Next Article in Journal
Changes in the Functional Role of the Tejo Estuary (Portugal, Europe) According to Fish Ecological Guilds
Previous Article in Journal
Biofloc Application Using Aquaponics and Vertical Aquaculture Technology in Aquaculture: Review
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 8
Issue 11
10.3390/fishes8110544
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Diversity and Genetic Structure among Four Selected Strains of Whiteleg Shrimp (Litopenaeus vannamei) Using SSR Markers

by
Zhe Zhang
1,
Chengkuan Lu
2,
Kebing Lin
1,
Weiwei You
2 and
Zhangwu Yang
1,*
1
Fisheries Research Institute of Fujian, Xiamen 361000, China
2
College of Ocean and Earth Sciences, Xiamen University, Xiamen 361102, China
*
Author to whom correspondence should be addressed.
Fishes 2023, 8(11), 544; https://doi.org/10.3390/fishes8110544
Submission received: 21 September 2023 / Revised: 27 October 2023 / Accepted: 3 November 2023 / Published: 6 November 2023
(This article belongs to the Section Aquatic Invertebrates)
Browse Figure
Versions Notes

Abstract

:
The whiteleg shrimp (Litopenaeus vannamei) is one of the most economically important aquaculture species in China. Genetic diversity is crucial for maintaining the gene pool of farmed shrimp. In this study, the effects of artificial selection on the genetic structure of four whiteleg shrimp strains were evaluated using microsatellite sequences. The results showed that the observed heterozygosity (Ho), expected heterozygosity (He), and the polymorphism information content (PIC) of the four selected strains ranged from 0.446 to 0.574, 0.450 to 0.566, and 0.435 to 0.509, respectively. All the selected strains maintained a moderate level of genetic diversity. Most inbreeding coefficients (Fis) in the four strains were positive but not significantly different from zero, indicating a relatively low degree of inbreeding within each strain. However, He and PIC in line 5 showed a decreasing trend from the 2017 to the 2019 generations, and Fis in line 10 showed a significant increasing trend across generations, indicating that measures must be taken to maintain the level of genetic diversity for lines 5 and 10. UPGMA cluster trees showed that the four breeding lines had apparent genetic differences, which could provide a genetic basis for studying crossbreeding between selective lines and the utilization of heterosis. This study will be useful for population genetic research and the breeding strategies of whiteleg shrimp.
Keywords:
genetic diversity; artificial selection; microsatellite; whiteleg shrimp
Key Contribution: The four selected strains maintained a moderate level of genetic diversity and had apparent genetic differences by microsatellite analysis of whiteleg shrimp.

1. Introduction

Litopenaeus vannamei is native to the South Pacific and the coastal waters of America. Since its introduction to China in 1988, it has become a pillar of China’s aquaculture industry after decades of development. With increasing industrial and social demands, the annual demand for seedlings in China exceeds 400 billion tails. However, in recent years, due to the invasion of various shrimp diseases and the degradation of germplasm caused by frequent inbreeding, problems have occurred in the culturing of L. vannamei, including miniaturization, slow growth rates, and poor disease resistance [1]. Therefore, it is urgent to characterize the genetic variation in the existing population at the molecular level and breed new strains suitable for farming.
Shrimp farming is an indispensable part of China’s aquaculture industry. Almost all broods are produced in hatcheries using captive-cultured broodstock sources for artificial reproduction. In addition, current selection practices based on mass phenotypic selection are commonly applied, where rapidly growing individuals are particularly favored and then used as broodstock to produce the next generation of offspring. Thus, genetic diversity in hatchery stocks may be lost during such artificial propagation. The level of genetic diversity within a population closely relates to the animals’ ability to adapt to new environments and resist disease, and a reduction in genetic diversity can negatively impact production and hinder the development of the aquaculture industry [2].
Simple sequence repeats (SSRs) or microsatellite genetic markers are co-dominantly inherited in Mendelian patterns. They are widely used to estimate genetic distances, construct phylogenetic trees, and measure genetic diversity among species due to their diverse repeat motifs, high mutation frequency, rich polymorphism, codominant inheritance, and high versatility [3,4,5]. Although increasing attention has been paid to a new generation of molecular markers such as SNPs with the development of high-throughput sequencing, a previous study [6] suggested that SSRs provide more information concerning genetic diversity and perform better at estimating relative kinship than SNPs. SSRs have been used to monitor genetic variation in marine organisms such as Norway Lobster (Nephrops norvegicus) [7], Pacific oyster (Crassostrea gigas) [8], grooved carpet shell clam (Ruditapes decussatus) [9], Nile Tilapia (Oreochromis niloticus) [10], summer flounder (Paralichthys dentatus) [11], and pike-perch (Sander lucioperca) [12]. To date, hundreds of SSRs have been identified and utilized to examine the current status of germplasm resources of wild or hatchery stocks in shrimp species such as Fenneropenaeus chinensis [13], F. indicus [14], Penaeus japonicus [15], P. monodon [16], P. notialis [17], and L. vannamei [18]. Using eight polymorphic microsatellite markers, the genetic diversity and heterozygosity of four successive generations of P. chinensis were estimated and compared by Zhang et al. [19].
Studies on the genetic diversity of whiteleg shrimp for different geographic locations have also been reported. Li et al. [20] analyzed the genetic background of six populations of whiteleg shrimp in China, and the results showed that the genetic diversity of L. vannamei in different populations may be high, while the genetic relationship of L. vannamei in the same population might be quite close. Huang et al. [21] analyzed the genetic diversity of seedling samples collected from seven culture populations in three major shrimp production areas in Guangdong, and the results showed that the seven populations were clustered into three branches, indicating that the genetic characteristics vary in different cultured populations of L. vannamei. In the assessment of genetic diversity of whiteleg shrimp in Iran, researchers utilized four microsatellite loci to examine individuals from different farms and observed an overall average heterozygosity (Ho) between 0.450 and 0.479, which was lower than the expected value (0.789–0.794) [22].
In the present study, we used 12 microsatellite markers to analyze the genetic diversity within and between four selected strains (5, 8, 9, and 10) of whiteleg shrimp, including different generations of selected fast-growing strains. The objective of this study was to evaluate the impact of selection practices on population genetic diversity. The results of this study will help shrimp farmers to better understand the genetic structure of the selected strains, thereby improving management strategies for shrimp farming programs.

2. Materials and Methods

2.1. Sample Collection

Four lines, namely 5, 8, 9, and 10, were used in the present study. These lines have been continuously selected for two to four generations from 2016 to 2019. Four generations were analyzed for line 5 (strain 20160505, 20170505, 20180505 and 20190505), two generations for line 8 (strain 20180808 and 20190808), two generations for line 9 (strain 20180909 and 20190909), and three generations were analyzed for line 10 (strain 20171010, 20181010, 20191010). At least 300 pairs from each population were preserved for constructing the core germplasm resource bank.

2.2. DNA Extraction

Live adult shrimp were randomly sampled, and equal amounts of muscle tissue were sampled from each strain (N = 32) from 2016 to 2019. The samples were immediately fixed in 95% ethanol for subsequent experiments. Total genomic DNA for genotyping was extracted using the TIANamp Marine Animals DNA kit (Beijing, China) according to the manufacturer’s guidelines. DNA quantification and qualification were performed using an ND2000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA), and DNA integrity was examined via 1% agarose gel electrophoresis.

2.3. Microsatellite Loci Amplification and Genotyping

Genetic diversity was examined using 12 pairs of highly polymorphic and well amplified microsatellite primers that have been developed in previous research [23] (Table 1). DNA amplification was performed in a 20 μL reaction mixture containing 2.0 μL of 10× Taq TM buffer (Takara, Dalian, China), 0.25 mM of each dNTP, 1 U of TaqTM polymerase (Takara), 20 pmol of each primer (the forward primer from each pair was 5′-end-labeled with 6-FAM, ROX, or HEX dye), and 1 μL of genomic DNA (approximately 50 ng/μL). Polymerase chain reactions were conducted using an ABI thermocycler (ABI, Veriti96, Waltham, MA, USA) under the following conditions: preheating at 95 °C for 5 min followed by 35 cycles of denaturation at 95 °C for 30 s, primer-specific annealing for 45 s (Table 1), and primer extension at 72 °C for 45 s followed by a final extension step at 72 °C for 5 min. PCR products were detected by 1% agarose gel electrophoresis, and then placed in the gel imaging system to observe whether the target fragment was amplified. The mixed PCR products were then sent to Shanghai Sangon Biotechnology Co., Ltd., (Shanghai, China) and the ABI 3500xl gene analyzer was used for capillary electrophoresis to detect fluorescence signals.

2.4. Data Analysis

Allele size scoring was performed using GeneMapper ver. 4. Possible null alleles and genotyping errors were tested using MICRO-CHECKER ver. 2.2.3 (1000 randomizations) [24], and conformation to the Hardy–Weinberg equilibrium was tested in Arlequin [25] using the Markov chain method with 1,000,000 chain steps and an initial burn-in of 100,000 steps. Standard genetic diversity parameters, including the number of alleles (Na), the number of effective alleles (Ne), observed heterozygosity (Ho), expected heterozygosity (He), and the fixation index (F), were determined for each sample at each locus using GenAlEx 6.41 [26]. Differences in diversity between populations were calculated through a Kruskal–Wallis test using SPSS 17.0. The inbreeding coefficient (mean Fis) was then calculated using FSTAT 2.9.3 [27]. Genetic distances among populations were estimated using Nei’s genetic distance (GD). To examine genetic relationships among populations, a phylogenetic tree was constructed based on pairwise genetic distances for all samples using the UPGMA method as provided in the program MEGA5.2. The occurrence of recent bottlenecks was evaluated using a standardized differences test (assuming the infinite alleles model, 10,000 replicates at a nominal level of 5%) in BOTTLENECK v.1.2.02 [28].

3. Results

3.1. Genetic Diversity Analysis

No evidence of scoring errors due to stuttering or large allele dropout was identified by Micro-Checker, whereas there was evidence of null alleles at several loci for particular populations. All loci were polymorphic across strains, and the level of polymorphism varied among loci (Table 2).
The results showed that in the five generations of line 5, the Na, Ne, He, and PIC values ranged from 3.455 to 3.909, 2.123 to 2.346, 0.450 to 0.513, and 0.435 to 0.490, respectively. In the three generations of line 8, the averages for Na, Ne, He, and PIC ranged from 3.909 to 5.273, 2.353 to 2.656, 0.484 to 0.523, and 0.428 to 0.509, respectively. In the three generations of line 9, the averages of Na, Ne, He, and PIC ranged from 4.000 to 4.818, 2.441 to 2.669, 0.504 to 0.535, and 0.448 to 0.471, respectively. In the four generations of line 10, the averages of Na, Ne, He, and PIC ranged from 3.818 to 5.273, 2.288 to 2.831, 0.519 to 0.566, and 0.455 to 0.515, respectively. These results indicated a mid-level genetic diversity and a rich polymorphism information content of these core populations.

3.2. Genetic Relationships among Populations

The UPGMA cluster trees of the four selected populations based on genetic distance are shown in Figure 1. The results showed that the genetic distances among breeding generations of line 5 and other lines were the largest, clustering into a single group at present. By contrast, the other three breeding lines showed significant genetic differences, providing a basis for the study of cross-breeding between lines and the utilization of heterosis. At present, no genetic markers have been found to distinguish the four lines, but the number of alleles in each line at pvan1815 was different, and the numbers of alleles in lines 8 and 9 were significantly higher than those in line 10 groups.

4. Discussion

The assessment of genetic diversity is essential for the conservation and utilization of germplasm resources. In selective breeding, genes related to target traits are often retained, while adverse alleles tend to be eliminated, resulting in decreased genetic diversity. Furthermore, unbalanced parental contributions and small effective population sizes are associated with selective breeding programs for shrimp promote inbreeding, leading to a rapid decline in genetic diversity and inbreeding depression [29]. Therefore, monitoring the genetic diversity and understanding changes in the genetic structure in generations of different hatchery stocks is important to improve management strategies for shrimp breeding programs.
Differences in Ho, He, and PIC values reflect differences in the included accessions, as well as the polymorphism of the included SSR markers. In this study, Ho, He, and PIC values for the four selected strains ranged from 0.446 to 0.574, 0.450 to 0.566, and 0.435 to 0.509, respectively. Compared with previous reports on the genetic diversity of the whiteleg shrimp L. vannamei, similar levels of these same parameters were reported by Huang et al. [21] for the first filial generation of seven introduced populations in Guangdong, China (Ho: 0.370–0.505; He: 0.477–0.670; PIC: 0.414–0.623). The levels of genetic diversity seemed slightly higher than those of four selected stocks (Ho: 0.3833–0.4444; He: 0.4214–05289; PIC: 0.3813–0.4478) in Zhanjiang, China [30], as well as nine breeding populations (Ho: 0.2225–0.3662; He: 0.3317–0.4539) in Shanghai, China [31]. However, the parameter values in this study were lower than those reported by Lima et al. [32], Zhang et al. [33], and Ren et al. [18], with the range of variation in He being 0.632–0.709, 0.600–0.802, and 0.58–0.78, respectively. This analysis suggests that each of the selected strains maintained a moderate level of genetic diversity. In addition, most of the strains in this study had He > Ho, indicating that a certain degree of inbreeding already exists within the population, which reminds us that the richness of the base population can be appropriately increased during artificial selection to avoid the loss of genetic diversity.
He and PIC are optimal parameters for measuring the genetic diversity of a population at multiple loci. In this study, He and PIC in the 2017–2019 generations of line 5 showed a decreasing trend from year to year, with a total decrease rate of about 0.6 over the three years. In lines 8, 9, and 10, the values of He and PIC in consecutive generations fluctuated, and He was greater than 0.5 in all lines except line 8 (0.484) in 2018, indicating a relatively stable level of genetic diversity. Loss of genetic diversity during selective breeding has been previously observed in P. monodon [34], P. chinensis [19], and Macrobrachium rosenbergii [35]. Sbordoni et al. [29] reported an evident reduction in genetic variation over time in hatchery stocks of P. japonicus using allozyme markers, with Ho decreasing from 0.102 in F1 to 0.039 in F6. The result was attributed to a bottleneck effect resulting from an effective breeding population as low as four. Smaller breeding population sizes and higher selection intensity may increase genetic gains but can also magnify sibship among broodstock, resulting in inbreeding and a loss of genetic diversity. This, in turn, can reduce resistance to environmental fluctuations and the potential for future generations to respond to selection pressures.
The inbreeding coefficients (Fis) for the four strains were mostly positive (except for groups 20180505 and 20191010), but they were not significantly different from zero, suggesting relatively low degrees of inbreeding in each group. These results for Fis also indicate the maintenance of a moderate level of genetic diversity. More significant Fis values have been reported by Valles-Jimenez et al. [36] in wild populations of L. vannamei from Mexico to Panama (Fis = 0.533) and by Atencia-Galindo et al. [17] in natural populations of P. notialis in Colombia (Fis: 0.597–0.720). Tong et al. [37,38] have reported germplasm degradation in successive generations as a result of the gradual loss of genetic diversity and relatively high levels of inbreeding in L. vannamei, as evidenced by size inequality and slow growth. In this study, we noted that Fis in each generation of line 10 was significantly higher than in the other three lines, indicating that inbreeding and a loss of genetic diversity may occur more easily in this strain. Therefore, to maintain the level of genetic diversity, especially for lines 5 and 10, it will be necessary to preserve a sufficient number of effective broodstock using a balanced sex ratio, a large broodstock size, and low selection pressure in the selective breeding program [39]. The breeding can also be improved by introducing an outgroup with high genetic diversity for hybridization.
Broadcast spawning in commercial hatcheries and unequal parental contributions increase the risk of unintentional inbreeding in aquatic animals, which can adversely affect production [2,40]. It has been reported that genetic diversity is lost when the effective number of parents is reduced to <100 [24,41]. Furthermore, artificial and natural selection in the culture environment may have altered the overall allelic composition of the farmed populations [42,43]. The present results indicate that the selected strains have lost considerable genetic variation during domestication. A 22–44% loss of alleles has been reported for hatchery-cultured silver-lipped pearl oysters, Pinctada maxima [2]. Substantial losses in genetic diversity in long-term mass selection or hatchery lines have also been observed in the Eastern oyster [44,45] the Pacific oyster [46], and cultured abalones [47,48,49]. Several factors, such as null alleles, nonrandom mating, admixture of independent populations, or artificial and natural selection during seed production and cultivation, could lead to heterozygote deficiency. The Wahlund effect refers to the reduction in observed heterozygosity caused by (cryptic) population substructure [50]. In the presence of the Wahlund effect, the power to detect heterozygote deficits depends on the effective population size, migration rate, the number of demes being pooled, and the sample size per deme [51].
The idea that highly fecund marine animals might have smaller-than-expected effective population sizes due to high variance in individual reproductive success has been described as sweepstake reproductive success (SRS) [52]. Reproductive success in marine organisms may at times resemble a sweepstake lottery, in which there are a few big winners and many losers. SRS, which is conceptually distinct from a bottleneck, produces a dynamic, mutation-drift equilibrium driven by the environmental vagaries of reproductive success and maintains much less genetic diversity than expected based on a large census size. Recent studies have found evidence for reduced variation within cohorts and enhanced variation among cohorts compared to variation among adult populations [52,53]. This pattern would increase the impact of inbreeding depression at the farm level during aquaculture. The results suggested a slight but not significant decline in heterozygosity and a reduction in differentiation and variation in the genetic structure over time under increased selection.
Several strategies exist concerning how to maintain the genetic diversity of the nucleus population. Cross-breeding with wild animals may be an effective method [54]. However, there are also distinct disadvantages. Wild animals are genetically unimproved, and thus their addition to the breeding nucleus could degrade the genetic selection responses already achieved, and the introduction may introduce pathogens [55]. Another method was suggested by Knibb [56]. In his plan, a line is divided into various sublines, and although there is a loss of variation in each subline, the loss is for different alleles or haplotypes. Overall, across the different sublines, variations approaching that in the ancestral population can be retained. In addition, the decrease in genetic variation may be delayed by lower selection intensity. A previous study on a species of clam (Meretrix petechialis) showed that observed heterozygosity was reduced by 11.48% after one generation of selection using a selection intensity of the top 15%, and this was alleviated under lower selection intensity (top 30%) over four generations [57,58].

5. Conclusions

In conclusion, the present study has revealed that artificial selection negatively influences genetic variation and differentiation in cultured populations and the four selected lines had apparent genetic differences. These findings indicate the importance of balancing the relationship between enhancing economic production traits and maintaining sufficient genetic diversity in a selective breeding program for aquatic animals. Cross-breeding and utilization of heterosis might be an efficient method for the shrimp breeding program in China.

Author Contributions

Conceptualization, W.Y. and Z.Y.; methodology, C.L.; investigation, Z.Z.; data curation, K.L.; supervision, W.Y.; project administration, Z.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by grants from the seed industry innovation and industrialization project in Fujian Province (2017FJSCZY02).

Institutional Review Board Statement

The sample collection and experimental protocols were approved by the Animal Care and Use Committee of the Fisheries Research Institute of Fujian (Animal Ethics No. 2021-2). All animal handling and methods were performed according to the relevant guidelines.

Data Availability Statement

Data are contained within the article.

Acknowledgments

The authors acknowledge help from Wenchao Yu with the data collection and manuscript preparation.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Chen, X.; Xiong, J. Development of the Culture of the White-Legged Shrimp, Penaeus vannamei. In Aquaculture in China: Success Stories and Modern Trends; Gui, J.-F., Tang, Q., Li, Z., Liu, J., De Silva, S.S., Eds.; Wiley: New York, NY, USA, 2018; pp. 378–392. [Google Scholar]
  2. Lind, C.E.; Evans, B.S.; Knauer, J.; Taylor, J.J.U.; Jerry, D.R. Decreased genetic diversity and a reduced effective population size in cultured silver-lipped pearl oysters (Pinctada maxima). Aquaculture 2009, 286, 12–19. [Google Scholar] [CrossRef]
  3. Holland, B.S. Invasion without a bottleneck: Microsatellite variation in natural and invasive populations of the brown mussel Perna perna (L). Mar. Biotechnol. 2001, 3, 407–415. [Google Scholar] [CrossRef]
  4. Zane, L.; Bargelloni, L.; Patarnello, T. Strategies for microsatellite isolation: A review. Mol. Ecol. 2002, 11, 1–16. [Google Scholar] [CrossRef]
  5. O’Connell, M.; Wright, J.M. Microsatellite DNA in fishes. Rev. Fish Biol. Fish. 1997, 7, 331–363. [Google Scholar] [CrossRef]
  6. Yang, X.; Xu, Y.; Shah, T.; Li, H.; Han, Z.; Li, J.; Yan, J. Comparison of SSRs and SNPs in assessment of genetic relatedness in maize. Genetica 2011, 139, 1045–1054. [Google Scholar] [CrossRef]
  7. Gallagher, J.; Lordan, C.; Hughes, G.M.; Jonasson, J.P.; Carlsson, J. Microsatellites obtained using high throughput sequencing and a novel microsatellite genotyping method reveals population genetic structure in Norway Lobster, Nephrops norvegicus. J. Sea Res. 2022, 179, 102139. [Google Scholar] [CrossRef]
  8. Chen, Y.; Xu, C.; Li, Q. Genetic diversity in a genetically improved line of the Pacific oyster Crassostrea gigas with orange shell based on microsatellites and mtDNA data. Aquaculture 2022, 549, 737791. [Google Scholar] [CrossRef]
  9. Amane, Z.; Tazi, L.; Ouagajjou, Y.; Ouazzani, K.C.; Nabich, A.; Chlaida, M. Genetic structuring in the grooved carpet shell clam Ruditapes decussatus along the Moroccan coasts revealed by microsatellites. Reg. Stud. Mar. Sci. 2021, 46, 101888. [Google Scholar] [CrossRef]
  10. Diyie, R.L.; Agyarkwa, S.K.; Armah, E.; Amonoo, N.A.; Owusu-Frimpong, I.; Osei-Atweneboana, M.Y. Genetic variations among different generations and cultured populations of Nile Tilapia (Oreochromis niloticus) in Ghana: Application of microsatellite markers. Aquaculture 2021, 544, 737070. [Google Scholar] [CrossRef]
  11. Wirgin, I.; Maceda, L.; Stabile, J.; Waldman, J. Genetic Population Structure of Summer Flounder Paralichthys dentatus using Microsatellite DNA Analysis. Fish Res. 2022, 250, 106270. [Google Scholar] [CrossRef]
  12. Lu, C.; Sun, Z.; Xu, P.; Na, R.; Lv, W.; Cao, D.; Liu, T.; Zheng, X. Novel microsatellites reveal wild populations genetic variance in pike-perch (Sander lucioperca) in China. Aquac. Rep. 2022, 23, 101031. [Google Scholar] [CrossRef]
  13. Liu, Q.; Li, C.; Li, W.; Gao, R.; Liu, B.; Liu, W.; Yi, G.; Zhang, L.; Li, M.; Su, J. Genetic identification of Chinese shrimp Fenneropenaeus chinensis post-release in Jinzhou Bay: Implications for management of stock enhancement. Reg. Stud. Mar. Sci. 2022, 53, 102425. [Google Scholar] [CrossRef]
  14. Sajeela, K.A.; Gopalakrishnan, A.; Basheer, V.S.; Mandal, A.; Bineesh, K.K.; Grinson, G.; Gopakumar, S.D. New insights from nuclear and mitochondrial markers on the genetic diversity and structure of the Indian white shrimp Fenneropenaeus indicus among the marginal seas in the Indian Ocean. Mol. Phylogenet. Evol. 2019, 136, 53–64. [Google Scholar] [CrossRef]
  15. Du, J.; Hou, C.; Chen, X.; Xiao, J.; Gul, Y.; Wang, H. Morphometric analysis and fluorescent microsatellite markers to evaluate the genetic diversity of five populations of Penaeus japonicus in China. Aquac. Fish. 2022, 7, 321–327. [Google Scholar] [CrossRef]
  16. Wong, L.L.; Chun, L.C.; Deris, Z.M.; Zainudin, A.A.; Ikhwanuddin, M.; Iehata, S.; Rahman, M.M.; Asaduzzaman, M. Genetic diversity and population structure of wild and domesticated black tiger shrimp (Penaeus monodon) broodstocks in the Indo-Pacific regions using consolidated mtDNA and microsatellite markers. Gene Rep. 2021, 23, 101047. [Google Scholar] [CrossRef]
  17. Atencia-Galindo, M.A.; Narvaéz, J.C.; Ramírez, A.; Paramo, J.; Aguire-Pabón, J.C. Genetic structure of the pink shrimp Penaeus (Farfantepenaeus) notialis (Pérez-Farfante, 1967) (Decapoda: Penaeidae) in the Colombian Caribbean. Fish. Res. 2021, 243, 106052. [Google Scholar] [CrossRef]
  18. Ren, S.; Mather, P.B.; Tang, B.; Hurwood, D.A. Levels of genetic diversity and inferred origins of Penaeus vannamei culture resources in China: Implications for the production of a broad synthetic base population for genetic improvement. Aquaculture 2018, 491, 221–231. [Google Scholar] [CrossRef]
  19. Zhang, T.; Kong, J.; Wang, W.; Wang, Q. Genetic variability assessed by microsatellites in the breeding populations of the shrimp Penaeus (Fenneropenaeus) chinensis in China. Aquaculture 2010, 310, 229–233. [Google Scholar] [CrossRef]
  20. Li, X.; Luan, S.; Cao, B.; Luo, K.; Tan, J.; Kong, Z.; Meng, X.; Kong, J. Genetic Background Analysis of Six Groups of White Shrimp Litopenaeus vannamei in China Using SSR Markers. Prog. Fish. Sci. 2020, 41, 103–110. [Google Scholar]
  21. Huang, X.; Xu, Y.; Hu, X.; Xu, W.; Su, H.; Wen, G.; Yang, K.; Cao, Y. Genetic diversity analysis of first filial generation of seven introduced Litopenaeus vannamei populations using microsatellite DNA markers. South China Fish. Sci. 2019, 15, 54–62. [Google Scholar]
  22. Rezaee, S.; Farahmand, H.; Nematollahi, M.A. Genetic diversity status of Pacific white shrimp (Litopenaeus vannamei) using SSR markers in Iran. Aquac. Int. 2016, 24, 479–489. [Google Scholar] [CrossRef]
  23. Meehan, D.; Xu, Z.; Zuniga, G.; Alcivar-Warren, A. High Frequency and Large Number of Polymorphic Microsatellites in Cultured Shrimp, Penaeus (Litopenaeus) vannamei [Crustacea: Decapoda]. Mar. Biotechnol. 2003, 5, 311–330. [Google Scholar] [CrossRef] [PubMed]
  24. Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar] [CrossRef]
  25. Excoffier, L.; Lischer, H.E. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef] [PubMed]
  26. Peakall, R.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef]
  27. Goudet, J. FSTAT (Version 1.2): A computer program to calculate F-statistics. J. Hered. 1995, 86, 485–486. [Google Scholar] [CrossRef]
  28. Piry, S.; Luikart, G.; Cornuet, J.M. BOTTLENECK: A computer program for detecting recent reductions in the effective population size using allele frequency data. J. Hered. 1999, 90, 502–503. [Google Scholar] [CrossRef]
  29. Sbordoni, V.; De Matthaeis, E.; Sbordoni, M.C.; La Rosa, G.; Mattoccia, M. Bottleneck effects and the depression of genetic variability in hatchery stocks of Penaeus japonicus (Crustacea, Decapoda). Aquaculture 1986, 57, 239–251. [Google Scholar] [CrossRef]
  30. Xie, L.; Chen, G.-L.; Ye, F.-L.; Li, Z.-M. Genetic Diversity of Four Selected Stocks of Litopenaeus vannamei as Revealed by SSR Marker. J. Guangdong Ocean Univ. 2009, 29, 5–9. [Google Scholar]
  31. Tang, F.; Wen, B.-N.; Liu, H. Microsatellite genetic diversity in different Litopenaeus vannamei breeding populations. J. South. Agric. 2021, 52, 1108–1115. [Google Scholar]
  32. Lima, A.P.S.; Silva, S.M.B.C.; Oliveira, K.K.C.; Maggioni, R.; Coimbra, M.R.M. Genetics of two marine shrimp hatcheries of the Pacific white shrimp Litopenaeus vannamei (Boone, 1931) in Pernambuco, Brazil. Ciência Rural 2010, 40, 295–301. [Google Scholar] [CrossRef]
  33. Zhang, K.; Wang, W.; Li, W.; Zhang, Q.; Kong, J. Analysis of genetic diversity and differentiation of seven stocks of Litopenaeus vannamei using microsatellite markers. J. Ocean Univ. China 2014, 13, 647–656. [Google Scholar] [CrossRef]
  34. Dixon, T.J.; Coman, G.J.; Arnold, S.J.; Sellars, M.J.; Lyons, R.E.; Dierens, L.; Preston, N.P.; Li, Y. Shifts in genetic diversity during domestication of Black Tiger shrimp, Penaeus monodon, monitored using two multiplexed microsatellite systems. Aquaculture 2008, 283, 1–6. [Google Scholar] [CrossRef]
  35. Dong, D.-J.; Dai, X.-L. SSR analysis on genetic diversity in different populations and generations of Macrobrachium rosenbergii. J. South. Agric. 2020, 51, 421–428. [Google Scholar]
  36. Valles-Jimenez, R.; Cruz, P.; Perez-Enriquez, R. Population genetic structure of Pacific white shrimp (Litopenaeus vannamei) from Mexico to Panama: Microsatellite DNA variation. Mar. Biotechnol. 2004, 6, 475–484. [Google Scholar] [CrossRef]
  37. Tong, X.; Gong, S.; Yu, D.; Du, B.; Huang, G.; Li, L.; Guo, Y.; Li, S. Variation of growth traits at different generations of Pacific white shrimp (Litopenaeus vannamei). South China Fish. Sci. 2007, 3, 30–33. [Google Scholar]
  38. Tong, X.; Gong, S.; Yu, D.; Huang, G.; Du, B.; Li, S. Genetic Diversity of Cultured Pacific white shrimp (Litopenaeus vannamei)Stocks of Different Generations in China. Oceanol. Limnol. Sin. 2009, 40, 215–220. [Google Scholar]
  39. Xu, L.; Li, Q.; Xu, C.; Yu, H.; Kong, L. Genetic diversity and effective population size in successive mass selected generations of black shell strain Pacific oyster (Crassostrea gigas) based on microsatellites and mtDNA data. Aquaculture 2019, 500, 338–346. [Google Scholar] [CrossRef]
  40. Kobayashi, T.; Kijima, A. Effects of Inbreeding Depression in Pacific Abalone Haliotis Discus Hannai. J. Shellfish Res. 2010, 3, 643–649. [Google Scholar] [CrossRef]
  41. Winans, G.A. Genetic variability in Chinook salmon stocks from the Columbia river basin. N. Am. J. Fish. Manag. 1989, 1, 47–52. [Google Scholar] [CrossRef]
  42. Eknath, A.E.; Doyle, R.W. Indirect Selection for Growth And Life-History Traits In Indian Carp Aquaculture. 1. Effects of Broodstock Management. Aquaculture 1985, 49, 73–84. [Google Scholar] [CrossRef]
  43. Mjolnerod, I.B.; Refseth, U.H.; Karlsen, E.; Balstad, T.; Jakobsen, K.S.; Hindar, K. Genetic differences between two wild and one farmed population of Atlantic salmon (Salmo salar) revealed by three classes of genetic markers. Hereditas 1997, 127, 239–248. [Google Scholar] [CrossRef]
  44. Carlsson, J.; Morrison, C.L.; Reece, K.S. Wild and aquaculture populations of the eastern oyster compared using microsatellites. J. Hered. 2006, 97, 595–598. [Google Scholar] [CrossRef] [PubMed]
  45. Yu, Z.; Guo, X. Genetic analysis of selected strains of eastern oyster (Crassostrea virginica Gmelin) using AFLP and microsatellite markers. Mar. Biotechnol. 2004, 6, 575–586. [Google Scholar] [CrossRef] [PubMed]
  46. Appleyard, S.A.; Ward, R.D. Genetic diversity and effective population size in mass selection lines of Pacific oyster (Crassostrea gigas). Aquaculture 2006, 254, 148–159. [Google Scholar] [CrossRef]
  47. An, H.S.; Lee, J.H.; Dong, C.M.; Noh, J.K.; Kim, H.C.; Park, C.J.; Park, K.D.; Min, B.H.; Park, J.W.; Myeong, J.I. New polymorphic microsatellite markers in Pacific abalone Haliotis discus hannai and their application to genetic characterization of wild and aquaculture populations. Genes Genom. 2010, 32, 413–418. [Google Scholar] [CrossRef]
  48. Evans, B.; Bartlett, J.; Sweijd, N.; Cook, P.; Elliott, N.G. Loss of genetic variation at microsatellite loci in hatchery produced abalone in Australia (Haliotis rubra) and South Africa (Haliotis midae). Aquaculture 2004, 233, 109–127. [Google Scholar] [CrossRef]
  49. Li, Q.; Park, C.; Endo, T.; Kijima, A. Loss of genetic variation at microsatellite loci in hatchery strains of the Pacific abalone (Haliotis discus hannai). Aquaculture 2004, 235, 207–222. [Google Scholar] [CrossRef]
  50. Wahlund, S. Zusammensetzung von Populationen and Korrelationserscheinungen von Standpunkt der Vererbungslehre aus betrachtet. Hereditas 1928, 11, 65–106. [Google Scholar] [CrossRef]
  51. Dharmarajan, G.; Beatty, W.S.; Rhodes, O.E. Heterozygote deficiencies caused by a Wahlund effect: Dispelling unfounded expectations. J. Wildl. Manag. 2013, 77, 226–234. [Google Scholar] [CrossRef]
  52. Li, G.; Hedgecock, D. Genetic heterogeneity, detected by PCR-SSCP, among samples of larval Pacific oysters (Crassostrea gigas) supports the hypothesis of large variance in reproductive success. Can. J. Fish. Aquat. Sci. 1998, 55, 1025–1033. [Google Scholar] [CrossRef]
  53. Liu, J.X.; Ely, B. Sibship reconstruction demonstrates the extremely low effective population size of striped bass Morone saxatilis in the Santee-Cooper system, South Carolina, USA. Mol. Ecol. 2009, 18, 4112–4120. [Google Scholar] [CrossRef] [PubMed]
  54. Evans, F.; Matson, S.; Brake, J.; Langdon, C. The effects of inbreeding on performance traits of adult Pacific oysters (Crassostrea gigas). Aquaculture 2004, 230, 89–98. [Google Scholar] [CrossRef]
  55. In, V.-V.; O’Connor, W.; Dove, M.; Knibb, W. Can genetic diversity be maintained across multiple mass selection lines of Sydney rock oyster, Saccostrea glomerata despite loss within each? Aquaculture 2016, 454, 210–216. [Google Scholar] [CrossRef]
  56. Knibb, W.; Whatmore, P.; Lamont, R.; Quinn, J.; Powell, D.; Elizur, A.; Anderson, T.; Remilton, C.; Nguyen, N.H. Can genetic diversity be maintained in long term mass selected populations without pedigree information?—A case study using banana shrimp Fenneropenaeus merguiensis. Aquaculture 2014, 428–429, 71–78. [Google Scholar] [CrossRef]
  57. Lu, X.; Wang, H.; Li, Y.; Liu, B. The impact of selection on population genetic structure in the clam Meretrix petechialis revealed by microsatellite markers. Genetica 2016, 144, 1–8. [Google Scholar] [CrossRef]
  58. Lu, X.; Wang, H.; Liu, B.; Xiang, J. Three EST-SSR markers associated with QTL for the growth of the clam Meretrix meretrix revealed by selective genotyping. Mar. Biotechnol. 2013, 15, 16–25. [Google Scholar] [CrossRef]
Fishes 08 00544 g001
Figure 1. UPGMA tree for the four selected strains of the whiteleg shrimp based on Nei’s genetic distance.
Figure 1. UPGMA tree for the four selected strains of the whiteleg shrimp based on Nei’s genetic distance.
Fishes 08 00544 g001
Table 1. Primer sequences, repeat motifs, and fluorescent labels used for whiteleg shrimp microsatellite loci.
Table 1. Primer sequences, repeat motifs, and fluorescent labels used for whiteleg shrimp microsatellite loci.
LocusForward Primer Fluorescent LabelPrimer Sequence (5′→3′)Ta/°CExpected Size (bp)GenBank Accession No.
TUMXLv10.200FAMF:GCAACAGACATAATGTAGGC
R:AATGCTCGTGCCCTCATC		54105AF359958
TUMXLv7.97HEXF:TGTCGTTAGTGCAGCTCATTC
R:GGGGAGGAATAAGAGGAAAGG		52176AF360057
TUMXLv7.74ROXF:CCTGCGCAATACTGGATATG
R:CGAGGTGTAGTTGTGCTTTGG		54214AF360056
TUMXLv10.207FAMF:GATCACTAGCCATATTTCATCC
R:ATCGCATAATGAGCAAACTGG		5697AF359963
Pvan1815HEXF:GATCATTCGCCCCTCTTTTT
R:ATCTACGGTTCGAGAGCAGA		56126–141AY062925
TUMXLv7.121ROXF:GGCACACTGTTTAGTCCTCG
R:CGAACAGAATGGCAGAGGAG		56242AF360043
TUMXLv10.311FAMF:CATCCACTTCTTCTCGTACCATC
R:TCTCCATCCAGGTTCTGGG		58105AF359988
TUMXLv10.312HEXF:ATACGAAACACCCCATCCC
R:GTGGTCTTACCTCGTGGCTC		58179AF359989
TUMXLv10.284ROXF:TCTTTAAAGGTCAGGTAAAGG
R:CGGCCAGACTCCACAACTAC		58205AF359983
TUMXLv10.291FAMF:CCCTCAAACAGTCGCAGTG
R:GTTGGGTGAGTCTTTAGGCG		58140AF359983
TUMXLv10.255HEXF:CTAAATAAATCACGGGTTGGG
R:CCTTCTGGTTTACTGTTGAGGC		58213AF359977
TUMXLv10.364ROXF:TGAAAGCATTCTGGTAAGGC
R:GAATAAAACAAGGGGTGAGGG		58299AF360000
Table 2. Summary statistics of variation detected in 12 microsatellite loci in four selected strains.
Table 2. Summary statistics of variation detected in 12 microsatellite loci in four selected strains.
StrainLocusNNaNeHoHeFisPIC
20160505TUMXLv10.2073231.4080.2810.2940.0290.256
Pvan181532104.1540.6560.7710.1360.725
TUMXLv7.1213252.4410.5940.600−0.0060.548
TUMXLv10.3123242.9260.6560.6690.0030.600
TUMXLv10.2843252.7230.5000.6430.2100.581
TUMXLv10.2913211.0000.0000.000N/AN/A
TUMXLv10.2553221.9920.9380.506−0.8820.374
TUMXLv10.3643231.5470.1880.3590.4700.309
TUMXLv10.2003251.8650.5940.471−0.2800.423
TUMXLv7.973221.8530.3440.4680.2530.354
TUMXLv7.743221.4380.3130.310−0.0260.258
Mean32.0003.8182.1230.4600.463−0.0090.443
20170505TUMXLv10.2073221.7530.3130.4370.2730.338
Pvan18153284.5010.6560.7900.1560.745
TUMXLv7.1213252.6560.5630.6330.0980.584
TUMXLv10.3123143.6540.8060.738−0.1100.676
TUMXLv10.2843142.6190.6450.628−0.0440.566
TUMXLv10.2913211.0000.0000.000N/AN/A
TUMXLv10.2553222.0001.0000.508−1.0000.375
TUMXLv10.3643231.9790.3440.5020.3050.444
TUMXLv10.2003241.8700.5940.473−0.2760.425
TUMXLv7.973232.1690.3440.5480.3620.447
TUMXLv7.743221.6000.2500.3810.3330.305
Mean31.8183.4552.3460.5010.5130.0100.490
20180505TUMXLv10.2073242.5380.4690.6160.2260.547
Pvan18153273.5680.6250.7310.1320.686
TUMXLv7.1213243.4420.6250.7210.1190.659
TUMXLv10.3123243.5370.7500.729−0.0460.666
TUMXLv10.2843242.3350.5630.5810.0160.516
TUMXLv10.2913251.3800.0940.2800.6600.259
TUMXLv10.2553252.1830.9380.551−0.7300.441
TUMXLv10.3643221.4380.3750.310−0.2310.258
TUMXLv10.2003231.3310.2810.252−0.1320.230
TUMXLv7.973231.7430.4690.433−0.1000.348
TUMXLv7.743221.3980.2810.2890.0120.244
Mean32.0003.9092.2630.4970.499−0.0070.441
20190505TUMXLv10.2073231.8090.5000.454−0.1180.371
Pvan18153284.2230.3130.7750.5910.736
TUMXLv7.1213231.2080.1250.1750.2750.162
TUMXLv10.3123243.3960.6560.7170.0700.651
TUMXLv10.2843262.9940.9380.677−0.4080.617
TUMXLv10.2913241.1360.0630.1220.4780.118
TUMXLv10.2553232.0710.7810.525−0.5110.434
TUMXLv10.3643211.0000.0000.000N/AN/A
TUMXLv10.2003241.5810.4380.374−0.1900.341
TUMXLv7.973252.6220.5940.6280.0400.586
TUMXLv7.743221.9830.5940.503−0.1980.373
Mean32.0003.9092.1840.4550.4500.0030.439
20180808TUMXLv10.2073252.6980.4690.6390.2550.560
Pvan18153274.4910.5940.7900.2360.746
TUMXLv7.1213231.6290.4060.392−0.0520.353
TUMXLv10.3123232.8480.8130.659−0.2520.574
TUMXLv10.2843264.4520.7810.788−0.0080.740
TUMXLv10.2913221.0320.0310.031−0.0160.031
TUMXLv10.2553232.1860.9060.551−0.6710.438
TUMXLv10.3643231.6270.2190.3910.4320.352
TUMXLv10.2003231.1350.1250.121−0.0530.115
TUMXLv7.973261.8530.3130.4680.3210.436
TUMXLv7.743221.9320.5000.490−0.0360.366
Mean32.0003.9092.3530.4690.4840.0140.428
20190808TUMXLv10.2073262.4240.4060.5970.3080.556
Pvan181532147.5570.4690.8810.4600.856
TUMXLv7.1213282.5250.5630.6140.0690.572
TUMXLv10.3123242.7860.7190.651−0.1210.572
TUMXLv10.2843273.6900.8130.741−0.1150.685
TUMXLv10.2913211.0000.0000.000N/AN/A
TUMXLv10.2553242.3950.9060.592−0.5560.495
TUMXLv10.3643231.4150.2810.2980.0420.265
TUMXLv10.2003231.0990.0940.092−0.0380.088
TUMXLv7.973262.4980.4380.6090.2700.554
TUMXLv7.743221.8220.5630.458−0.2470.349
Mean32.0005.2732.6560.4770.5030.0070.499
20180909TUMXLv10.20732.0004.0002.7270.4060.6430.3590.561
Pvan18153274.7190.5630.8010.2860.758
TUMXLv7.1213241.8010.4060.4520.0870.404
TUMXLv10.3123232.8170.6250.6550.0310.570
TUMXLv10.2843264.9110.6250.8090.2150.765
TUMXLv10.2913221.0640.0000.0621.0000.058
TUMXLv10.2553232.1760.8750.549−0.6190.437
TUMXLv10.3643231.3310.0940.2520.6230.230
TUMXLv10.2003241.5950.4380.379−0.1730.353
TUMXLv7.973261.8580.4060.4690.1210.439
TUMXLv7.743221.8530.4690.468−0.0180.354
Mean32.0004.0002.4410.4460.5040.1740.448
20190909TUMXLv10.2073242.4070.5940.594−0.0160.519
Pvan181532116.3800.3440.8570.5920.825
TUMXLv7.1213262.1580.4690.5450.1260.508
TUMXLv10.3123253.0980.6560.6880.0310.618
TUMXLv10.2843263.9690.8440.760−0.1280.706
TUMXLv10.2913221.0320.0310.031−0.0160.031
TUMXLv10.2553242.8440.9060.659−0.3980.581
TUMXLv10.3643221.2050.1880.173−0.1030.156
TUMXLv10.2003241.3390.2810.257−0.1100.242
TUMXLv7.973262.8760.3750.6630.4250.601
TUMXLv7.743232.0500.5000.5200.0240.397
Mean32.0004.8182.6690.4720.5220.0390.471
20171010TUMXLv10.2073241.8300.3130.4610.3110.422
Pvan181532127.4470.5630.8790.3500.851
TUMXLv7.1213262.6060.5940.6260.0360.563
TUMXLv10.3123253.2150.7500.700−0.0890.633
TUMXLv10.2843264.0080.7190.7620.0420.710
TUMXLv10.2913231.9190.1880.4870.6090.401
TUMXLv10.2553232.8170.7190.655−0.1140.570
TUMXLv10.3643231.2100.1880.177−0.0790.166
TUMXLv10.2003151.4530.2900.3170.0680.295
TUMXLv7.973282.6190.4060.6280.3430.597
TUMXLv7.743232.0220.3440.5130.3200.393
Mean31.9095.2732.8310.4610.5640.1630.509
20181010TUMXLv10.2073232.2930.4380.5730.2240.485
Pvan181532104.6550.5310.7980.3230.756
TUMXLv7.1213291.9600.5310.498−0.0850.474
TUMXLv10.3123242.7380.7500.645−0.1820.571
TUMXLv10.2843274.2670.8130.778−0.0610.728
TUMXLv10.2913221.2800.0000.2221.0000.195
TUMXLv10.2553221.9980.9690.507−0.9390.375
TUMXLv10.3643231.6970.1560.4170.6200.357
TUMXLv10.2003241.3390.2190.2570.1350.241
TUMXLv7.973271.8450.3440.4650.2490.431
TUMXLv7.743232.1630.5630.546−0.0460.435
Mean32.0004.9092.3850.4830.5190.1130.459
20191010TUMXLv10.2073232.1070.3130.5340.4050.416
Pvan18153282.9260.3750.6690.4300.616
TUMXLv7.1213241.9580.6560.497−0.3410.435
TUMXLv10.3123243.4650.9060.723−0.2740.660
TUMXLv10.2843253.5430.8750.729−0.2190.668
TUMXLv10.2913221.4380.0000.3101.0000.258
TUMXLv10.2553221.9690.8750.500−0.7780.371
TUMXLv10.3643232.1690.5000.5480.0720.446
TUMXLv10.2003241.5140.4060.345−0.1970.307
TUMXLv7.973242.2580.7810.566−0.4020.470
TUMXLv7.743231.8200.6250.458−0.3870.363
Mean32.0003.8182.2880.5740.534−0.0630.455
Na: number of alleles; Ne: number of effective alleles; Ho: observed heterozygosity; He: expected heterozygosity; PIC: polymorphism information content.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, Z.; Lu, C.; Lin, K.; You, W.; Yang, Z. Genetic Diversity and Genetic Structure among Four Selected Strains of Whiteleg Shrimp (Litopenaeus vannamei) Using SSR Markers. Fishes 2023, 8, 544. https://doi.org/10.3390/fishes8110544

AMA Style

Zhang Z, Lu C, Lin K, You W, Yang Z. Genetic Diversity and Genetic Structure among Four Selected Strains of Whiteleg Shrimp (Litopenaeus vannamei) Using SSR Markers. Fishes. 2023; 8(11):544. https://doi.org/10.3390/fishes8110544

Chicago/Turabian Style

Zhang, Zhe, Chengkuan Lu, Kebing Lin, Weiwei You, and Zhangwu Yang. 2023. "Genetic Diversity and Genetic Structure among Four Selected Strains of Whiteleg Shrimp (Litopenaeus vannamei) Using SSR Markers" Fishes 8, no. 11: 544. https://doi.org/10.3390/fishes8110544

Article Metrics

Back to TopTop