Next Article in Journal
What Do We Need to Do? The Sustainable Development of Chinese Marine Fisheries: A Legal Perspective
Previous Article in Journal
Which Fish Benefit from the Combined Influence of Eutrophication and Warming in the Dnipro River (Ukraine)?
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Moringa oleifera and Azadirachta indica Leaves Enriched Diets Mitigate Chronic Oxyfluorfen Toxicity Induced Immunosuppression through Disruption of Pro/Anti-Inflammatory Gene Pathways, Alteration of Antioxidant Gene Expression, and Histopathological Alteration in Oreochromis niloticus

by
Rowida E. Ibrahim
1,*,
Heba I. Ghamry
2,
Saed Ayidh Althobaiti
3,
Daklallah A. Almalki
4,
Medhat S. Shakweer
5,
Mona A. Hassan
6,
Tarek Khamis
7,8,
Heba M. Abdel-Ghany
9 and
Shaimaa A. A. Ahmed
1,*
1
Department of Aquatic Animal Medicine, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44511, Egypt
2
Department of Home Economics, College of Home Economics, King Khalid University, P.O. Box 960, Abha 61421, Saudi Arabia
3
Biology Department, Turabah University College, Taif University, Al Hawiyah 21995, Saudi Arabia
4
Department of Biology, Faculty of Science and Arts (Qelwah), Albaha University, Al Bahah 65528, Saudi Arabia
5
Department of Internal Medicine, Infectious and Fish Diseases, Mansoura University, El Mansoura 35516, Egypt
6
Department of Forensic Medicine and Toxicology, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44511, Egypt
7
Department of Pharmacology, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44511, Egypt
8
Egypt Laboratory of Biotechnology, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44511, Egypt
9
Department of Pathology, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44511, Egypt
*
Authors to whom correspondence should be addressed.
Fishes 2023, 8(1), 15; https://doi.org/10.3390/fishes8010015
Submission received: 12 November 2022 / Revised: 13 December 2022 / Accepted: 22 December 2022 / Published: 26 December 2022

Abstract

Our goal in this study was to determine the effect of dietary supplementation with Moringa oleifera (M. oleifera), and Azadirachta indica (A. indica) leaves in mitigating the effects of chronic oxyfluorfen (OXY) toxicity on the health status, expressions of immune and antioxidant genes, and tissue morphological alterations in Oreochromis niloticus. In this study, we used 370 healthy O. niloticus (average weight = 25.35 ± 0.29 g). We used 70 fish to study the 96 h lethal concentration 50 (LC50) of OXY. We assigned another 300 fish into six equal groups with five replicates (50 fish/group, 10 fish/replicate) to determine the chronic OXY toxicity for 60 days. The 96 h LC50 of OXY for O. niloticus was 6.685 mg/L. Exposure to 1/10 96 h LC50 of OXY (0.668 mg/L) had health impacts and pathological changes in the main tissues. In addition, the expressions of oxidant and immune genes were disrupted. Dietary supplementation with both M. oleifera and A. indica efficiently mitigated the toxic effects of OXY in the treated groups. Comparing the palliative efficiency of M. oleifera and A. indica, the results showed that M. oleifera was more potent in alleviating the toxic effects of OXY.

1. Introduction

Nile tilapia, Oreochromis niloticus, is an omnivorous fish of the Cichlidae family. It is one of the most cultured food fish in Egypt and worldwide [1,2]. Nonetheless, several challenges have hindered the growth of Nile tilapia aquaculture development, and water pollution represents one of these severe drawbacks [3,4,5,6,7].
The herbicides widely applied in agricultural practices worldwide are the primary source of water pollution, which, in turn, negatively impacts the lives of all aquatic fauna, including fish. Although herbicides produce numerous benefits in enhancing the growth of various crops, their repeated usage is associated with negative impacts on aquatic environments [8,9]. Herbicides produce severe changes that affect the physiological functions of fish tissues and organs. These effects develop as a result of the herbicides inhibiting enzymes vital for fish metabolism, changes in mitochondria electron transport, and increased ROS production, which results in the oxidation of lipids, proteins, and DNA [10]. Moreover, gene expression can be altered by herbicides [11].
Oxyfluorfen (OXY) is a diphenyl ether herbicide that is frequently used worldwide and known for its effectiveness and outstanding herbicidal effects [12]. OXY is widely used in Egypt for a variety of applications, including protecting water resources against some invasive species of plants and suppressing broad-leaf weeds and numerous grasses in economically important crops such as onion, cotton, and soybean [13]. In male CD-1 mice, the major impacts of OXY exposure at a concentration of 800 ppm for 28 days were liver toxicity and anemia symptoms caused by protoporphyrinogen oxidase inactivation leading to the inhibition of heme biosynthesis [14]. Owing to its low water solubility and poor biodegradability, OXY persists in the soil and aquatic bodies [15,16,17]. OXY residues in the soil rapidly enter the groundwater via runoff and accumulate in the aquatic system and in the soil. It has a half-life of 72 to 150 days [18,19]. OXY has long-lasting residues in the environment and poses a bioaccumulation risk in largescale suckers (Catostomus macrocheilus) [20]. Researchers found OXY residue levels in water and sediment of approximately 0.04 μg/mL and 4.0 μg/g, respectively, from container plant nurseries in England [21]. OXY residues were also detected in the cucumber plant at approximately 9.50 mg/kg in Khartoum State, Sudan [22]. OXY was found in soil samples from the Eastern Nile Delta in Egypt at a concentration of 0.046 mg/kg [23].
Moringa (Moringa oleifera, M. oleifera) is known as a miracle tree: its leaves have a high nutritional value, being high in lipids, fiber, proteins, vitamins, and minerals [24,25]. Moringa leaves have different pharmacological actions (antibacterial, antioxidant, antifungal, anti-inflammatory, antidiabetic, and anticancer effects) because it contains bioactive constituents such as phenolic acid and flavonoids [5,26,27].
Neem (Azadirachta indica, A. indica) is a large evergreen tree with scented leaves and flavorful fruits. It has been extensively used for numerous applications as a result of its anti-inflammation, immunological, and antiulcer properties [28,29,30]. Furthermore, every portion of the A. indica tree has a broad spectrum of antifungal, antibacterial, antiviral, and antioxidant capabilities [31]. Consequently, our aim in this study was to explore the influences of M. oleifera and A. indica leaves on growth retardation; hematological, biochemical, and immunological disorders; tissue morphology; and immune/oxidant gene disruptions caused by chronic OXY exposure in O. niloticus.

2. Materials and Methods

2.1. Ethical Approval

The experimental procedure was approved by the Zagazig University animal care and use committee with approval number ZU-IACUC/2/F/135/2022.

2.2. Preparation of M. oleifera and A. indica Leaf Powder and Phytochemical Screening

We obtained fresh M. oleifera leaves from the Egyptian Scientific Society of Moringa, National Research Center, Egypt. We obtained fresh leaves of A. indica from El Mashreq Company, Cairo, Egypt. We cut the leaves into small pieces and allowed them to air dry at room temperature before being milled into a coarse powder using a high-speed milling machine. We packaged one part of this leaf powder in an airtight plastic package, which we used for phytochemical screening. We stored the other part in a refrigerator for the preparation of the experimental diets. We qualitatively assessed the phytochemical components (flavonoids, saponins, phenols, terpenes, steroids, alkaloids, cardiac glycosides, tannins, and resins) of the M. oleifera and A. indica leaves following the approach developed by Trease and Evans [32].

2.3. Determination of Plant Inclusion Levels and Diet Preparation

We conducted a preliminary study (unpublished data) to determine the optimal inclusion level of each plant to mitigate the effects of herbicide toxicity. We fed different dietary supplementation levels of M. oleifera (0%, 3%, 6%, 9%, 12%, and 15% inclusion levels) and A. indica (0%, 0.5%, 1%, 1.5%, and 2%, 2.5%) to Nile tilapia fish (23.55 ± 1.5) for 60 days. We assessed behavioral responses, growth metrics, hepato-renal functions, and hematological profiles. We found that 3% and 6% M. oleifera supplementation and 0.5% and 1% A. indica supplementation did not affect fish behavior, growth metrics, hepato-renal functions, or hematological profiles (Supplementary Table S1).
We prepared five experimental diets (Table 1); the control diet was a basal diet. In the N1 and N2 diets, we supplemented the basal diet with 0.5% and 1% A. indica leaf powder, respectively. For the M1 and M2 diets, we supplemented the basal diet with 3% and 6% M. oleifera leaf powder, respectively. We dried the pellets for 24 h at 65 °C in a drying oven, which we then stored in plastic bags in a refrigerator until use.

2.4. Fish and Rearing Conditions

We purchased 370 Nile tilapia (O. niloticus) (25.35 ± 0.29 g) from private El-Abbassa fish farms in Sharkia, Egypt, which we transported to the Department of Aquatic Animal Medicine laboratory at Zagazig University’s Faculty of Veterinary Medicine. The fish did not exhibit any clinical abnormalities or history of illness outbreaks. Before the experiment began, we thoroughly examined the fish to ensure their health in accordance with the Canadian Council on Animal Care [35]. We raised the fish in glass aquaria (80 × 60 × 30 cm) filled with 100 L of dechlorinated tap water, and we fed them a basal diet for 2 weeks. We evaluated water quality parameters on a daily basis, which we established within the optimal limits; temperature: 25 ± 1.2 °C, dissolved oxygen: 6.7 ± 0.55 mg L−1, pH: 6.9 ± 0.2 and ammonia: 0.024 ± 0.01 mg L−1, according to APHA [36], with a controlled photoperiod (12 h light: 12 h dark).

2.5. Experimental Design

2.5.1. Acute Toxicity Evaluation (96 h LC50 Determination)

We allotted 70 O. niloticus into seven groups (10 fish/ group). We maintained the control group in clean, dechlorinated tap water for 96 h, and we exposed the other six groups to six different levels of OXY (Chem. Service, West Chester, PA, USA) (4, 5, 6, 7, 8, and 9 mg/L). We did not feed the fish during the experiment, and we did not exchange the water (96 h). We documented mortalities at 24, 48, 72, and 96 h with the direct removal of the dead fish. We used Environmental Protection Agency (EPA) probit analysis software, version 1.5 (EPA, 1999), to determine the 96 h LC50 value and 95% confidence bounds using Finney’s probit analysis [37].

2.5.2. Chronic Toxicity Exposure

We randomly allotted 300 fish into six groups in five replicates (10 fish/replicate; 50 fish/group). We kept Group 1 (C) as a control group (reared in clean water and fed a basal diet). We exposed Group 2 (C-OXY) to 1/10 of the 96 h LC50 of OXY (0.668 mg/L) and fed them the basal diet. We fed Groups 3 (M1-OXY) and 4 (M2-OXY) the basal diet fortified with 3% and 6% M. oleifera leaves, respectively, and exposed the fish to 1/10 of the 96 h LC50 of OXY. We fed Groups 5 (N1-OXY) and 6 (N2-OXY) the basal diet fortified with 0.5% and 1% A. indica leaves, respectively, and exposed the fish to 1/10 of the 96 h LC50 OXY. We fed the fish twice daily (8 a.m. and 2 p.m.) until apparent satiation. We inspected the fish on a daily basis to record clinical signs and behavior abnormalities throughout the experiment (60 days).

2.6. Growth Performance Analysis

At the start and end of the experiment (60 days), we weighed the fish in each group to determine their initial body weight (IBW) and final body weight (FBW). We determined the growth performance parameters [38,39]. We used the difference between the FBW and IBW to compute fish weight gain (WG). We calculated the feed conversion ratio (FCR) = total feed intake (g)/total gain (g), and the specific growth rate (SGR) (% day−1) = 100 × (ln FBW − ln IBW)/duration/day. We calculated survivability = (number of fish in each group left after 60 days feeding period/initial number of fish)/100.

2.7. Sample Collection

At the end of the experimental trial (60 days), we obtained blood samples (3 samples/replicate; 9 samples/group) by bricking the caudal vessels without anticoagulant. We obtained the serum by centrifugation at 3000 rpm for 15 min to evaluate the serum immunological and biochemical parameters. We took additional blood samples using an anticoagulant (EDTA) to determine the hematological indices and the phagocytic activity. Afterward, we obtained tissue samples from euthanized fish following the Guidelines for the Use of Fishes in Research [40]. We collected and stored liver samples (for determination of the hepatic antioxidant activity) and brain tissue (for AChE determination) at −20 °C. We obtained liver, kidney, and spleen samples (for histopathological examination), which we preserved in 10% neutral buffered formalin; we collected head kidney samples (for gene expression analysis) as 50 mg of tissue in 1 mL Quiazol (Qiagen, Hilden, Germany), which we stored at −80 °C for total RNA extraction.

2.8. Hematological Analysis

We used an automatic cell counter (HospitexHema screen 18, Sesto Fiorentino city, Italy) to estimate the erythrocytes count, hemoglobin (Hb) concentration, packed cell volume (PCV) value, as well as total and differential leukocytic counts, according to the protocol of Dacie and Lewis [41].

2.9. Analysis of Immune Indices

We assayed immunoglobulin M (IgM, catalog no. CSB-E12045Fh) and complement 3 (C3, catalog no. MBS281020) using their kits from Cusabio Co. (Houston city, TX, USA) and MyBioSource Co. (San Diego, CA, USA), respectively, based on the instructions provided by the manufacturer. We evaluated serum lysozyme activity following Ghareghanipoor et al. [42], based on the lysis of Micrococcus lysodeikticus (Sigma Co., MO, USA), with some modifications. At 25 °C for 5 min, we mixed the serum and the M. lysodeikticus suspension (0.2 mg/mL in 0.05 M PBS, pH 6.2). We measured the optical density at 540 nm for 5 min in 1-min intervals (5010, Photometer, BM Co. Berlin city, Germany). We constructed a calibration curve using several dilutions of lyophilized chicken egg-white lysozyme (Sigma Co., MO, USA) to determine the serum lysozyme content. We assayed leukocytes for their phagocytic activity following the protocol of Cai et al. [43], and we calculated the phagocytic percentage.

2.10. Serum Biochemical Assays

We spectrophotometrically measured the serum activities of alanine aminotransferase (ALT, catalog no. MBS038444) and aspartate aminotransferase (AST, catalog no. EK12276) (Biotrend Co., MD, USA) following the standard manufacturer’s protocol using a spectrophotometer (Lambda EZ201; Perkin Elmer). Moreover, we estimated creatinine levels according to Fossati et al. [44], and we assessed acetylcholinesterase (AchE) activity in brain tissue using a commercial ELISA kit (My-Biosource Inc., San Diego, CA, USA).

2.11. Hepatic Antioxidant Biomarkers

We collected liver homogenate samples (9 samples/group) to spectrophotometrically evaluate the activities of MDA, GPx, SOD, and TAC using commercial kits (Bio diagnostics company, Cairo, Egypt). We measured the hepatic levels of malondialdehyde (MDA, catalog no. MD 25 29), glutathione peroxidase GPx (catalog no. GP 2524), superoxide dismutase (SOD, catalog no. SD 2521), and serum total antioxidant capacity (TAC catalog no. TA 2513); we determined the serum nitric oxide (NO) according to Bryan and Grisham [45].

2.12. Gene Expression Analysis in Head Kidney Tissue Using Quantitative Real-Time PCR

We used quantitative real-time polymerase chain reaction (qRT-PCR) to estimate the expression of the antioxidant/immune genes and inflammatory cytokines in the head kidney samples from all fish groups (9 samples /group). We ground the tissue with liquid nitrogen, and we extracted the RNA with Trizol (Invitrogen; Thermo Fisher Scientific, Inc.). We synthesized cDNA using a HiSenScript™ RH (-) cDNA Synthesis Kit (iNtRON Biotechnology Co., Switzerland, Republic of Korea) following the protocol of Khamis et al. [46]. We performed real-time RT-PCR with an Mx3005 P Real-Time PCR System (Agilent Stratagene, USA) using TOPreal™ qPCR 2X PreMIX (SYBR Green with low ROX) following the instructions of the manufacturer for gene expression analysis. The PCR cycling conditions were as follows: a primary denaturation at 95 °C for 15 min, denaturation for 40 series at 95 °C for 30 s, annealing at 60 °C for 60 s, and extension at 72 °C for 60 s. To assess the specificity of qPCR products, the melting curve was examined at 65–95 °C in 0.1 °C increments per second. We ran the samples in duplicates; we included nontemplate controls (NTC) (RNAse free water only) and RT negative controls (RT) in each qPCR run (RT-). We purchased the specific primers of superoxide dismutase (SOD), glutathione peroxidase (GPx), glutathione synthetase (GSS), tumor necrosis factor-alpha (TNF-α), transforming growth factor beta (TGF-β), interleukin 1 beta (IL-1β), interleukin 10 (IL-10), interleukin 6 (IL-6), interleukin 8 (IL-8), glutathione synthetase (GSS), Toll-like receptor-2 (TRL-2), and Toll-like receptor-7 (TRL-7) from Sangon Biotech (Beijing, China), as described in Table 2. We calculated the relative fold changes in gene expression using the 2−ΔΔCT comparative technique [47], with the target gene expressions adjusted to that of β actin.

2.13. Histopathological Study

We fixed the collected samples from the liver, kidney, and spleen (9 samples/group) in 10% neutral buffer formalin, followed by dehydration in ascending grades of alcohol, which we then cleared in xylene and finally embedded in melted paraffin wax. We used Microtome (Leica®) to obtain paraffin sections (5 μm), which we then stained with hematoxylin and eosin to prepare the sections for microscopic examination [48].

2.14. Statistical Analysis

We checked the normality of the data using the Shapiro–Wilk test; we checked the homogeneity of variance components between the experimental treatments using Levene’s test. We used one-way ANOVA and Tukey’s comparison post hoc tests for examining significant variation and comparing the various fish groups with SPSS 21 software. The data are presented as a mean ± standard error (SE), and we considered p ˂ 0.05 as significant. We used Environmental Protection Agency (EPA) probit analysis software, version 1.5 (EPA, 1999), to determine the 96 h LC50 value and 95% confidence bounds using Finney’s probit analysis.

3. Results

3.1. Results of Phytochemical Screening of M. oleifera and A. indica Leaves

Table 3 shows the results of the phytochemical screening of M. oleifera and A. indica leaves. We found that flavonoids, phenols, and cardiac glycosides were present in M. oleifera in medium amounts; saponins, terpenes, steroids, alkaloids, and tannins were present in low amounts. We found that saponins, terpenes, and steroids were present in A. indica in high concentrations; cardiac glycosides and tannins were present in medium concentrations; and flavonoids, phenols, and alkaloids were present in low concentrations.

3.2. Evaluation of 96 h LC50

No mortality occurred in the control group; the mortality rate was concentration-dependently higher in the fish exposed to various concentrations of OXY. We noticed several alterations in fish feeding activity and swimming movement among the O. niloticus exposed to different OXY concentrations for 96 h. These behavioral alterations included decreased feed intake (anorexia), decreased swimming movement, and depression. The mean 96 h LC50 OXY for O. niloticus was 6.685 mg/L, with lower and upper confidence limits of 6.097 and 7.301 mg/L, respectively.

3.3. Clinical Signs, Post-Mortem Picture, and Survivability of O. niloticus after Chronic OXY Exposure

From our general inspection of the fish while in water, we found that fish after chronic OXY exposure were lethargic, with variable degrees of inactivity and loss of response to external stimuli (such as knocking on the sides of the aquarium, vigorous agitation, and intense illumination of the water). The response to external stimuli remarkably declined in the O. niloticus exposed to the herbicide that received no treatment (C-OXY) compared with fish in the control group (C), which were alert and demonstrated a strong escape reflex. The O. niloticus in the moringa-treated groups (M1-OXY and M2-OXY) actively responded to the external stimuli, whereas those in the A. indica-treated groups (N1-OXY and N2-OXY) exhibited a moderate escape reflex. The clinical examination of fish outside the water showed that fish in the C-OXY group was the most affected by OXY toxicity, showing severe cutaneous lesions in the form of erythematous skin and hemorrhage on the operculum at the base of the fins. Profuse slime secretion and severe fin rot were also evident. The other exposed groups showed less-pronounced clinical signs, exhibiting mild fin rot and skin erythema. Necropsy of the sacrificed or freshly dead fish revealed enlarged internal organs (liver, kidney, and spleen) with gall bladder distention in the C- OXY group. In contrast, the groups fed M. oleifera and A. indica leaves recovered from the previous lesions. As highlighted in Table 4, survivability was 100% in the O. niloticus in the control group (C). Survivability was 65% in M2-OXY, 52% in M1-OXY, 49% in N2-OXY, 41% in N1-OXY, and 36% in C-OXY.

3.4. Growth Metrics

As shown in Table 4, the FBW, WG, FI, and SGR% significantly (p < 0.05) decreased with increasing FCR value in the C-OXY group relative to the control group. FBW, WG, FI, and SGR% (p < 0.05) significantly increased in the M2-OXY, M1-OXY, N2-OXY, and N1-OXY groups with increasing FCR values compared with those of the C-OXY group.

3.5. Assessment of Hematological Indices

We recorded significant declines (p < 0.05) in RBC counts, Hb concentrations, and PCV% in the C-OXY group compared with the control group (C). RBC counts, Hb concentrations, and PCV% significantly increased (p < 0.05) in the M2-OXY group, followed by the M1-OXY group, then N2-OXY and N1-OXY groups, respectively, compared with the C-OXY group. MCV, MCH, and MCHC values were not significantly affected (p > 0.05) by chronic OXY exposure (Table 5). We found a significant reduction (p < 0.05) in WBC counts, lymphocytes, heterophile, monocytes, and eosinophils in the C-OXY group in comparison with the control group. However, the leukogram was notably elevated in the exposed treated fish groups that were fed M. oleifera (M2-OXY followed by M1-OXY groups) then A. indica leaves powder (N2-OXY followed by N1-OXY groups) compared with the C-OXY group (Table 5).

3.6. Immune Status Indicators

We noted a significant decline (p < 0.05) in the levels of serum IgM, complement 3, lysozyme, and phagocytic percent activity in the C-OXY group compared with the control group (C) (Table 6). The immunological parameters were remarkably increased (p < 0.05) in M. oleifera-supplemented groups (M2-OXY followed by M1-OXY groups) and in the A. indica supplemented groups (N2-OXY followed by N1-OXY groups), respectively, compared with the C-OXY group.

3.7. Assessment of Some Biochemical Parameters

As shown in Table 7, the levels of hepato-renal function indicators (ALT, AST, and creatinine) significantly increased (p < 0.05) in the C-OXY group compared with those of fish in the control group (C). However, we observed a significant decline in those hepato-renal biomarkers (p < 0.05) noticed among fish in the M2-OXY, M1-OXY, N2-OXY, and N1-OXY groups, respectively, compared with those of the C-OXY group. As shown in Table 7, we found a lower AchE level in the C-OXY group than in the control group. Compared with the C-OXY group, in the M2-OXY followed by the M1-OXY group, A. indica supplemented diets (N2-OXY followed by N1-OXY groups) significantly increased (p < 0.05), the AChE level compared with that the control group.

3.8. Lipid Peroxidation and Oxidative Stress Biomarkers

As depicted in Table 7, we noted a higher hepatic content of the lipid peroxidation marker (MDA), as well as lower levels of antioxidant indicators (SOD, GPx, TAC, and NO) (p < 0.05) in the C-OXY group than in the control group (C). However, a concentration-dependent rise in SOD, GPx, TAC, and NO levels and a decrease in the MDA level was evident in M2-OXY, M1-OXY, N2-OXY, and N1-OXY groups, respectively.

3.9. Antioxidant/Immunity Gene Expression Analysis

In comparison with the control group, the expressions of antioxidant genes (SOD, GPx, and GSS) in the C-OXY group were significantly downregulated (p < 0.05) (Figure 1A–C, respectively), as were those of the anti-inflammatory cytokines (IL-10, and TGF-β) (Figure 1D,E, respectively). We noted upregulation of the expressions of inflammatory cytokines genes (Il-1β, IL-6, and IL-8) (Figure 2A–C, respectively), as well as of TNF-α, TRL-2, TRL-7, and cc-chemokine gene expressions (Figure 2D–G, respectively). Dietary supplementation with M. oleifera and A. indica leaf powder modulated the expressions of all studied genes. In the M2-OXY, M1-OXY, N2-OXY, and N1-OXY groups, the expressions of the antioxidants and anti-inflammatory gene were upregulated, and those of the inflammatory cytokine genes TNF-α, TRL-2, TRL-7, and cc-chemokine were downregulated in comparison with those of the C-OXY group.

3.10. Histopathological Findings

The histopathological findings of the control group showed that the histological structures of the hepatocytes and hepatopancreas were normal (Figure 3A), tubular and glomerular structures were normal (Figure 4A), and the histology of the white and red pulps was normal as well (Figure 5A). The C-OXY group showed focal areas of necrosis and hydropic degenerations within a large number of hepatocytes; the hepatopancreas showed apoptotic changes with melanomacrophage aggregates (Figure 3B), necrotic tubular epithelium in a large number of renal tubules (Figure 4B), a high density of melanomacrophages with hemosiderosis, and edema admixed with inflammatory cells between red and white pulps (Figure 5B). In the M1-OXY group, we observed hydropic degeneration in a moderate number of hepatic parenchyma and dilated portal veins (Figure 3C), some atrophic glomerular tufts, focal tubular necrosis (Figure 4C), and normal white and red pulps with melanomacrophage centers (Figure 5C). For the M2-OXY group, we found normal hepatic cells with vacuolations and normal histomorphological structures of the pancreatic acini (Figure 3D), normal epithelial lining tubules, and normal glomerular corpuscles in most renal tissue. However, other tubules revealed epithelial vacuolations (Figure 4D) and apparently normal cytoarchitecture of the red and white pulp around the ellipsoid arterioles with a reticular network and low-density melanomacrophage centers (Figure 5D). For the N1-OXY group, we observed cytoplasmic vacuolations, the hepatopancreas showed a normal acinar epithelium (Figure 3E), and normal histomorphology of the tubules and glomeruli. We noted necrotic changes in a few tubules (Figure 4E) and prominent melanomacrophage centers with apparently normal red and white pulps (Figure 5E). The N2-OXY group had relatively normal hepatocytes and hepatopancreas (Figure 3F), regenerative tubules, apparently normal glomerular corpuscles and renal tubules (Figure 4F), and preserved aggregations of lymphocytes, monocytes, and red blood cells within reticular fibers beside the melanomacrophage centers (Figure 5F).

4. Discussion

Our aim in this study was to determine the curative role of the M. oleifera and A. indica leaf powder in ameliorating the negative impacts of a widely used herbicide, OXY, on the hematological parameters, immune response, hepato-renal function, oxidative stress, certain gene expression, AChE level, and histopathological alterations in exposed O. niloticus. We used two concentrations of each leaf powder from each plant against 1/10 of LC50 of OXY. Our findings revealed that the 96 h LC50 of OXY in O. niloticus was 6.685 mg/L. Similar results were obtained by Banhawy et al. [49], who documented that the 96 h LC50 of OXY in Nile tilapia (O. niloticus) was 3 mg/L. Another study was conducted by Abd El-Rahman et al. [50], who found that the 96 h LC50 of OXY in C. gariepinus was 11.698 mg/L.
Chronic exposure to OXY significantly lowered the growth metrics (FBW, WG, FI, and SGR %) in the study fish; these results could be related to the toxic-stress-induced reduction in the feed intake, which was observed in the OXY-exposed groups. Similar results were recorded in O. niloticus after exposure to pyrethroids and/or carbamates [51]. Fortifying the diets of OXY-exposed fish with M. oleifera and A. indica leaves modulated their growth performance and improved the FCR, especially the supplementation of M. oleifera leaves in the diets at both levels, followed by 1% and 0.5% A. indica supplemented diet. A similar conclusion was reported by Ibrahim et al. [5], who found that M. oleifera leaves recovered the reduction in the growth of O. niloticus that had been exposed to chlorpyrifos. In addition, Kaur et al. [28] reported that the dietary incorporation of A. indica leaf extracts increased the feeding efficiency, growth, and survival of Cyprinus carpio.
The use of hematological indicators as a tool for assessing the hazardous impacts of numerous xenobiotics has become necessary [5]. Chronic exposure to OXY negatively affected the erythrogram of O. niloticus, as evidenced by the significant decline in RBC counts, Hb, and PCV%. The negatively affected erythrogram could be attributed to the increase in the erythrocyte destruction rate due to the stress condition produced by chronic OXY exposure, which accelerated the peroxidation of unsaturated fatty acids of the RBC membranes [51]. In this study, the erythrogram of fish chronically exposed to OXY changed with M. oleifera, and A. indica leaves dietary supplementation. This could be attributed to the numerous amino acids, trace elements, vitamins, minerals (including copper, iron, zinc, and selenium), and biochemical constituents of M. oleifera (such as flavonoids and saponins) [52]. The contents of multiple vitamins (including B12, B6, E, and C), as well as riboflavin, which are all important, are high in M. oleifera leaves; both the synthesis of DNA and the ultimate maturation of erythrocytes require vitamin B12 and folic acid [53]. Furthermore, the amino acid content in M. oleifera is critical for synthesizing hemoglobin [54]. M. oleifera also contains iron, a trace element, and is used in the formation of hemoglobin. In addition, M. oleifera was found to protect and stabilize the RBC membrane [55]. Many alkaloids, such as salanin, azadirachtin, and nimbitin, are abundant in A. indica; these alkaloids possess hematopoietic qualities. Several additional components found in A. indica leaves are responsible for increasing hemoglobin levels and enhancing red blood cell formation [56]. In addition, A. indica leaves are rich in biologically active compounds such as saponins, alkaloids, tannins, flavonoids, glycosides, reducing sugars, vitamins, and micronutrients [57].
WBCs are essential components of the immune system, and they are influenced by several physiological and environmental variables [58]. Variations in the WBC profile reflect how fish react to the stress reactions caused by different toxins [59]. In this study, we noted a marked reduction in all leukocyte cells (including leukopenia, lymphopenia, monocytopenia, and eosinopenia) with chronic OXY exposure, which indicated immunosuppression in the exposed the O. niloticus. These findings could be correlated with the liver damage associated with chronic OXY exposure, which is evident by higher hepatic enzymes and altered hepatic tissue. Hepatic injury can impair bone marrow, lowering the number of leukocytes. Similar results were obtained by Abd El-Rahman et al. [50] in C. gariepinus. The modulation of the leukogram of the OXY-exposed fish by dietary supplementation with M. oleifera and A. indica leaves could be attributed to M. oleifera’s micronutrient concentrations, which play a crucial role in adjusting the redox state of leukocytes, protecting them from oxidative stress [53,54,55,56,57]. Furthermore, oleic acid, the main constituent of M. oleifera, has the ability to affect the generation of reactive oxygen species (ROS) in leukocytes, particularly neutrophils [60]. In addition, A. indica was reported to boost RBC, WBC, and lymphocyte counts, enhancing the immune response of the fish against the majority of pathogenic diseases [29].
Lysozyme is a critical biomarker of fish toxicity because it is a powerful defensive tool for the innate immune response [61,62,63]. A crucial component, complement 3 has a variety of immunological functions, including mediating the inflammatory response and destroying invading microorganisms. Furthermore, essential antibodies are a component of the humoral immune response, IgM, considered the most important antibody in fish [64,65]. Our results showed a notable reduction in the immune response (lysozyme level, C3, IgM, and phagocytic percent) and survivability in fish exposed to OXY for 60 days. Feeding a diet supplemented with M. oleifera and A. indica to OXY-exposed fish noticeably improved their immune functions and increased their survivability, implying an enhanced immune response and proving the immunostimulatory effect of M. oleifera and A. indica leaves. The modulation of these immune parameters could be attributed to the high concentration of monounsaturated fatty acids (MUFAS), particularly oleic acid and saturated fatty acids (SFAS), mainly palmitic and stearic acids in M. oleifera, which contribute to cell membrane modifications [66]. Vitamins A, K, and C were also found in M. oleifera; these vitamins improve immunoglobulin synthesis, boosting the immune response [67]. Additionally, the amino acids found in M. oleifera leaves are required to produce immunoglobulin [68] and enhanced immune parameters following dietary supplementation with A. indica leaves owing to the presence of bioactive chemicals and its immune-stimulating broad-spectrum effect, which has various biological activities [69]. A. indica is known for boosting immunity, particularly cell-mediated and humoral immunity; boosting antibody formation, particularly IgM; and stimulating lymphocytes and macrophages through cell-mediated pathways [56]. Talpur and Ikhwanuddin [30] reported that the dietary A. indica leaf extract improved the immune functions of Asian sea bass fingerlings (Lates calcarifer) by improving the WBC phagocytic activity, boosting the immunological parameters and survivability.
We assessed immunotoxicity in the head kidney (as a main immune organ) of O. niloticus to examine the immunotoxicity effect of chronic OXY exposure on the immune-related expression of genes, including IL-1β, IL-6, IL-8, IL-10, TNF-α, TGF-β, TLR-2, TLR-7, and cc-chemokine, which are involved in the immune defense of fish [70,71]. Inflammatory cytokines, such as TNF-α, IL-1β, IL-6, and IL-8, are released during inflammation [71]. TGF-β and IL-10 are anti-inflammatory cytokines that suppress inflammation in fish [72].
cc-chemokine (CC) is an important immune modulator that modulates immunological responses and stimulates leukocyte recruitment and differentiation [73]. TLRs are innate immune receptors for detecting pathogens and play a crucial role in coordinating the adaptive immune response [74]. Chronic OXY exposure down-regulated the levels of anti-inflammatory cytokines (TGF-β and IL-10) and up-regulated the levels of inflammatory cytokines (TNF-α, IL-1β, IL-6, and IL-8), cc-chemokine, TRL-2, and TRL-7 in head kidney tissue. Immune-related gene expressions are down-regulated in O. niloticus due to imidacloprid toxicity [75] and pyrethroids and/or carbamates [76]. Abdel-Rahman et al. [77] reported that the dietary supplementation of herbs could modulate immune gene expression; in our study, the modulation of the immune-related gene expression due to M. oleifera and A. indica dietary supplementation could have been correlated with the immune-stimulatory effect of both M. oleifera and A. indica discussed above and the ameliorative impact of both plants against OXY toxicity, which, in turn, modulated the fish physiology.
In this study, chronic OXY exposure elevated the hepato-renal functions (ALT, AST, and creatinine levels); these deteriorations in biochemical biomarkers were supported by various hepatic and renal lesions. These consequences could be attributed to exposure to OXY, which can accumulate in the liver. As a result of their high pro-oxidative impacts, hepatic membranes may lose their functional integrity and permeability, resulting in hepatic enzyme leakage into the bloodstream and abnormal liver function [14]. Additionally, renal tissue is negatively affected by chronic OXY exposure expressing various pathological lesions; this explains the increase in the creatinine level in the fish blood. Similar results were obtained by Abd El-Rahman [50] in C. gariepinus exposed to OXY. The modulation of hepatorenal function as a result of dietary supplementation with M. oleifera and A. indica could be attributed to the active components of M. oleifera, which stabilize the cell membrane and prevent enzyme leakage, as well as the hepatoprotective effect of the major components of M. oleifera (quercetin and kaempferol) [78]. Because of its numerous bioactive components, A. indica is responsible for boosting liver function. The presence of rutin and quercetin, which are important for reducing necrosis in liver cells, is primarily accountable for the hepatoprotective function. Another bioactive component found in A. indica leaves azadirachtin-A, which reduces necrosis in hepatic cells and, as a result, restores normal liver function [56].
In this study, chronic OXY exposure reduced the levels of AChE; a marked decline in brain AChE levels was observed in Gambusia afnis, O. niloticus [79], and C. gariepinus [50] after exposure to sublethal OXY doses. In this study, OXY-exposed fish suffered inactivity and reduced swimming behavior; this could be attributed to the inhibition of the AChE enzyme [80]. According to Hassanein [79], OXY inactivates AChE by producing an irreversible enzyme-inhibitor complex, similar to organophosphorus insecticides [81], or by impairing AChE resynthesis [82]. The AChE level was restored in OXY-exposed fish as a result of dietary M. oleifera and A. indica leaves supplementation, which could be attributed to the potential of these natural antioxidant dietary supplements to mitigate the oxidative stress related to OXY exposure [56,83].
When cells are exposed to a toxicant in the environment, they create a large number of antioxidant enzymes to protect themselves from the harm caused by ROS [84]. MDA is the end product of the lipid peroxidation of PUFAS [85]. In this study, chronic OXY exposure significantly lowered the level of antioxidant enzymes (SOD, GPX, TAC, and NO) and elevated the MDA level. Such oxidative stress was reported by Abd El-Rahman [50] in C. gariepinus experiencing OXY toxicity. Herein, oxidative stress caused by chronic OXY exposure could be attributed to several pathological impacts on the hepatic, renal, and splenic tissue, as well as to the downregulation of the expression of antioxidant genes, including SOD, GPX, and GSS. Dietary incorporation of M. oleifera and A. indica leaves considerably improved antioxidant enzyme levels and decreased MDA contents of OXY-exposed fish, with accompanying up-regulation of the expression of antioxidant genes in the head kidney tissue in the same groups. These findings could be attributed to the antioxidant components of M. oleifera, such as vitamin C, β-carotene, α- and γ-tocopherol, β-sitosterol, and vitamin A, as well as phenolic components, such as quercetin, kaempferol, flavonoids, and anthocyanins [85]. Furthermore, the abundance of vitamin C in M. oleifera leaves gives it the ability to relieve the oxidative stress caused by the antioxidant effects arising from its ability to form poorly ionized but soluble complexes with harmful metals and metalloids [86]. Similarly, A. indica leaves are high in antioxidants, which can help avoid oxidative stress by lowering lipid peroxidation and boosting the body’s antioxidant status [56].

5. Conclusions

Our data suggested that OXY exposure resulted in growth retardation, behavioral abnormalities, hematological dysfunction, hepato-renal toxicity, oxidative stress, and the downregulation of antioxidant and immune genes in O. niloticus. Enriching fish diets with either M. oleifera or A. indica leaves modulated and mitigated the impacts of oxyfluorfen toxicity. M. oleifera, especially at a 6% supplementation level, achieved the best results. So, we recommend including both plants in fish diets to mitigate oxyfluorfen toxicity, especially 6% M. oleifera leaf powder.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/fishes8010015/s1, Table S1: Effects of dietary supplementation with M. oleifera and A. indica on behavior response, growth performance, hepato-renal functions, and hematological profile.

Author Contributions

Conceptualization, R.E.I., H.I.G., S.A.A., D.A.A., S.A.A.A., M.S.S., M.A.H., H.M.A.-G. and T.K.; methodology, R.E.I., H.I.G., S.A.A., D.A.A., S.A.A.A., M.S.S., M.A.H., H.M.A.-G. and T.K.; formal analysis, R.E.I., H.I.G., S.A.A., D.A.A., S.A.A.A., M.S.S., M.A.H., H.M.A.-G. and T.K.; investigation, R.E.I., H.I.G., S.A.A., D.A.A., S.A.A.A., M.S.S., M.A.H., H.M.A.-G. and T.K.; resources, R.E.I., H.I.G., S.A.A., D.A.A., S.A.A.A., M.S.S., M.A.H., H.M.A.-G. and T.K.; writing—original draft preparation, R.E.I.; writing—review and editing, R.E.I. and S.A.A.A. All authors have read and agreed to the published version of the manuscript.

Funding

The APC was funded by the Deanship of Scientific Research at King Khalid University through large group projects under grant number R.G.P2/200/43.

Institutional Review Board Statement

The experimental procedure was approved by the Zagazig University animal care and use committee with approval number ZU-IACUC/2/F/135/2022.

Data Availability Statement

Data are contained within the article.

Acknowledgments

We extend our appreciation to the Deanship of Scientific Research at King Khalid University for supporting this study through large group projects under grant number R.G.P2/200/43. We acknowledge the Department of Aquatic Animal Medicine, Faculty of Veterinary Medicine, Zagazig University, Egypt, for their kind cooperation. We also acknowledge Shimaa A. Amer, assistant professor of the Department of Nutrition & Clinical Nutrition, Faculty of Veterinary Medicine, Zagazig University, Egypt, for the formulation and analysis of the diet.

Conflicts of Interest

We have no conflict of interest to declare.

References

  1. Gupta, M.V.; Acosta, B.O. A review of global tilapia farming practices. Aquac. Asia 2004, 9, 7–12. [Google Scholar]
  2. Mugwanya, M.; Dawood, M.A.; Kimera, F.; Sewilam, H. Updating the Role of Probiotics, Prebiotics, and Synbiotics for Tilapia Aquaculture as Leading Candidates for Food Sustainability: A Review. Probiot. Antimicrob. Proteins 2021, 14, 130–157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Mohamed, W.A.; El-Houseiny, W.; Ibrahim, R.E.; Abd-Elhakim, Y.M. Palliative effects of zinc sulfate against the immunosuppressive, hepato-and nephrotoxic impacts of nonylphenol in Nile tilapia (Oreochromis niloticus). Aquaculture 2019, 504, 227–238. [Google Scholar] [CrossRef] [Scilit]
  4. El-Bouhy, Z.; El-Nobi, G.; Reda, R.M.; Ibrahim, R. Effect of Insecticide. Zagazig Vet. J. 2016, 44, 196–204. [Google Scholar] [CrossRef] [Scilit]
  5. Ibrahim, R.E.; El-Houseiny, W.; Behairy, A.; Mansour, M.F.; Abd-Elhakim, Y.M. Ameliorative effects of Moringa oleifera seeds and leaves on chlorpyrifos-induced growth retardation, immune suppression, oxidative stress, and DNA damage in Oreochromis niloticus. Aquaculture 2019, 505, 225–234. [Google Scholar] [CrossRef] [Scilit]
  6. Ibrahim, R.E.; Elshopakey, G.E.; Abd El-Rahman, G.I.; Ahmed, A.I.; Altohamy, D.E.; Zaglool, A.W.; Younis, E.M.; Abdelwarith, A.A.; Davies, S.J.; Al-Harthi, H.F. Palliative role of colloidal silver nanoparticles synthetized by moringa against Saprolegnia spp. infection in Nile Tilapia: Biochemical, immuno-antioxidant response, gene expression, and histopathological investigation. Aquac. Rep. 2022, 26, 101318. [Google Scholar] [CrossRef] [Scilit]
  7. Ahmed, S.A.; Ibrahim, R.E.; Elshopakey, G.E.; Khamis, T.; Abdel-Ghany, H.M.; Abdelwarith, A.A.; Younis, E.M.; Davies, S.J.; Elabd, H.; Elhady, M. Immune-antioxidant trait, growth, splenic cytokines expression, apoptosis, and histopathological alterations of Oreochromis niloticus exposed to sub-lethal copper toxicity and fed thyme and/or basil essential oils enriched diets. Fish Shellfish. Immunol. 2022, 131, 1006–1018. [Google Scholar] [CrossRef] [Scilit]
  8. Dos Santos, E.V.; Sáez, C.; Cañizares, P.; Martínez-Huitle, C.A.; Rodrigo, M.A. Treating soil-washing fluids polluted with oxyfluorfen by sono-electrolysis with diamond anodes. Ultrason. Sonochem. 2017, 34, 115–122. [Google Scholar] [CrossRef] [Scilit]
  9. Ryberg, K.R.; Gilliom, R.J. Trends in pesticide concentrations and use for major rivers of the United States. Sci. Total Environ. 2015, 538, 431–444. [Google Scholar] [CrossRef] [Scilit]
  10. Solomon, K.R.; Dalhoff, K.; Volz, D.; Van Der Kraak, G. Effects of herbicides on fish. In Fish Physiology; Elsevier: Amsterdam, The Netherlands, 2013; Volume 33, pp. 369–409. [Google Scholar]
  11. Li, Z.; Guo, J.; Jia, K.; Zheng, Z.; Chen, X.; Bai, Z.; Yang, Y.; Chen, B.; Yuan, W.; Chen, W.; et al. Oxyfluorfen induces hepatotoxicity through lipo-sugar accumulation and inflammation in zebrafish (Danio rerio). Ecotoxicol. Environ. Saf. 2022, 230, 113140. [Google Scholar] [CrossRef] [Scilit]
  12. Acar, Ü.; İnanan, B.E.; Navruz, F.Z.; Yılmaz, S. Alterations in blood parameters, DNA damage, oxidative stress and antioxidant enzymes and immune-related genes expression in Nile tilapia (Oreochromis niloticus) exposed to glyphosate-based herbicide. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2021, 249, 109147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Hassanein, H.M.A.; Banhawy, M.A.; Soliman, F.M.; Abdel-Rehim, S.A.; Müller, W.E.G.; Schröder, H.C. Induction of Hsp70 by the Herbicide Oxyfluorfen (Goal) in the Egyptian Nile Fish, Oreochromis niloticus. Arch. Environ. Contam. Toxicol. 1999, 37, 78–84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Stagg, N.J.; LeBaron, M.J.; Eisenbrandt, D.L.; Gollapudi, B.B.; Klaunig, J.E. Assessment of possible carcinogenicity of oxyfluorfen to humans using mode of action analysis of rodent liver effects. Toxicol. Sci. 2012, 128, 334–345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Yen, J.-H.; Sheu, W.-S.; Wang, Y.-S. Dissipation of the herbicide oxyfluorfen in subtropical soils and its potential to contaminate groundwater. Ecotoxicol. Environ. Saf. 2003, 54, 151–156. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Mantzos, N.; Karakitsou, A.; Hela, D.; Patakioutas, G.; Leneti, E.; Konstantinou, I. Persistence of oxyfluorfen in soil, runoff water, sediment and plants of a sunflower cultivation. Sci. Total Environ. 2014, 472, 767–777. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Hall, K.E.; Ray, C.; Ki, S.J.; Spokas, K.A.; Koskinen, W.C. Pesticide sorption and leaching potential on three Hawaiian soils. J. Environ. Manag. 2015, 159, 227–234. [Google Scholar] [CrossRef] [Scilit]
  18. Delgado-Moreno, L.; Nogales, R.; Romero, E. Biodegradation of high doses of commercial pesticide products in pilot-scale biobeds using olive-oil agroindustry wastes. J. Environ. Manag. 2017, 204, 160–169. [Google Scholar] [CrossRef] [Scilit]
  19. Anastassiadou, M.; Bernasconi, G.; Brancato, A.; Carrasco Cabrera, L.; Ferreira, L.; Greco, L.; Jarrah, S.; Kazocina, A.; Leuschner, R.; Magrans, J.O.; et al. Review of the existing maximum residue levels for oxyfluorfen according to Article 12 of Regulation (EC) No 396/2005. EFSA J. Eur. Food Saf. Auth. 2020, 18, e06269. [Google Scholar] [CrossRef] [Scilit]
  20. Nilsen, E.; Zaugg, S.; Alvarez, D.; Morace, J.; Waite, I.; Counihan, T.; Hardiman, J.; Torres, L.; Patiño, R.; Mesa, M. Contaminants of legacy and emerging concern in largescale suckers (Catostomus macrocheilus) and the foodweb in the lower Columbia River, Oregon and Washington, USA. Sci. Total Environ. 2014, 484, 344–352. [Google Scholar] [CrossRef] [Scilit]
  21. Riley, M.B.; Keese, R.J.; Camper, N.D.; Whitwell, T.; Wilson, P.C. Pendimethalin and oxyfluorfen residues in pond water and sediment from container plant nurseries. Weed Technol. 1994, 8, 299–303. [Google Scholar] [CrossRef] [Scilit]
  22. Mohamed, A.O.; Mater, A.A.; Hammad, A.; Ishag, A.; El Tayeb, E.M.; Dahab, A.A. Pesticide residues detected on tomato and cucumber fruits grown in greenhouse farms in Khartoum State, Sudan. Int. J. Life Sci. Res. 2018, 6, 472–481. [Google Scholar]
  23. Ibrahim, E.A.; Shalaby, S.E. Screening and assessing of pesticide residues and their health risks in vegetable field soils from the Eastern Nile Delta, Egypt. Toxicol. Rep. 2022, 9, 1281–1290. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Gowda, S.K.; Kumar, R.; Abhishek, K.; Badhusha, S.; Baby, B.; Ramesh, B. Moringa oleifera: A Nutrional tree with immense medicinal value-Ethonobotanical and Pharmacological review. Int. J. Pharm. Drug Anal. 2020, 8, 12–19. [Google Scholar]
  25. Afuang, W.; Siddhuraju, P.; Becker, K. Comparative nutritional evaluation of raw, methanol extracted residues and methanol extracts of moringa (Moringa oleifera Lam.) leaves on growth performance and feed utilization in Nile tilapia (Oreochromis niloticus L.). Aquac. Res. 2003, 34, 1147–1159. [Google Scholar] [CrossRef] [Scilit]
  26. Mwamatope, B.; Tembo, D.; Chikowe, I.; Kampira, E.; Nyirenda, C. Total phenolic contents and antioxidant activity of Senna singueana, Melia azedarach, Moringa oleifera and Lannea discolor herbal plants. Sci. Afr. 2020, 9, e00481. [Google Scholar] [CrossRef] [Scilit]
  27. Abidin, Z.; Huang, H.-T.; Liao, Z.-H.; Chen, B.-Y.; Wu, Y.-S.; Lin, Y.-J.; Nan, F.-H. Moringa oleifera Leaves’ Extract Enhances Nonspecific Immune Responses, Resistance against Vibrio alginolyticus, and Growth in Whiteleg Shrimp (Penaeus vannamei). Animals 2021, 12, 42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Kaur, Y.; Dhawan, A.; Naveenkumar, B.; Tyagi, A.; Shanthanagouda, A. Immunostimulatory and antifertility effects of neem (Azadirachta indica) leaf extract on common carp (Cyprinus carpio Linnaeus). Indian J. Anim. Res. 2020, 54, 196–201. [Google Scholar]
  29. Shah, A.S.; Gunjal, M.A.; Juvekar, A.R. Immunomostimulatory activity of aqueous extract of Azadirachta indica flowers on specific and non specific immune response. J. Nat. Remedies 2009, 9, 35–42. [Google Scholar]
  30. Talpur, A.D.; Ikhwanuddin, M. Azadirachta indica (neem) leaf dietary effects on the immunity response and disease resistance of Asian seabass, Lates calcarifer challenged with Vibrio harveyi. Fish Shellfish Immunol. 2013, 34, 254–264. [Google Scholar] [CrossRef] [Scilit]
  31. Adamu, K.M.; Aliyu-Paiko, M.; Abdullahi, F.; Mustapha, A.Y.a. Effects of Azadirachta indica Leaf Powder on some Biochemical Parameters of the African catfish (Clarias gariepinus). Niger. J. Basic Appl. Sci. 2017, 25, 41–50. [Google Scholar] [CrossRef] [Scilit]
  32. Evans, W.C.; Evans, D.; Trease, G.E. Trease and Evans Pharmacognosy, 15th ed.; Saunders/Elsevier: Edinburgh, UK, 2002; p. 206. [Google Scholar]
  33. Council, N.R. Nutrient Requirements of Fish and Shrimp; National Academies Press: Washington, DC, USA, 2011. [Google Scholar]
  34. Hepher, B.; Liao, I.-C.; Cheng, S.; Hsieh, C. Food utilization by red tilapia—Effects of diet composition, feeding level and temperature on utilization efficiencies for maintenance and growth. Aquaculture 1983, 32, 255–275. [Google Scholar] [CrossRef] [Scilit]
  35. Canadian Council on Animal Care CCAC. Guidelines on: The Care and Use of Fish in Research, Teaching and Testing; CCAC: Ottawa, ON, Canada, 2005. [Google Scholar]
  36. Federation, W.E.; Association, A. Standard Methods for the Examination of Water and Wastewater; American Public Health Association (APHA): Washington, DC, USA, 2005; Volume 21. [Google Scholar]
  37. Finney, D. Probit Analysis; Cambridge University Press: Cambridge, UK, 1971. [Google Scholar]
  38. Ahmed, S.A.; Ibrahim, R.E.; Farroh, K.Y.; Moustafa, A.A.; Al-Gabri, N.A.; Alkafafy, M.; Amer, S.A. Chitosan vitamin E nanocomposite ameliorates the growth, redox, and immune status of Nile tilapia (Oreochromis niloticus) reared under different stocking densities. Aquaculture 2021, 541, 736804. [Google Scholar] [CrossRef] [Scilit]
  39. Amer, S.A.; Ahmed, S.A.; Ibrahim, R.E.; Al-Gabri, N.A.; Osman, A.; Sitohy, M. Impact of partial substitution of fish meal by methylated soy protein isolates on the nutritional, immunological, and health aspects of Nile tilapia, Oreochromis niloticus fingerlings. Aquaculture 2020, 518, 734871. [Google Scholar] [CrossRef] [Scilit]
  40. Jenkins, J.A.; Bart, H., Jr.; Bowker, J.D.; Bowser, P.; MacMillan, J.; Nickum, J.; Rose, J.; Sorensen, P.; Whitledge, G.; Rachlin, J.W. Guidelines for the Use of Fishes in Research; American Fisheries Society: Bethesda, MD, USA, 2014. [Google Scholar]
  41. Dacie, J.V.; Lewis, S.M. Practical Haematology, 9th ed.; Lewis, S.M., Bain, B.J., Bates, I., Eds.; Churchill Livingstone, Elsevier: Amsterdam, The Netherlands, 2001; pp. 219–225. [Google Scholar]
  42. Ghareghanipoor, M.; Akbary, P.; Akhlaghi, M.; Fereidouni, M. Nonspecific ımmune responses and ımmune related genes expression of rainbow trout (Oncorhynchus mykiss, Walbaum) fed zataria multiflora boiss extract. Bull. Environ. Pharmacol. Life Sci. 2014, 3, 140–146. [Google Scholar]
  43. Cai, W.-q.; Li, S.-f.; Ma, J.-y. Diseases resistance of Nile tilapia (Oreochromis niloticus), blue tilapia (Oreochromis aureus) and their hybrid (female Nile tilapia × male blue tilapia) to Aeromonas sobria. Aquaculture 2004, 229, 79–87. [Google Scholar] [CrossRef] [Scilit]
  44. Fossati, P.; Prencipe, L.; Berti, G. Enzymic creatinine assay: A new colorimetric method based on hydrogen peroxide measurement. Clin. Chem. 1983, 29, 1494–1496. [Google Scholar] [CrossRef] [Scilit]
  45. Bryan, N.S.; Grisham, M.B. Methods to detect nitric oxide and its metabolites in biological samples. Free Radic. Biol. Med. 2007, 43, 645–657. [Google Scholar] [CrossRef] [Scilit]
  46. Khamis, T.; Abdelalim, A.F.; Abdallah, S.H.; Saeed, A.A.; Edress, N.M.; Arisha, A.H. Early intervention with breast milk mesenchymal stem cells attenuates the development of diabetic-induced testicular dysfunction via hypothalamic Kisspeptin/Kiss1r-GnRH/GnIH system in male rats. Biochim. Biophys. Acta (BBA)-Mol. Basis Dis. 2020, 1866, 165577. [Google Scholar] [CrossRef] [Scilit]
  47. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [Scilit]
  48. Suvarna, K.S.; Layton, C.; Bancroft, J.D. Bancroft’s Theory and Practice of Histological Techniques E-Book; Elsevier Health Sciences: Amsterdam, The Netherlands, 2018. [Google Scholar]
  49. Banhawy, M.; Soliman, F.; Abdel-Rehim, S.; Hamada, H. Metabolic changes in the Nile bolti Oreochromis niloticus exposed to different concentrations of the herbicide (Goal). Proc. Egy. Acad. Sci. 1996, 46, 99–117. [Google Scholar]
  50. Abd El-Rahman, G.I.; Ahmed, S.A.; Khalil, A.A.; Abd-Elhakim, Y.M. Assessment of hematological, hepato-renal, antioxidant, and hormonal responses of Clarias gariepinus exposed to sub-lethal concentrations of oxyfluorfen. Aquat. Toxicol. 2019, 217, 105329. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Ahmad, I.; Maria, V.; Oliveira, M.; Pacheco, M.; Santos, M. Oxidative stress and genotoxic effects in gill and kidney of Anguilla anguilla L. exposed to chromium with or without pre-exposure to β-naphthoflavone. Mutat. Res./Genet. Toxicol. Environ. Mutagenes. 2006, 608, 16–28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Anwar, F.; Latif, S.; Ashraf, M.; Gilani, A.H. Moringa oleifera: A food plant with multiple medicinal uses. Phytother. Res. Int. J. Devoted Pharmacol. Toxicol. Eval. Nat. Prod. Deriv. 2007, 21, 17–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Bender, D.; Mayes, P. Micronutrients: Vitamins and Minerals; McGraw-Hill Lange: New York, NY, USA, 2006. [Google Scholar]
  54. Gyton, A.; Hall, J. Blood Cells. Immunity and Blood Clotting: Blood groups. In Text Book of Medical Physiology, 11th ed.; WB Saunders Company: Philadelphia, PA, USA, 2005; pp. 458–459. [Google Scholar]
  55. Sarkar, M.; Bhowmick, S.; Hussain, J.; Hasan, M.; Hossain, S. Hot Water Extract of Moringa oleifera Leaves Protects Erythrocytes from Hemolysis and Major Organs from Oxidative Stress in vitro. J. Basic Appl. Res. Biomed. 2017, 3, 120–126. [Google Scholar]
  56. Asghar, H.A.; Abbas, S.Q.; Arshad, M.K.; Jabin, A.; Usman, B.; Aslam, M.; Asghar, A. Therapeutic Potential of Azadirachta indica (Neem)-A Comprehensive Review. Sch. Int. J. Tradit. Complement. Med. 2022, 5, 47–64. [Google Scholar] [CrossRef] [Scilit]
  57. Eid, A.; Jaradat, N.; Elmarzugi, N. A Review of chemical constituents and traditional usage of Neem plant (Azadirachta indica). Palest. Med. Pharm. J. 2017, 2, 75–81. [Google Scholar]
  58. Ibrahim, R.E.; Amer, S.A.; Shahin, S.A.; Darwish, M.I.; Albogami, S.; Abdelwarith, A.A.; Younis, E.M.; Abduljabbar, M.H.; Davies, S.J.; Attia, G.A. Effect of fish meal substitution with dried bovine hemoglobin on the growth, blood hematology, antioxidant activity and related genes expression, and tissue histoarchitecture of Nile tilapia (Oreochromis niloticus). Aquac. Rep. 2022, 26, 101276. [Google Scholar] [CrossRef] [Scilit]
  59. Solomon, K.R.; Carr, J.A.; Du Preez, L.H.; Giesy, J.P.; Kendall, R.J.; Smith, E.E.; Van Der Kraak, G.J. Effects of atrazine on fish, amphibians, and aquatic reptiles: A critical review. Crit. Rev. Toxicol. 2008, 38, 721–772. [Google Scholar] [CrossRef] [Scilit]
  60. Hwang, T.-L.; Su, Y.-C.; Chang, H.-L.; Leu, Y.-L.; Chung, P.-J.; Kuo, L.-M.; Chang, Y.-J. Suppression of superoxide anion and elastase release by C18 unsaturated fatty acids in human neutrophils. J. Lipid Res. JLR 2009, 50, 1395–1408. [Google Scholar] [CrossRef] [Scilit]
  61. Cai, S.; Zhang, Y.; Wu, F.; Wu, R.; Yang, S.; Li, Y.; Xu, Y. Identification and functional characterization of a c-type lysozyme from Fenneropenaeus penicillatus. Fish Shellfish Immunol. 2019, 88, 161–169. [Google Scholar] [CrossRef] [Scilit]
  62. Rashidian, G.; Mahboub, H.H.; Fahim, A.; Hefny, A.A.; Prokić, M.D.; Rainis, S.; Boldaji, J.T.; Faggio, C. Mooseer (Allium hirtifolium) boosts growth, general health status, and resistance of rainbow trout (Oncorhynchus mykiss) against Streptococcus iniae infection. Fish Shellfish Immunol. 2022, 120, 360–368. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Amer, S.A.; Farahat, M.; Khamis, T.; Abdo, S.A.; Younis, E.M.; Abdel-Warith, A.-W.A.; Reda, R.; Ali, S.A.; Davies, S.J.; Ibrahim, R.E. Evaluation of Spray-Dried Bovine Hemoglobin Powder as a Dietary Animal Protein Source in Nile Tilapia, Oreochromis niloticus. Animals 2022, 12, 3206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Magnadóttir, B. Innate immunity of fish (overview). Fish Shellfish Immunol. 2006, 20, 137–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Verma, V.K.; Rani, K.V.; Sehgal, N.; Prakash, O. Immunostimulatory response induced by supplementation of Ficus benghalensis root powder, in the artificial feed the Indian freshwater murrel, Channa punctatus. Fish Shellfish Immunol. 2012, 33, 590–596. [Google Scholar] [CrossRef] [Scilit]
  66. De Pablo, M.A.; De Cienfuegos, G.Á. Modulatory effects of dietary lipids on immune system functions. Immunol. Cell Biol. 2000, 78, 31–39. [Google Scholar] [CrossRef] [Scilit]
  67. Moyo, B.; Masika, P.J.; Hugo, A.; Muchenje, V. Nutritional characterization of Moringa (Moringa oleifera Lam.) leaves. Afr. J. Biotechnol. 2011, 10, 12925–12933. [Google Scholar]
  68. Mora, J.R.; Iwata, M.; Von Andrian, U.H. Vitamin effects on the immune system: Vitamins A and D take centre stage. Nat. Rev. Immunol. 2008, 8, 685–698. [Google Scholar] [CrossRef] [Scilit]
  69. Girish, K.; Shankara, B.S. Neem–a green treasure. Electron. J. Biol. 2008, 4, 102–111. [Google Scholar]
  70. Hamid, N.H.; Daud, H.M.; Kayansamruaj, P.; Hassim, H.A.; Yusoff, M.S.M.; Bakar, S.N.A.; Srisapoome, P. Short-and long-term probiotic effects of Enterococcus hirae isolated from fermented vegetable wastes on the growth, immune responses, and disease resistance of hybrid catfish (Clarias gariepinus× Clarias macrocephalus). Fish Shellfish Immunol. 2021, 114, 1–19. [Google Scholar] [CrossRef] [Scilit]
  71. Zou, J.; Secombes, C.J. The function of fish cytokines. Biology 2016, 5, 23. [Google Scholar] [CrossRef] [Scilit]
  72. Ming, J.; Ye, J.; Zhang, Y.; Xu, Q.; Yang, X.; Shao, X.; Qiang, J.; Xu, P. Optimal dietary curcumin improved growth performance, and modulated innate immunity, antioxidant capacity and related genes expression of NF-κB and Nrf2 signaling pathways in grass carp (Ctenopharyngodon idella) after infection with Aeromonas hydrophila. Fish Shellfish Immunol. 2020, 97, 540–553. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  73. Francis, N.O.; Esa, Y.B. A review of production protocols used in producing economically viable monosex tilapia. J. Fish. Aquat. Sci. 2016, 11, 1. [Google Scholar] [CrossRef] [Scilit]
  74. Takeda, K.; Kaisho, T.; Akira, S. Toll-like receptors. Annu. Rev. Immunol. 2003, 21, 335–376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  75. Rahman, A.N.A.; Mansour, D.A.; Abd El-Rahman, G.I.; Elseddawy, N.M.; Zaglool, A.W.; Khamis, T.; Mahmoud, S.F.; Mahboub, H.H. Imidacloprid toxicity in Clarias gariepinus: Protective role of dietary Hyphaene thebaica against biochemical and histopathological disruption, oxidative stress, immune genes expressions, and Aeromonas sobria infection. Aquaculture 2022, 555, 738170. [Google Scholar] [CrossRef] [Scilit]
  76. Abdel-Rahman Mohamed, A.; Abdel Rahman, A.N.; Salem, G.A.; Deib, M.M.E.; Nassan, M.A.; Rhouma, N.R.; Khater, S.I. The Antioxidant Role of a Taurine-Enriched Diet in Combating the Immunotoxic and Inflammatory Effects of Pyrethroids and/or Carbamates in Oreochromis niloticus. Animals 2021, 11, 1318. [Google Scholar] [CrossRef] [Scilit]
  77. Rahman, A.N.A.; Elshopakey, G.E.; Behairy, A.; Altohamy, D.E.; Ahmed, A.I.; Faroh, K.Y.; Alkafafy, M.; Shahin, S.A.; Ibrahim, R.E. Chitosan-Ocimum basilicum nanocomposite as a dietary additive in Oreochromis niloticus: Effects on immune-antioxidant response, head kidney gene expression, intestinal architecture, and growth. Fish Shellfish Immunol. 2022, 128, 425–435. [Google Scholar] [CrossRef] [Scilit]
  78. Selvakumar, D.; Natarajan, P. Hepato-protective activity of Moringa oleifera Lam leaves in carbon tetrachloride induced hepato-toxicity in albino rats. Pharm. Mag. 2008, 4, 97. [Google Scholar]
  79. Hassanein, H.M. Toxicological effects of the herbicide oxyfluorfen on acetylcholinesterase in two fish species: Oreochromis niloticus and Gambusia affinis. J. Environ. Sci. Health Part A 2002, 37, 521–527. [Google Scholar] [CrossRef] [Scilit]
  80. Brewer, S.; Little, E.; DeLonay, A.; Beauvais, S.; Jones, S.; Ellersieck, M.R. Behavioral dysfunctions correlate to altered physiology in rainbow trout (Oncorynchus mykiss) exposed to cholinesterase-inhibiting chemicals. Arch. Environ. Contam. Toxicol. 2001, 40, 70–76. [Google Scholar]
  81. Rajyalakshmi, T.; Srinivas, T.; Swamy, K.; Prasad, N.S.; Mohan, P.M. Action of the herbicide butachlor on cholinesterases in the freshwater snail Pila globosa (Swainson). Drug Chem. Toxicol. 1996, 19, 325–331. [Google Scholar] [CrossRef] [Scilit]
  82. Szabo, A.; Nemcsok, J.; Asztalos, B.; Rakonczay, Z.; Kasa, P. The effect of pesticides on carp (Cyprinus carpio L). Acetylcholinesterase and its biochemical characterization. Ecotoxicol. Environ. Saf. 1992, 23, 39–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  83. Ambali, S.F.; Ayo, J.O.; Shittu, M.; Kawu, M.U.; Salami, S.O. Ameliorative effect of vitamin E on sensorimotor and cognitive changes induced by chronic chlorpyrifos exposure in Wistar rats. In Insecticides–Basic and Other Applications; InTech: Vienna, Austria, 2012; pp. 207–232. [Google Scholar]
  84. Slaninova, A.; Smutna, M.; Modra, H.; Svobodova, Z. REVIEWS Oxidative stress in fish induced by pesticides. Neuroendocrinol. Lett. 2009, 30, 2. [Google Scholar] [PubMed]
  85. Valavanidis, A.; Vlahogianni, T.; Dassenakis, M.; Scoullos, M. Molecular biomarkers of oxidative stress in aquatic organisms in relation to toxic environmental pollutants. Ecotoxicol. Environ. Saf. 2006, 64, 178–189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  86. Sánchez-Machado, D.I.; López-Cervantes, J.; Vázquez, N.J. High-performance liquid chromatography method to measure alpha- and gamma-tocopherol in leaves, flowers and fresh beans from Moringa oleifera. J. Chromatogr. A 2006, 1105, 111–114. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Effect of dietary supplementation with Moringa oleifera and Azadirachta indica leaves on antioxidant and anti-inflammatory cytokines gene expressions in the head kidney of Oreochromis niloticus exposed to 1/10 LC50 of oxyfluorfen. C: control: fish kept in nontreated water and fed a basal diet; C-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet; M1-OXY and M2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 3% and 6% Moringa oleifera leaves, respectively; N1-OXY and N2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 0.5% and 1% Azadirachta indica leaves, respectively; (AE) SOD: superoxide dismutase; GPX: glutathione peroxidase; GSS: glutathione synthetase. IL-10: interleukin 10; TGF-β: transforming growth factor-beta. Bars with different superscripts (a, b, c, d and e) are significantly different (one-way ANOVA, p < 0.05).
Figure 1. Effect of dietary supplementation with Moringa oleifera and Azadirachta indica leaves on antioxidant and anti-inflammatory cytokines gene expressions in the head kidney of Oreochromis niloticus exposed to 1/10 LC50 of oxyfluorfen. C: control: fish kept in nontreated water and fed a basal diet; C-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet; M1-OXY and M2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 3% and 6% Moringa oleifera leaves, respectively; N1-OXY and N2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 0.5% and 1% Azadirachta indica leaves, respectively; (AE) SOD: superoxide dismutase; GPX: glutathione peroxidase; GSS: glutathione synthetase. IL-10: interleukin 10; TGF-β: transforming growth factor-beta. Bars with different superscripts (a, b, c, d and e) are significantly different (one-way ANOVA, p < 0.05).
Fishes 08 00015 g001
Figure 2. Effect of dietary supplementation with Moringa oleifera and Azadirachta indica leaves on (AG) IL-1β, IL-6, IL-8, TNF-α, TRL-2, TRL-7, and cc-chemokine genes expressions in the head kidney of Oreochromis niloticus exposed to 1/10 96 h LC50 of oxyfluorfen. C: control: fish kept in nontreated water and fed a basal diet; C-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet; M1-OXY and M2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 3% and 6% moringa oleifera leaves, respectively; N1-OXY and N2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 0.5% and 1% Azadirachta indica leaf powder, respectively’ IL-1β: interleukin 1beta; IL-6: interleukin 6; IL-8: interleukin 8; TNF-α: tumor necrosis factor-alpha; TRL-2; Toll-like receptor-2; TRL-7: Toll-like receptor-7. Bars with different superscripts (a, b, c, d and e) are significantly different (one-way ANOVA, p < 0.05).
Figure 2. Effect of dietary supplementation with Moringa oleifera and Azadirachta indica leaves on (AG) IL-1β, IL-6, IL-8, TNF-α, TRL-2, TRL-7, and cc-chemokine genes expressions in the head kidney of Oreochromis niloticus exposed to 1/10 96 h LC50 of oxyfluorfen. C: control: fish kept in nontreated water and fed a basal diet; C-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet; M1-OXY and M2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 3% and 6% moringa oleifera leaves, respectively; N1-OXY and N2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 0.5% and 1% Azadirachta indica leaf powder, respectively’ IL-1β: interleukin 1beta; IL-6: interleukin 6; IL-8: interleukin 8; TNF-α: tumor necrosis factor-alpha; TRL-2; Toll-like receptor-2; TRL-7: Toll-like receptor-7. Bars with different superscripts (a, b, c, d and e) are significantly different (one-way ANOVA, p < 0.05).
Fishes 08 00015 g002
Figure 3. Photomicrographs (H&E) of the liver of Oreochromis niloticus exposed to 1/10 96 h LC50 of oxyfluorfen and supplemented with Moringa oleifera and Azadirachta indica leaf powder for 45 days. (A) Fish in the control group (C) showed normal histological structures of hepatocytes (star) and hepatopancreas (arrow). (B) Fish in the C-OXY group showed focal areas of hepatic necrosis (star) and apoptotic changes in the hepatopancreas (arrow). (C) Fish in the M1-OXY group showed hydropic degenerations in a moderate number of hepatic parenchyma (star) and dilated portal vein (arrow). (D) Fish in the M2-OXY group showed apparently normal hepatic cells with vacuolations (star) and normal histomorphological structures in pancreatic acini (arrow). (E) Fish in the N1-OXY group showed cytoplasmic vacuolations (star) within most hepatic parenchyma and normal acinar epithelium of hepatopancreas (arrow). (F) Fish in the N2-OXY group showed relatively normal hepatocytes (star) and hepatopancreas (arrow). Scale bar 20 μm. C: control: fish kept in nontreated water and fed a basal diet; C-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet, M1-OXY and M2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 3% and 6% Moringa oleifera leaves, respectively; N1-OXY and N2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 0.5% and 1% Azadirachta indica leaf powder, respectively.
Figure 3. Photomicrographs (H&E) of the liver of Oreochromis niloticus exposed to 1/10 96 h LC50 of oxyfluorfen and supplemented with Moringa oleifera and Azadirachta indica leaf powder for 45 days. (A) Fish in the control group (C) showed normal histological structures of hepatocytes (star) and hepatopancreas (arrow). (B) Fish in the C-OXY group showed focal areas of hepatic necrosis (star) and apoptotic changes in the hepatopancreas (arrow). (C) Fish in the M1-OXY group showed hydropic degenerations in a moderate number of hepatic parenchyma (star) and dilated portal vein (arrow). (D) Fish in the M2-OXY group showed apparently normal hepatic cells with vacuolations (star) and normal histomorphological structures in pancreatic acini (arrow). (E) Fish in the N1-OXY group showed cytoplasmic vacuolations (star) within most hepatic parenchyma and normal acinar epithelium of hepatopancreas (arrow). (F) Fish in the N2-OXY group showed relatively normal hepatocytes (star) and hepatopancreas (arrow). Scale bar 20 μm. C: control: fish kept in nontreated water and fed a basal diet; C-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet, M1-OXY and M2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 3% and 6% Moringa oleifera leaves, respectively; N1-OXY and N2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 0.5% and 1% Azadirachta indica leaf powder, respectively.
Fishes 08 00015 g003
Figure 4. Photomicrograph (H&E) of the kidney of Oreochromis niloticus exposed to 1/10 96 h LC50 of oxyfluorfen and supplemented with Moringa oleifera and Azadirachta indica leaf powder for 45 days. (A) Fish in the control group (C) showed normal tubular (arrowhead) and glomerular structures (arrow). (B) Fish in the C-OXY group showed necrotic tubular epithelium in many renal tubules (arrow). (C) Fish in the M1-OXY group showed some atrophic glomerular tufts (curved arrow) and focal tubular necrosis (arrowhead). (D) Fish in the M2-OXY group showed normal epithelial lining tubules (arrowhead) in most renal tissue and normal glomerular corpuscle (arrow) with the presence of some epithelial vacuolations. (E) Fish in the N1-OXY group showed apparent normal most renal parenchyma with necrotic changes in a few tubules (arrow). (F) Fish in the N2-OXY group showed relatively normal hepatocytes (arrowhead) and hepatopancreas (arrow). Scale bar 20 μm. C: control: fish kept in nontreated water and fed a basal diet; C-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal die;, M1-OXY and M2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 3% and 6% Moringa oleifera leaves, respectively; N1-OXY and N2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 0.5% and 1% Azadirachta indica leaf powder, respectively.
Figure 4. Photomicrograph (H&E) of the kidney of Oreochromis niloticus exposed to 1/10 96 h LC50 of oxyfluorfen and supplemented with Moringa oleifera and Azadirachta indica leaf powder for 45 days. (A) Fish in the control group (C) showed normal tubular (arrowhead) and glomerular structures (arrow). (B) Fish in the C-OXY group showed necrotic tubular epithelium in many renal tubules (arrow). (C) Fish in the M1-OXY group showed some atrophic glomerular tufts (curved arrow) and focal tubular necrosis (arrowhead). (D) Fish in the M2-OXY group showed normal epithelial lining tubules (arrowhead) in most renal tissue and normal glomerular corpuscle (arrow) with the presence of some epithelial vacuolations. (E) Fish in the N1-OXY group showed apparent normal most renal parenchyma with necrotic changes in a few tubules (arrow). (F) Fish in the N2-OXY group showed relatively normal hepatocytes (arrowhead) and hepatopancreas (arrow). Scale bar 20 μm. C: control: fish kept in nontreated water and fed a basal diet; C-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal die;, M1-OXY and M2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 3% and 6% Moringa oleifera leaves, respectively; N1-OXY and N2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 0.5% and 1% Azadirachta indica leaf powder, respectively.
Fishes 08 00015 g004
Figure 5. Photomicrograph (H&E) of the spleen of Oreochromis niloticus exposed to 1/10 96 h LC50 of oxyfluorfen and supplemented with Moringa oleifera and Azadirachta indica leaf powder for 45 days. (A) Fish in the control group (C) showed normal histology of white pulp (arrow) and red pulp (arrow). (B) Fish in the C-OXY group showed a high density of melanomacrophages with hemosiderosis (arrowhead) and edema admixed with inflammatory cells (curved arrow) between red and white pulps. (C) Fish in the M1-OXY group showed normal white and red pulp with melanomacrophage centers (arrowhead). (D) Fish in the M2-OXY group showed apparent normal cytoarchitectures of red and white pulp around ellipsoids arterioles with reticular network and low-density melanomacrophage centers (arrowhead). (E) Fish in the N1-OXY group showed prominent melanomacrophage centers (arrowhead) with apparently normal red and white pulp. (F) Fish in the N2-OXY group showed preserved aggregations of lymphocytes, monocytes, and red blood cells within reticular fibers beside the melanomacrophage center (arrowhead). Scale bar 20 μm. C: control: fish kept in non-treated water and fed a basal diet; C-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet; M1-OXY and M2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 3% and 6% Moringa oleifera leaves, respectively; N1-OXY and N2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 0.5% and 1% Azadirachta indica leaf powder, respectively.
Figure 5. Photomicrograph (H&E) of the spleen of Oreochromis niloticus exposed to 1/10 96 h LC50 of oxyfluorfen and supplemented with Moringa oleifera and Azadirachta indica leaf powder for 45 days. (A) Fish in the control group (C) showed normal histology of white pulp (arrow) and red pulp (arrow). (B) Fish in the C-OXY group showed a high density of melanomacrophages with hemosiderosis (arrowhead) and edema admixed with inflammatory cells (curved arrow) between red and white pulps. (C) Fish in the M1-OXY group showed normal white and red pulp with melanomacrophage centers (arrowhead). (D) Fish in the M2-OXY group showed apparent normal cytoarchitectures of red and white pulp around ellipsoids arterioles with reticular network and low-density melanomacrophage centers (arrowhead). (E) Fish in the N1-OXY group showed prominent melanomacrophage centers (arrowhead) with apparently normal red and white pulp. (F) Fish in the N2-OXY group showed preserved aggregations of lymphocytes, monocytes, and red blood cells within reticular fibers beside the melanomacrophage center (arrowhead). Scale bar 20 μm. C: control: fish kept in non-treated water and fed a basal diet; C-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet; M1-OXY and M2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 3% and 6% Moringa oleifera leaves, respectively; N1-OXY and N2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 0.5% and 1% Azadirachta indica leaf powder, respectively.
Fishes 08 00015 g005
Table 1. Ingredients and chemical composition of experimental diets: experimental diet content (g/kg on DM basis).
Table 1. Ingredients and chemical composition of experimental diets: experimental diet content (g/kg on DM basis).
IngredientsCN1N2M1M2
Fish meal 180180180180180
Neem -510--
Moringa---3070
Fish oil6060606060
Ground yellow corn243243243243243
Soybean meal 44%255252.5250245235
Corn gluten 60% CP110110110110110
Wheat 5050505050
Wheat bran9087.5857040
Premix #1212121212
Chemical analysis % ##
Crude protein 37.1837.1337.0837.0637.01
Fat9.989.991010.0210.07
NFE *42.5342.5642.642.4542.24
Crude fiber 3.823.823.814.064.36
Ash 6.466.486.506.396.30
Lysine 2.012.01222
Methionine 0.780.780.770.770.75
DE (Kcal kg−1) **2950.122951.352952.52967.52993
# Premix: each 1 kg of premix contained: vitamin A, 550,000 IU; vitamin D, 110,000 IU; vitamin E, 11,000 mg; vitamin K, 484 mg; vitamin C, 50 g; vitamin B1, 440 mg; vitamin B2, 660 mg; vitamin B3, 13,200 mg; vitamin B5, 1100 mg; vitamin B6, 1045 mg; vitamin B9, 55 mg; choline, 110,000 mg; biotin, 6.6 mg; iron, 6.6 g; copper, 330 mg; manganese, 1320 mg; zinc, 6.6 g; selenium, 44 mg; iodine, 110 mg. ## All compositions calculated according to NRC [33]. * Nitrogen free extract (NFE) = 1000 − (g kg−1 crude protein + crude lipids + ash + crude fiber). ** Digestible energy (DE) was calculated by applying a coefficient of 0.75 to convert gross energy to digestible energy, according to Hepher et al. [34].
Table 2. Primers of immune and antioxidant-related genes for real-time quantitative PCR amplification.
Table 2. Primers of immune and antioxidant-related genes for real-time quantitative PCR amplification.
PrimerForward PrimerReverse PrimerAccession Number
β-ActinCCACCCAAAGTTCAGCCATGACGATGGAGGGGAAGACAGXM_003443127.5
SODTCACAGCAAGCACCATGCTAGCAACCTGTGTTGTCACGTCXM_003449940.5
GPXGTGCCCTGCAATCAGTTTGGCGAGGAGCTGGAACTTTGGTNM_001279711.1
TNF-αCAGGATCTGGCGCTACTCAGTAGCTGGTTGGTTTCCGTCCNM_001279533.1
TGF-βCCAGAGCAGAGCTACGGATGCCAGGTCTGCAGAGGTTCAGNM_001311325.1
IL-1βCTCATGTCTGTCCGCTACCCTGAAGCTTCTGTAGCGTGGGXM_019365842.2
IL-10CATCAGCATTTCTGTGGACCAGTTCTTGAGCCTGACGGGGAAKP645180.1
IL-6CTTTTCCTCTGCGGTGATGCGGTGCTCAAACGCTTTCTCGXM_019350387.2
IL-8CAAGATCATGTCCAGCAGATCCTCGTGAAAGGAACACGGTGANM_001279704.1
cc-chemokineTCTGGAAGTCTGTTTGCGCTGACAGTTTTGCAGCAGGTGGFF279635.1
GSSTAGCAAGCTAAAATGCGCGGAGAGCCGAGTTCATCAGCACXM_025901610.1
TRL-2TGGCACAGGACACTTAAGCAGCGACGAGCACTGAGATACTXM_019360109.2
TRL-7CTTGGTCACGCTGTCCATCTTGGCCCTGCAGAAATGGTAGXM_019352834.2
β-actin, beta actin; SOD, superoxide dismutase; GPX, glutathione peroxidase; TNF-α, tumor necrosis factor alpha; TGF-β, transforming growth factor beta; IL-1β, interleukin 1 beta; IL-10, interleukin 10; IL-6, interleukin 6; IL-8, interleukin 8; GSS, glutathione synthetase; TRL-2; Toll-like receptor-2; TRL-7, Toll-like receptor-7.
Table 3. Results of qualitative phytochemical screening of M. oleifera and A. indica leaves.
Table 3. Results of qualitative phytochemical screening of M. oleifera and A. indica leaves.
ParameterM. oleiferaA. indica
Flavonoids+++
Saponins ++++
Phenols+++
Terpenes and steroids++++
Alkaloids ++
Cardiac glycosides++++
Tannins+++
+: detected in low concentration; ++: detected in moderate concentration; +++: detected in high concentration.
Table 4. Effect of Moringa oleifera and Azadirachta indica leaves on growth parameters of Oreochromis niloticus exposed to 1/10 96 h LC50 of oxyfluorfen.
Table 4. Effect of Moringa oleifera and Azadirachta indica leaves on growth parameters of Oreochromis niloticus exposed to 1/10 96 h LC50 of oxyfluorfen.
Experimental Group
ParameterCC-OXYM1-OXYM2-OXYN1-OXYN2-OXY
IBW (g)25.00 ± 0.5725 ± 0.1025.10 ± 0.2625.11 ± 0.3325.10 ± 0.3325.25 ± 0.57
FBW (g)57.00 ± 1.52 a36.00 ± 1.45 d42.00 ± 0.56 b46.50 ± 0.57 ab40.50 ± 0.88 c41.50 ± 1.15 c
WG (g)31.88 ± 1.15 a10.75 ± 1.76 d16.90 ± 1.20 b21.15 ± 0.33 b15.50 ± 1.20 c16.40 ± 0.57 bc
FI (g/fish)63.46 ± 2.25 a46.50 ± 2.10 d54.50 ± 1.85 c57.50 ± 2.53 b54.65 ± 1.95 c54.16 ± 1.60 c
FCR1.99 ± 0.10 d4.32 ± 0.85 a3.23 ± 0.52 b2.71 ± 0.15 c3.52 ± 0.53 b3.43 ± 0.35 b
SGR (%/day)1.37 ± 0.06 a0.61 ± 0.14 d0.68 ± 0.11 d1.01 ± 0.02 b0.80 ± 0.08 c0.83 ± 0.0 bc
survivability100 ± 0.00 a36 ± 0.45 e52 ± 0.55 c65 ± 0.62 b41 ± 0.33 d49 ± 0.21 c
Values are expressed as mean ± SE. Means within the same row with different superscripts are significantly different (p < 0.05). C: control: fish kept in non-treated water and fed a basal diet; C-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet; M1-OXY and M2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 3% and 6% Moringa oleifera leaves, respectively; N1-OXY and N2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 0.5% and 1% Azadirachta indica leaves powder, respectively; IBW: initial body weight; FBW: final body weight; WG: weight gain; FI: feed intake, FCR; feed conversion ratio, SGR%: specific growth rate%.
Table 5. Effect of Moringa oleifera and Azadirachta indica leaves on erythrogram and leukogram of Oreochromis niloticus exposed to 1/10 96 h LC50 of oxyfluorfen.
Table 5. Effect of Moringa oleifera and Azadirachta indica leaves on erythrogram and leukogram of Oreochromis niloticus exposed to 1/10 96 h LC50 of oxyfluorfen.
ParametersExperimental Groups
CC-OXYM1-OXYM2-OXYN1-OXYN2-OXY
Erythrogram
RBCs (106/μL)2.04 ± 0.23 a1.18 ± 0.05 f1.87 ± 0.06 c1.96 ± 0.17 b1.53 ± 0.20 e1.65 ± 0.11 d
Hb (g/dL)6.34 ± 0.19 a3.59 ± 0.20 f5.73 ± 0.16 c5.89 ± 0.09 b4.66 ± 0.06 e4.96 ± 0.12 d
PCV (%)17.83 ± 0.50 a10.16 ± 0.33 f16.05 ± 0.44 c16.98 ± 0.16 b13.33 ± 0.19 e14.19 ± 0.80 d
MCV (fl)87.40 ± 0.2886.10 ± 0.7186.36 ± 0.4486.17 ± 0.7687.12 ± 0.2886 ± 0.68
MCH (pg)31.56 ± 0.2830.42 ± 0.5230.64 ± 0.8330.05 ± 0.4630.45 ± 0.5730.06 ± 0.57
MCHC (%)35.55 ± 0.2935.33 ± 0.6635.70 ± 0.4734.68 ± 0.3334.95 ± 0.2934.95 ± 0.33
Leukogram
WBCs (103/μL)16.04 ± 0.23 a5.91 ± 0.05 f12.43 ± 0.11 c14.20 ± 0.30 b8.17 ± 0.27 e10.91 ± 0.37 d
Lymphocytes (103/μL)11.53 ± 0.08 a3.82 ± 0.09 f9.03 ± 0.03 c10.16 ± 0.08 b5.64 ± 0.21 e8.07 ± 0.11 d
Heterophiles (103/μL)2.57 ± 0.23 a1.66 ± 0.08 f2.25 ± 0.06 c2.37 ± 0.17 b1.89 ± 0.04 e2.00 ± 0.06 d
Monocytes (103/μL)1.06 ± 0.03 a0.23 ± 0.01 f0.65 ± 0.02 c0.98 ± 0.03 b0.33 ± 0.01 e0.41 ± 0.01 d
Eosinophils (103/μL)0.88 ± 0.08 a0.20 ± 0.05 f0.50 ± 0.05 c0.69 ± 0.17 b0.31 ± 0.05 e0.43 ± 0.17 d
Values are expressed as mean ± SE. Means within the same row with different superscripts are significantly different (p < 0.05). C: control: fish kept in non-treated water and fed a basal diet; C-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet; M1-OXY and M2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 3% and 6% Moringa oleifera leaf powder, respectively; N1-OXY and N2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 0.5% and 1% Azadirachta indica leaf powder, respectively; RBCs: red blood cells; Hb: hemoglobin; PCV: packed cell volume; MCV: Mean corpuscular volume; MCH: mean corpuscular hemoglobin; MCHC: mean corpuscular hemoglobin concentration; WBCs: white blood cells.
Table 6. Effect of feeding Moringa oleifera and Azadirachta indica leaves on the immunological function of Oreochromis niloticus exposed to 96 h LC50 oxyfluorfen.
Table 6. Effect of feeding Moringa oleifera and Azadirachta indica leaves on the immunological function of Oreochromis niloticus exposed to 96 h LC50 oxyfluorfen.
ParameterCC-OXYM1-OXYM2-OXYN1-OXYN2-OXY
IgM (ng/m)173.00 ± 4.7 a48.00 ± 4.6 e122.67 ± 19.20 bc135.33 ± 1.45 b67.66 ± 1.45 d104.33 ± 1.75 c
Complement 3 (mg/dL)32.91 ± 0.42 a6.64 ± 0.34 d23.56 ± 0.63 b26.17 ± 0.63 b10.72 ± 0.37 c11.29 ± 0.55 c
Lysozyme (ng/mL)7.38 ± 0.65 a0.64 ± 0.26 f3.58 ± 0.09 c4.66 ± 0.35 b1.79 ± 0.10 e2.13 ± 0.16 d
Phagocytic %96.00 ± 0.57 a45.00 ± 0.57 f78.66 ± 0.88 c84.33 ± 1.20 b61.00 ± 0.57 e73.00 ± 0.57 d
Values are expressed as mean ± SE. Means within the same row with different superscripts are significantly different (p < 0.05). C: control: fish kept in non-treated water and fed a basal diet; C-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet; M1-OXY and M2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 3% and 6% Moringa oleifera leaf powder, respectively; N1-OXY and N2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 0.5% and 1% Azadirachta indica leaf powder, respectively; IgM: immunoglobulin M.
Table 7. Effect of Moringa oleifera and Azadirachta indica leaves on liver and kidney functions, AChE, and hepatic and serum antioxidants of Oreochromis niloticus exposed to 1/10 96 h LC50 of oxyfluorfen.
Table 7. Effect of Moringa oleifera and Azadirachta indica leaves on liver and kidney functions, AChE, and hepatic and serum antioxidants of Oreochromis niloticus exposed to 1/10 96 h LC50 of oxyfluorfen.
ParameterExperimental Group
CC-OXYM1-OXYM2-OXYN1-OXYN2-OXY
Liver and kidney functions
ALT (U/L)2.99 ± 0.20 f28.08 ± 1.14 a12.77 ± 0.70 d7.30 ± 0.47 e23.74 ± 0.63 b19.47 ± 0.73 c
ALT (U/L)35.70 ± 2.71 e160.46 ± 1.83 a82.96 ± 1.56 c71.22 ± 3.04 d96.23 ± 1.16 b92.13 ± 0.57 b
Creatinine (mg/dL)0.31 ± 0.03e1.12 ± 0.06 a0.52 ± 0.01 d0.44 ± 0.01 d0.83 ± 0.02 b0.70 ± 0.02 c
Hepatic and serum antioxidants
MDA (nmol/mg)1.36 ± 0.26 f9.98 ± 0.33 a4.33 ± 0.22 d2.52 ± 0.26 e7.23 ± 0.45 b5.49 ± 0.25 c
SOD (U/mg)154 ± 3.54 a67.66 ± 0.99 f113.72 ± 1.08 c132.10 ± 1.40 b80.56 ± 3.03 e106.50 ± 2.10 d
GPx (U/mg)7.82 ± 0.29 a0.51 ± 0.19 f4.71 ± 0.31 c6.31 ± 0.26 b1.12 ± 0.03 e2.25 ± 0.14 d
TAC (ng/mg)8.46 ± 0.64 a1.57 ± 0.13 f3.73 ± 0.25 c4.96 ± 0.34 b2.19 ± 0.14 e3.08 ± 0.34 d
NO (μmol/L)86.66 ± 0.88 a20.33 ± 1.45 f63.66 ± 1.85 c79.33 ± 2.60 b45.33 ± 2.45 e52.33 ± 1.45 d
Brain neurotransmitter
AChE (pg/mL)72.00 ± 1.73 a18.00 ± 1.15 f35.33 ± 1.45 c42.33 ± 1.20 b23.00 ± 0.57 e27.00 ± 0.57 d
Values are expressed as mean ± SE. Means within the same row with different superscripts are significantly different (p < 0.05). C: control: fish kept in non-treated water and fed a basal diet; C-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet; M1-OXY and M2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 3% and 6% moringa oleifera leaf powder, respectively; N1-OXY and N2-OXY: fish exposed to 1/10 96 h LC50 oxyfluorfen and fed a basal diet fortified with 0.5% and 1% Azadirachta indica leaf powder, respectively; ALT: alanine aminotransferase; AST: aspartate aminotransferases; MDA: malondialdehyde; SOD: superoxide dismutase; CAT: catalase; TAC: total antioxidant capacity; NO: nitric oxide; AChE: acetylcholinesterase.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ibrahim, R.E.; Ghamry, H.I.; Althobaiti, S.A.; Almalki, D.A.; Shakweer, M.S.; Hassan, M.A.; Khamis, T.; Abdel-Ghany, H.M.; Ahmed, S.A.A. Moringa oleifera and Azadirachta indica Leaves Enriched Diets Mitigate Chronic Oxyfluorfen Toxicity Induced Immunosuppression through Disruption of Pro/Anti-Inflammatory Gene Pathways, Alteration of Antioxidant Gene Expression, and Histopathological Alteration in Oreochromis niloticus. Fishes 2023, 8, 15. https://doi.org/10.3390/fishes8010015

AMA Style

Ibrahim RE, Ghamry HI, Althobaiti SA, Almalki DA, Shakweer MS, Hassan MA, Khamis T, Abdel-Ghany HM, Ahmed SAA. Moringa oleifera and Azadirachta indica Leaves Enriched Diets Mitigate Chronic Oxyfluorfen Toxicity Induced Immunosuppression through Disruption of Pro/Anti-Inflammatory Gene Pathways, Alteration of Antioxidant Gene Expression, and Histopathological Alteration in Oreochromis niloticus. Fishes. 2023; 8(1):15. https://doi.org/10.3390/fishes8010015

Chicago/Turabian Style

Ibrahim, Rowida E., Heba I. Ghamry, Saed Ayidh Althobaiti, Daklallah A. Almalki, Medhat S. Shakweer, Mona A. Hassan, Tarek Khamis, Heba M. Abdel-Ghany, and Shaimaa A. A. Ahmed. 2023. "Moringa oleifera and Azadirachta indica Leaves Enriched Diets Mitigate Chronic Oxyfluorfen Toxicity Induced Immunosuppression through Disruption of Pro/Anti-Inflammatory Gene Pathways, Alteration of Antioxidant Gene Expression, and Histopathological Alteration in Oreochromis niloticus" Fishes 8, no. 1: 15. https://doi.org/10.3390/fishes8010015

APA Style

Ibrahim, R. E., Ghamry, H. I., Althobaiti, S. A., Almalki, D. A., Shakweer, M. S., Hassan, M. A., Khamis, T., Abdel-Ghany, H. M., & Ahmed, S. A. A. (2023). Moringa oleifera and Azadirachta indica Leaves Enriched Diets Mitigate Chronic Oxyfluorfen Toxicity Induced Immunosuppression through Disruption of Pro/Anti-Inflammatory Gene Pathways, Alteration of Antioxidant Gene Expression, and Histopathological Alteration in Oreochromis niloticus. Fishes, 8(1), 15. https://doi.org/10.3390/fishes8010015

Article Metrics

Back to TopTop