. The results indicated that the qRTPCR expression in the spleen (Figure 4B), intestine (Figure 4C), and liver (Figure 4D) was identical to that of the RNA-Seq (Figure 4A). This study indicated that Aatk and DAPK2 were upregulated more than once, whereas IL6ST and Bax were downregulated only once in the spleen. Aatk, DAPK2, Cd63, and inppl1b were upregulated at least once, and IL6ST and Bax were downregulated once in the intestine. Aatk, DAPK2, inppl1b, and Sh2d1a were upregulated at least once, and IL6ST was downregulated twice as much in the liver as in the control. All seven DEGs were associated with apoptosis and immune function.
Apoptosis plays an important role in the immune responses of fish. Apoptosis-associated tyrosine kinase (Aatk) was first reported in myeloid precursor cells undergoing apoptosis [52] and was shown to suppress cancer cell growth [53]. In our study, when fish in the A. membranaceus group were challenged with A. hydrophila, Aatk expression was upregulated twice, once, and four times in the spleen, intestine, and liver, respectively, suggesting that A. membranaceus could upregulate hybrid yellow catfish Aatk expression to resist A. hydrophila immune infection. Death-associated protein kinase (DAPK) is important for cellular processes, including apoptosis and immune response regulation [54]. DAPK is related to apoptosis and can be expressed in the liver, skin, trunk kidney, muscle, and head kidney of Japanese flounder, and its expression can be upregulated when challenged with E. tarda [55]. In this study, when the fish were challenged with A. hydrophila, DAPK2 expression in the A. membranaceus group was upregulated twice, six times, and ten times in the spleen, intestine, and liver, respectively, suggesting that DAPK2 is a positive immune response and apoptosis regulator. The SH2 domain containing 1A (Sh2d1a) has a pro-apoptotic function [56] and can be upregulated in the Pelodiscus sinensis intestine when stimulated by LPS [57]. When the hybrid yellow fish were fed A. membranaceus and challenged with A. hydrophila, the Sh2d1a expression level was twice that of the control group; however, there was no difference between the spleen and intestine. Bax belongs to the Bcl-2 family and has pro-apoptotic and tumor-suppressive functions [58]. In our study, the expression of Bax in the A. membranaceus group was downregulated in the intestine and spleen and was the same as that in the control group in the liver. Thus, A. membranaceus can regulate Bax expression to suppress apoptosis.
CD63, INPPL1, and IL6ST are immune-related DEGs, and A. membranaceus modulates the expression levels of these genes once a hybrid yellow catfish is stimulated by pathogens. CD63 belongs to the tetraspanin superfamily and acts as a lysosomal integral membrane protein [59]. CD63 mRNA is expressed in hemocytes, gills, the mantle, the digestive tract, muscle, and the hepatopancreas and is significantly upregulated in gills when abalones are challenged by bacteria or viruses [60]. When the hybrid yellow catfish were challenged with A. hydrophila, CD63 was upregulated in the liver of the A. membranaceus group, but no difference was observed between the spleen and intestine. INPPL1 modulates cell function through changes in specific phosphoinositides, and loss of INPPL1 can lead to increased levels of FGF-mediated signaling [61]. NPPL1 was upregulated four times in the intestine and once in the spleen and liver of the A. membranaceus group when challenged with A. hydrophila. Interleukin 6 signal transducer (IL6ST) is associated with immune signaling. Lower IL6ST expression can lead to a disrupted leukemia inhibitory factor signaling cascade, which inhibits the JAK-STAT signaling pathway [62]. In this study, when the fish were fed A. membranaceus, IL6ST was expressed thrice, twice, and once in the intestine, liver, and spleen, respectively.

3.5. Correlation between qRTPCR and RNA-Seq

In this study, a correlation analysis between the RNA-Seq data and qRTPCR results for the seven DEGS in the spleen was performed using cor() in the R environment. R2 was 0.86, 0.95, 0.90, 0.93, 0.80, 0.86, 0.36 in Aatk, DAPK2, IL6ST, Bax, Cd63, Inppl1b, and Sh2d1a. All seven DEGs in the spleen showed the same linear correlation between qRTPCR and RNA-seq. Correlation analysis revealed that qRTPCR and RNA-seq showed a significant trend (p < 0.05) for Aatk, DAPK2, IL6ST, Bax, Cd63, and Inppl1b (Figure 5).

3.6. Disease Resistance

In this study, the RPS was 85.71% in the group fed with A. membranaceus-enriched diets when challenged with A. hydrophila (Table 4). The mortalities were0%, 3.33%, 6.67%, 10%, 10%, 10%, and 10% from the first day to the seventh day in the A. membranaceus group, respectively. In the control group, the mortality was 20%, 46.7%, 56.7%, 63.3%, 66.7%, 70%, and 70% from the first day to the seventh day. The time to reach the highest mortality was on the fourth and sixth days in the A. membranaceus group and the control groups, respectively (Figure 6). The mortality rate of the control group was 70%, which was significantly higher than the A. membranaceus group. Fish in the control group died within 24 h, which was 1 d earlier than the A. membranaceus group, once infected by A. hydrophila.
A. membranaceus can effectively enhance disease resistance and reduce mortality in aquaculture. In this study, the mortality in the A. membranaceus group is much lower than in the control group after being stimulated by A. hydrophila. When the yellow catfish were fed astragalus polysaccharides and challenged with A. hydrophila, the mortality was much lower in the two groups [63]. Fed with traditional Chinese herbs and challenged with V. splendidus, the highest mortality of the red drum was 90% in the control group, and the lowest mortality and the highest RPS was 10% and 88.9% in the A. membranaceus group [9].

4. Conclusions and Prospects

In conclusion, the RPS of hybrid yellow catfish was 85.71%, and the spleen transcriptomes were analyzed in the group fed with A. membranaceus-enriched diets. There were 396 DEGs between the A. membranaceus and control groups at 24 h after A. hydrophila stimulation, including 263 upregulated and 133 downregulated DEGs. Seven DEGs were selected for the qRTPCR analysis. A. membranaceus effectively prevented hybrid yellow catfish from acquiring the disease when challenged with A. hydrophila. A. membranaceus significantly decreased mortality and enhanced the RPS. Thus, it can be concluded that A. membranaceus extracts can be used as immunostimulants to enhance the immune response and disease resistance of cultured hybrid yellow catfish. This study will help elucidate the significance of A. membranaceus in bacterial defense.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/fishes8090454/s1, Table S1: 396 differentially expressed genes between Astragalus membranaceus group and the control group at 24 h after Aeromonas hydrophila stimulation.

Author Contributions

T.P.: methodology, data curation, and writing—original draft preparation. M.Y.: methodology and writing—review and editing. H.J. and T.L.: writing—review and editing. G.D.: methodology. J.L.: project administration, supervision, writing—review and editing. Q.G.: writing—review and editing. All authors have read and agreed to the published version of this manuscript.

Funding

This research was funded by the Anhui Key Research and Development Program (grant number: 202004a06020063); Young Talent Program of Anhui Academy of Agricultural Sciences (grant number: 2023-2027).

Institutional Review Board Statement

All fish experiments were conducted under the national regulations on laboratory animals of China and approved by the Experimental Animal Welfare and Ethical of Anhui Academy of Agricultural Sciences guidelines of use of animals for research (Approval Code: AAAS2021-30).

Data Availability Statement

All the data generated or used during this study appear in the submitted article.

Conflicts of Interest

The authors declare that there are no conflict of interest regarding the publication of the work described in this manuscript.

References

  1. Shao, W.; Fan, Q.; Zhang, C.; Wang, L. Comparative analysis of nutritive composition in muscle of “huangyou no. 1”, yellow catfish and darkbarbel catfish. J. Huazhong Agric. Univ. 2018, 37, 76–82. [Google Scholar]
  2. Pan, T.; Yan, M. The screening of traditional Chinese herbs on nonspecific immune response and protection of Pacific white shrimp (Litopenaeus vannamei) from Vibrio harveyi infection. Aquac. Int. 2020, 28, 767–776. [Google Scholar] [CrossRef]
  3. Barman, D.; Nen, P.; Mandal, S.C.; Kumar, V. Immunostimulants for aquaculture health management. J. Mar. Sci. Res. Dev. 2013, 3, 1000134. [Google Scholar] [CrossRef]
  4. Labh, S.N.; Shakya, S.R. Application of Immunostimulants as an Alternative to Vaccines for Health Management in Aquaculture; AkiNik Publications: New Delhi, India, 2014. [Google Scholar]
  5. Sakai, M. Current research status of fish immunostimulants. Aquaculture 1999, 172, 63–92. [Google Scholar] [CrossRef]
  6. Ardó, L.; Yin, G.; Xu, P.; Váradi, L.; Szigeti, G.; Jeney, Z.; Jeney, G. Chinese herbs (Astragalus membranaceus and Lonicera japonica) and boron enhance the non-specific immune response of Nile tilapia (Oreochromis niloticus) and resistance against Aeromonas hydrophila. Aquaculture 2008, 275, 26–33. [Google Scholar] [CrossRef]
  7. Wang, C.; Liu, H.; Mu, G.; Lu, S.; Wang, D.; Jiang, H.; Sun, X.; Han, S.; Liu, Y. Effects of traditional Chinese medicines on immunity and culturable gut microflora to Oncorhynchus masou. Fish Shellfish Immunol. 2019, 93, 322–327. [Google Scholar] [CrossRef]
  8. Xia, Y.-T.; Cheng, E.H.-C.; Xia, Y.-J.; Wu, Q.-Y.; Zhang, L.H.-L.; Lin, S.-Y.; Dong, T.T.-X.; Qin, Q.-W.; Wang, W.-X.; Tsim, K.W.-K. Characterization of a macrophagic-like cell line derived from rabbit fish (Siganus fuscescens): An illustration of anti-inflammatory responses of the herbal extract of Scutellaria baicalensis. Fish Shellfish Immunol. Rep. 2021, 2, 100036. [Google Scholar] [CrossRef] [PubMed]
  9. Pan, T.; Yan, M.; Chen, S.; Wang, X. Effects of Ten Traditional Chinese Herbs on Immune Response and Disease Resistance of Sciaenops Ocellatus (Actinopterygii: Perciformes: Sciaenidae). Acta Ichthyol. Piscat. 2013, 43, 41–49. [Google Scholar] [CrossRef]
  10. Adel, M.; Yeganeh, S.; Dawood, M.A.O.; Safari, R.; Radhakrishnan, S. Effects of pediococcus pentosaceus supplementation on growth performance, intestinal microflora and disease resistance of white shrimp, litopenaeus vannamei. Aquac. Nutr. 2017, 23, 1401–1409. [Google Scholar] [CrossRef]
  11. Jeney, G.; Jeney, Z. Application of immunostimulants for modulation of the non-specific defense mechanisms in sturgeon hybrid: Acipenser ruthenus x a. Baerii. J. Appl. Ichthyol. 2002, 18, 416–419. [Google Scholar] [CrossRef]
  12. Zeng, P.; Li, J.; Chen, Y.; Zhang, L. The structures and biological functions of polysaccharides from traditional Chinese herbs. Prog. Mol. Biol. Transl. Sci. 2019, 163, 423–444. [Google Scholar] [CrossRef]
  13. Shan, H.; Zheng, X.; Li, M. The Effects of Astragalus membranaceus Active Extracts on Autophagy-Related Diseases. Int. J. Mol. Sci. 2019, 20, 1904. [Google Scholar] [CrossRef] [PubMed]
  14. Fu, J.; Wang, Z.; Huang, L.; Zheng, S.; Wang, D.; Chen, S.; Zhang, H.; Yang, S. Review of the botanical characteristics, phytochemistry, and pharmacology of astragalus membranaceus (huangqi). Phytother. Res. 2014, 28, 1275–1283. [Google Scholar] [CrossRef]
  15. Mo, W.Y.; Lun, C.H.I.; Choi, W.M.; Man, Y.B.; Wong, M.H. Enhancing growth and non-specific immunity of grass carp and Nile tilapia by incorporating Chinese herbs (Astragalus membranaceus and Lycium barbarum) into food waste based pellets. Environ. Pollut. 2016, 219, 475–482. [Google Scholar] [CrossRef] [PubMed]
  16. Elabd, H.; Wang, H.-P.; Shaheen, A.; Matter, A. Astragalus membranaceus nanoparticles markedly improve immune and anti-oxidative responses; and protection against Aeromonas veronii in Nile tilapia Oreochromis niloticus. Fish Shellfish Immunol. 2019, 97, 248–256. [Google Scholar] [CrossRef]
  17. Wang, X.; Ding, L.; Yan, M.; Chai, X.; Lu, R.; Wang, Q.; Li, F. Polysaccharides, Saponins, and Water Decoction of Astragalus membranaceus Significantly Enhance the Non-Specific Immune Response of Spotted Maigre (Nibea albiflora). Isr. J. Aquac. Bamidgeh 2012, 64, 20621. [Google Scholar] [CrossRef]
  18. Abdel-Latif, H.M.; Ahmed, H.A.; Shukry, M.; Chaklader, M.R.; Saleh, R.M.; Khallaf, M.A. Astragalus membranaceus extract (ame) enhances growth, digestive enzymes, antioxidant capacity, and immunity of pangasianodon hypophthalmus juveniles. Fishes 2022, 7, 319. [Google Scholar] [CrossRef]
  19. Shi, F.; Lu, Z.; Yang, M.; Li, F.; Zhan, F.; Zhao, L.; Li, Y.; Li, Q.; Li, J.; Li, J. Astragalus polysaccharides mediate the immune response and intestinal microbiota in grass carp (ctenopharyngodon idellus)—Sciencedirect. Aquaculture 2020, 534, 736205. [Google Scholar] [CrossRef]
  20. Marioni, J.C.; Mason, C.E.; Mane, S.M.; Stephens, M.; Gilad, Y. RNA-seq: An assessment of technical reproducibility and comparison with gene expression arrays. Genome Res. 2008, 18, 1509–1517. [Google Scholar] [CrossRef]
  21. Liu, Y.; Xin, Z.-Z.; Zhang, D.-Z.; Wang, Z.-F.; Zhu, X.-Y.; Tang, B.-P.; Jiang, S.-H.; Zhang, H.-B.; Zhou, C.-L.; Chai, X.-Y.; et al. Transcriptome analysis of yellow catfish (Pelteobagrus fulvidraco) liver challenged with polyriboinosinic polyribocytidylic acid (poly I:C). Fish Shellfish Immunol. 2017, 68, 395–403. [Google Scholar] [CrossRef]
  22. Tao, Y.-F.; Qiang, J.; Dagoudo, M.; Zhu, H.-J.; Bao, J.-W.; Ma, J.-L.; Li, M.-X.; Xu, P. Transcriptome profiling reveals differential expression of immune-related genes in gills of hybrid yellow catfish (Tachysurus fulvidraco ♀ × Pseudobagrus vachellii ♂) under hypoxic stress: Potential NLR-mediated immune response. Fish Shellfish Immunol. 2021, 119, 409–419. [Google Scholar] [CrossRef]
  23. Zhang, J.; Ma, W.; Song, X.; Lin, Q.; Gui, J.-F.; Mei, J. Characterization and Development of EST-SSR Markers Derived from Transcriptome of Yellow Catfish. Molecules 2014, 19, 16402–16415. [Google Scholar] [CrossRef]
  24. Chen, X.; Mei, J.; Wu, J.; Jing, J.; Ma, W.; Zhang, J.; Dan, C.; Wang, W.; Gui, J.-F. A Comprehensive Transcriptome Provides Candidate Genes for Sex Determination/Differentiation and SSR/SNP Markers in Yellow Catfish. Mar. Biotechnol. 2015, 17, 190–198. [Google Scholar] [CrossRef]
  25. Bian, L.; Liu, C.; Chen, S.; Zhao, F.; Ge, J.; Tan, J. Transcriptome analysis of gene expression patterns during embryonic development in golden cuttlefish (sepia esculenta). Genes Genom. 2018, 40, 253–263. [Google Scholar] [CrossRef]
  26. Kim, W.-J.; Lee, K.; Lee, D.; Kim, H.-C.; Nam, B.-H.; Jung, H.; Yi, S.-J.; Kim, K. Transcriptome profiling of olive flounder responses under acute and chronic heat stress. Genes Genom. 2021, 43, 151–159. [Google Scholar] [CrossRef] [PubMed]
  27. Yang, L.; Wang, Y.; Zhang, Z.; He, S. Comprehensive transcriptome analysis reveals accelerated genic evolution in a tibet fish, gymnodiptychus pachycheilus. Genome Biol. Evol. 2015, 7, 251–261. [Google Scholar] [CrossRef] [PubMed]
  28. Carruthers, M.; Yurchenko, A.A.; Augley, J.J.; Adams, C.E.; Herzyk, P.; Elmer, K.R. De novo transcriptome assembly, annotation and comparison of four ecological and evolutionary model salmonid fish species. BMC Genom. 2018, 19, 4379. [Google Scholar]
  29. Reed, L.J.; Muench, H. A simple method of estimating fifty per cent endpoints. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef]
  30. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
  31. Tatusov, R.L.; Galperin, M.Y.; Natale, D.A.; Koonin, E.V. The COG database: A tool for genome-scale analysis of protein functions and evolution. Nucleic Acids Res. 2000, 28, 33–36. [Google Scholar] [CrossRef]
  32. Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D. Gene ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef]
  33. Minoru, K.; Susumu, G.; Shuichi, K.; Yasushi, O.; Masahiro, H. The kegg resource for deciphering the genome. Nucleic Acids Res. 2004, 32, D277. [Google Scholar]
  34. Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef] [PubMed]
  35. Anders, S.; Huber, W. Differential Expression of rna-seq Data at the Gene Level–The Deseq Package. Heidelberg, Germany: European Molecular Biology Laboratory (EMBL) 10 (2012): F1000research. Available online: https://www.genomatix.de/online_help/help_regionminer/DESeq_1.10.1.pdf (accessed on 8 December 2021).
  36. Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T.; et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2007, 36, D480–D484. [Google Scholar] [CrossRef] [PubMed]
  37. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  38. Liu, Q.-N.; Xin, Z.-Z.; Chai, X.-Y.; Jiang, S.-H.; Li, C.-F.; Zhang, H.-B.; Ge, B.-M.; Zhang, D.-Z.; Zhou, C.-L.; Tang, B.-P. Characterization of immune-related genes in the yellow catfish Pelteobagrus fulvidraco in response to LPS challenge. Fish Shellfish Immunol. 2016, 56, 248–254. [Google Scholar] [CrossRef] [PubMed]
  39. Zhu, R.; Liu, X.-X.; Lv, X.; Li, S.-Y.; Li, Y.-D.; Yu, X.-J.; Wang, X.-G. Deciphering transcriptome profile of the yellow catfish (Pelteobagrus fulvidraco) in response to Edwardsiella ictaluri. Fish Shellfish Immunol. 2017, 70, 593–608. [Google Scholar] [CrossRef]
  40. Li, Z.; Liu, X.; Cheng, J.; He, Y.; Wang, X.; Wang, Z.; Qi, J.; Yu, H.; Zhang, Q. Transcriptome profiling provides gene resources for understanding gill immune responses in Japanese flounder (Paralichthys olivaceus) challenged with Edwardsiella tarda. Fish Shellfish Immunol. 2018, 72, 593–603. [Google Scholar] [CrossRef]
  41. Taylor, G.A. IRG proteins: Key mediators of interferon-regulated host resistance to intracellular pathogens. Cell. Microbiol. 2007, 9, 1099–1107. [Google Scholar] [CrossRef]
  42. Hunn, J.P.; Feng, C.G.; Sher, A.; Howard, J.C. The immunity-related GTPases in mammals: A fast-evolving cell-autonomous resistance system against intracellular pathogens. Mamm. Genome 2010, 22, 43–54. [Google Scholar] [CrossRef] [PubMed]
  43. MacMicking, J.D. Immune control of tuberculosis by ifn-γ-inducible lrg-47. Science 2003, 302, 654–659. [Google Scholar] [CrossRef] [PubMed]
  44. Hu, S.; Shi, Y.; Ding, T.; Duan, W.; Qiu, Z.; Zhao, Z. Functional characterization of an immunity-related GTPase gene in immune defense from obscure puffer (Takifugu obscurus). Fish Shellfish Immunol. 2020, 103, 248–255. [Google Scholar] [CrossRef]
  45. Boles, K.S.; Mathew, P.A. Molecular cloning of CS1, a novel human natural killer cell receptor belonging to the CD2 subset of the immunoglobulin superfamily. Immunogenetics 2001, 52, 302–307. [Google Scholar] [CrossRef] [PubMed]
  46. Simmons, D.P.; Nguyen, H.N.; Gomez-Rivas, E.; Jeong, Y.; Brenner, M.B. Slamf7 Engagement Super-Activates Macrophages in Acute and Chronic Inflammation; Cold Spring Harbor Laboratory: New York, NY, USA, 2020. [Google Scholar]
  47. Choe, U.; Pham, Q.; Kim, Y.S.; Yu, L.; Wang, T.T.Y. Identification and elucidation of cross talk between SLAM Family Member 7 (SLAMF7) and Toll-like receptor (TLR) pathways in monocytes and macrophages. Sci. Rep. 2023, 13, 1–13. [Google Scholar] [CrossRef]
  48. Li, K.; Underhill, D. C-type lectin receptors in phagocytosis. Curr. Top. Microbiol. Immunol. Undefined 2020, in press. [Google Scholar]
  49. Yu, M.; Chang, S.; Xu, J.; Zhang, H.; Jiang, Y. Genome-wide identification of endosialin family of C-type lectins in common carp (Cyprinus carpio) and their response following Aeromonas hydrophila infection. Dev. Comp. Immunol. 2022, 129, 104338. [Google Scholar] [CrossRef] [PubMed]
  50. Mu, L.; Yin, X.; Liu, J.; Wu, L.; Bian, X.; Wang, Y.; Ye, J. Identification and characterization of a mannose-binding lectin from Nile tilapia (Oreochromis niloticus). Fish Shellfish Immunol. 2017, 67, 244–253. [Google Scholar] [CrossRef]
  51. Liu, F.; Li, J.; Fu, J.; Shen, Y.; Xu, X. Two novel homologs of simple C-type lectin in grass carp (Ctenopharyngodon idellus): Potential role in immune response to bacteria. Fish Shellfish Immunol. 2011, 31, 765–773. [Google Scholar] [CrossRef]
  52. Gaozza, E.; Baker, S.J.; Vora, R.K.; Reddy, E.P. AATYK: A novel tyrosine kinase induced during growth arrest and apoptosis of myeloid cells. Oncogene 1997, 15, 3127–3135. [Google Scholar] [CrossRef]
  53. Haag, T.; Herkt, C.E.; Walesch, S.K.; Richter, A.M.; Dammann, R.H. The apoptosis associated tyrosine kinase gene is frequently hypermethylated in human cancer and is regulated by epigenetic mechanisms. Genes Cancer 2014, 5, 365–374. [Google Scholar] [CrossRef]
  54. Steinmann, S.; Scheibe, K.; Erlenbach-Wuensch, K.; Neufert, C.; Schneider-Stock, R. Death-associated protein kinase: A molecule with functional antagonistic duality and a potential role in inflammatory bowel disease (Review). Int. J. Oncol. 2015, 47, 5–15. [Google Scholar] [CrossRef]
  55. Xu, Y.; Feng, Y.; Li, S.; Sun, J. Identification and characterization of apoptosis-related gene serine/threonine kinase 17A (STK17A) from Japanese flounder Paralichthys olivaceus. Fish Shellfish Immunol. 2020, 98, 1008–1016. [Google Scholar] [CrossRef]
  56. Nagy, N.; Matskova, L.; Kis, L.L.; Hellman, U.; Klein, G.; Klein, E. The proapoptotic function of SAP provides a clue to the clinical picture of X-linked lymphoproliferative disease. Proc. Natl. Acad. Sci. USA 2009, 106, 11966–11971. [Google Scholar] [CrossRef] [PubMed]
  57. Xu, J.; Zhao, J.; Li, Y.; Zou, Y.; Lu, B.; Chen, Y.; Ma, Y.; Xu, H. Evaluation of differentially expressed immune-related genes in intestine of Pelodiscus sinensis after intragastric challenge with lipopolysaccharide based on transcriptome analysis. Fish Shellfish Immunol. 2016, 56, 417–426. [Google Scholar] [CrossRef]
  58. Brady, H.J.; Gil-Gómez, G. Molecules in focus bax. The pro-apoptotic bcl-2 family member, bax. Int. J. Biochem. Cell Biol. 1998, 30, 647–650. [Google Scholar] [CrossRef] [PubMed]
  59. Schröder, J.; Lüllmann-Rauch, R.; Himmerkus, N.; Pleines, I.; Nieswandt, B.; Orinska, Z.; Koch-Nolte, F.; Schröder, B.; Bleich, M.; Saftig, P. Deficiency of the tetraspanin cd63 associated with kidney pathology but normal lysosomal function. Mol. Cell. Biol. 2009, 29, 1083–1094. [Google Scholar] [CrossRef]
  60. Priyathilaka, T.T.; Bathige, S.; Herath, H.; Lee, S.; Lee, J. Molecular identification of disk abalone (Haliotis discus discus) tetraspanin 33 and CD63: Insights into potent players in the disk abalone host defense system. Fish Shellfish Immunol. 2017, 69, 173–184. [Google Scholar] [CrossRef]
  61. Ooms, L.M.; Horan, K.A.; Rahman, P.; Seaton, G.; Gurung, R.; Kethesparan, D.S.; Mitchell, C.A. The role of the inositol polyphosphate 5-phosphatases in cellular function and human disease. Biochem. J. 2009, 419, 29–49. [Google Scholar] [CrossRef] [PubMed]
  62. Dimitriadis, E.; White, C.; Jones, R.; Salamonsen, L. Cytokines, chemokines and growth factors in endometrium related to implantation. Hum. Reprod. Updat. 2005, 11, 613–630. [Google Scholar] [CrossRef]
  63. Bai, D.; Wu, X.; Zhu, G.; Guo, Y.; Yang, G.; Ning, B.; Xing, K. Astragalus Polysaccharides Enhance Cellular Immune Response and Disease Resistance in Yellow Catfish. Isr. J. Aquac. 2012, 64. [Google Scholar] [CrossRef]
Fishes 08 00454 g001
Figure 1. Volcano plots of DEGs from Astragalus membranaceus group and control group. The x-axis and y-axis represent fold change and −log10q-value, respectively. In volcano plot, red dots, blue dots, and grey dots represent significant upregulated, significant downregulated, and non-significant different unigenes, respectively.
Figure 1. Volcano plots of DEGs from Astragalus membranaceus group and control group. The x-axis and y-axis represent fold change and −log10q-value, respectively. In volcano plot, red dots, blue dots, and grey dots represent significant upregulated, significant downregulated, and non-significant different unigenes, respectively.
Fishes 08 00454 g001
Fishes 08 00454 g002
Figure 2. Top 30 gene ontology terms located in three categories: biological process, molecular function, and cellular component.
Figure 2. Top 30 gene ontology terms located in three categories: biological process, molecular function, and cellular component.
Fishes 08 00454 g002
Fishes 08 00454 g003
Figure 3. Top 20 KEGG pathways of DEGs. The KEGG enrichment score and the names of the top 20 pathways are shown on the x- and y-axes, respectively.
Figure 3. Top 20 KEGG pathways of DEGs. The KEGG enrichment score and the names of the top 20 pathways are shown on the x- and y-axes, respectively.
Fishes 08 00454 g003
Fishes 08 00454 g004
Figure 4. RNA-seq and qRTPCR of seven immune-related genes. (A) The fold change of five upregulated and two downregulated immune-related genes between the Astragalus membranaceus and control groups by RNA-Seq. (B) Expression of spleen qRTPCR. (C) Expression of intestine qRTPCR. (D) Expression of liver qRTPCR. * indicates a significant difference between the A. membranaceus group and the control group (p < 0.05).
Figure 4. RNA-seq and qRTPCR of seven immune-related genes. (A) The fold change of five upregulated and two downregulated immune-related genes between the Astragalus membranaceus and control groups by RNA-Seq. (B) Expression of spleen qRTPCR. (C) Expression of intestine qRTPCR. (D) Expression of liver qRTPCR. * indicates a significant difference between the A. membranaceus group and the control group (p < 0.05).
Fishes 08 00454 g004
Fishes 08 00454 g005
Figure 5. Correlation between qRTPCR and RNA-seq of seven DEGs in spleen. X-axis and y-axis show RNA-seq and qRTPCR, respectively. (A) Aatk. (B) DAPK2. (C) IL6ST. (D) Bax. (E) Cd63. (F) Inppl1b. (G) Sh2d1a.
Figure 5. Correlation between qRTPCR and RNA-seq of seven DEGs in spleen. X-axis and y-axis show RNA-seq and qRTPCR, respectively. (A) Aatk. (B) DAPK2. (C) IL6ST. (D) Bax. (E) Cd63. (F) Inppl1b. (G) Sh2d1a.
Fishes 08 00454 g005
Fishes 08 00454 g006
Figure 6. Mortality of hybrid yellow catfish. Time indicates the day that fish have been challenged with Aeromonas hydrophila. Mortality = cumulative mortality. * indicates a significant difference between the Astragalus membranaceus group and the control group (p < 0.05).
Figure 6. Mortality of hybrid yellow catfish. Time indicates the day that fish have been challenged with Aeromonas hydrophila. Mortality = cumulative mortality. * indicates a significant difference between the Astragalus membranaceus group and the control group (p < 0.05).
Fishes 08 00454 g006
Table 1. Primer sequence used for qRTPCR.
Table 1. Primer sequence used for qRTPCR.
NamePrimers Sequences
aatkF: GGTGATGGCTACCAATCAGA
R: TGCTCCCATTTGTACTCAAAG
DAPK2F: AGGTGGTCCTCATCGTAG
R: TTCAGGAACTTGATCGCGT
IL6STF: CTCAGAAGCCTACATGGTATC
R: TTAGGTTTAGCGTTGTTGCG
BaxF: GACCAGATCGATGGTTTAGCA
R: TGTCCATCATCGAAGACGC
Cd63F: TCTTGGCCCTGATAATCGTAG
R: CGATGGAAGACTTCATCCG
inppl1bF: CCTGGTAATCCCTTTGCTTTAT
R: TGGCTTCTCATCATCTCCG
Sh2d1aF: AAAGCATTCCTTCGCAGAT
R: AAGTGATGTTCAGAGCCAG
β-ActinF: GCACAGTAAAGGCGTTGTGA
R: ACATCTGCTGGAAGGTGGAC
Table 2. Sequenced data for spleen transcriptome and its quality.
Table 2. Sequenced data for spleen transcriptome and its quality.
RIN
Value		Raw
Reads
(M)		Clean
Reads
(M)		Clean
Bases
(G)		GC
Percentage
(%)		Q30
(%)
CS2419.546.2544.936.5446.4392.01
CS2429.248.7047.436.9146.5892.54
CS2439.750.4949.177.1746.3192.42
AS2419.947.4146.096.7146.1792.00
AS2429.446.4045.086.5646.1991.97
AS2439.549.6148.297.0446.4192.16
Table 3. Reads of sample transcriptome and map ratio to the reference genome.
Table 3. Reads of sample transcriptome and map ratio to the reference genome.
SampleTotal ReadsMap ReadsMap Ratio
CS24144,929,76434,416,34676.60%
CS24247,428,33836,342,45376.63%
CS24349,172,94437,735,69776.74%
AS24146,093,01034,991,23575.91%
AS24245,079,55234,534,15176.61%
AS24348,294,02436,864,14976.33%
Table 4. Mortality and RPS in hybrid yellow catfish when challenged by Aeromonas hydrophila.
Table 4. Mortality and RPS in hybrid yellow catfish when challenged by Aeromonas hydrophila.
GroupChallenged Fish NumberDead Fish NumberMortality (%)Relative Percent Survival (%)
Astragalus membranaceus3 × 10310.0085.71
control3 × 102170.00/
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pan, T.; Yang, M.; Jiang, H.; Li, T.; Duan, G.; Ling, J.; Gao, Q. Effect of Astragalus membranaceus on Transcriptome and Survival of Hybrid Yellow Catfish (Pseudobagrus vachellii ♂ × Tachysurus fulvidraco ♀) in Response to Aeromonas hydrophila Challenge. Fishes 2023, 8, 454. https://doi.org/10.3390/fishes8090454

AMA Style

Pan T, Yang M, Jiang H, Li T, Duan G, Ling J, Gao Q. Effect of Astragalus membranaceus on Transcriptome and Survival of Hybrid Yellow Catfish (Pseudobagrus vachellii ♂ × Tachysurus fulvidraco ♀) in Response to Aeromonas hydrophila Challenge. Fishes. 2023; 8(9):454. https://doi.org/10.3390/fishes8090454

Chicago/Turabian Style

Pan, Tingshuang, Min Yang, He Jiang, Tong Li, Guoqing Duan, Jun Ling, and Qian Gao. 2023. "Effect of Astragalus membranaceus on Transcriptome and Survival of Hybrid Yellow Catfish (Pseudobagrus vachellii ♂ × Tachysurus fulvidraco ♀) in Response to Aeromonas hydrophila Challenge" Fishes 8, no. 9: 454. https://doi.org/10.3390/fishes8090454

Article Metrics

Back to TopTop