Next Article in Journal
Growth, Muscle Nutrition Composition, and Digestive Enzyme Activities of the Juvenile and Adult Siniperca chuatsi Fed on Live Baits and a Formulated Diet
Next Article in Special Issue
Replacement of Dietary Fishmeal by Black Soldier Fly Larvae (Hermetia illucens) Meal in Practical Diets for Juvenile Tench (Tinca tinca)
Previous Article in Journal
Molecular Characterization and Dietary Regulation of Glutaminase 1 (gls1) in Triploid Crucian Carp (Carassius auratus)
Previous Article in Special Issue
Effects of Diets with Varying Astaxanthin from Yarrowia lipolytica Levels on the Growth, Feed Utilization, Metabolic Enzymes Activities, Antioxidative Status and Serum Biochemical Parameters of Litopenaeus vannamei
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 7
Issue 6
10.3390/fishes7060378
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of a Diet of Phragmites australis instead of Triticum aestivum L. on Immune Performance and Liver Tissue Structure of Ctenopharyngodon idellus

by
Ronghua Wang
1,2,3,
Chaobo Lei
1,
Zhenyu Li
1,
Yanju Lei
1,2,3,
Congqiang Luo
1,2,3,
Liye Shao
1,2,3,*,
Chunhong Huang
1,2,3 and
Pinhong Yang
1,2,3,*
1
College of Life and Environmental Sciences, Hunan University of Arts and Science, Changde 415000, China
2
Hunan Provincial Key Laboratory for Molecular Immunity Technology of Aquatic Animal Diseases, Changde 415000, China
3
Hunan Provincial Key Laboratory for Health Aquaculture and Product Processing in Dongting Lake Area, Changde 415000, China
*
Authors to whom correspondence should be addressed.
Fishes 2022, 7(6), 378; https://doi.org/10.3390/fishes7060378
Submission received: 1 November 2022 / Revised: 30 November 2022 / Accepted: 6 December 2022 / Published: 8 December 2022
(This article belongs to the Special Issue Fish Nutrition and Feed Technology)
Browse Figures
Versions Notes

Abstract

:
This experiment aimed to study the effects on liver tissue structure and immune performance of grass carp Ctenopharyngodon idellus when the common reed Phragmites australis is in its diet, instead of wheat Triticum aestivum L. Seventy-two healthy grass carps (145.52 ± 2.56 g) were randomly divided into three groups according to their body weight. Fishes in each group were fed an essential diet with 0% (control group), 50% and 100% (test group) common reed, instead of wheat, respectively. After feeding for 41 days, the changes of serum biochemical indices, liver tissue structure and immune related indices of grass carp were detected. The results showed that, compared with the control group, the activities of serum alanine transaminase (ALT) and aspartate transaminase (AST) in the substitution groups were significantly increased (p < 0.05), but still at a normal level. The contents of total protein, albumin and globulin did not change significantly (p > 0.05). Compared with the control group, the liver cells of grass carp in the substitution groups had clear boundaries, tight arrangement and less vacuolation. The contents of serum interleukin-1 (IL-1) and complement 3 (C3) in the 100% substitution group were significantly higher than those in the control group (p < 0.05), and the contents of liver IL-1 and total complement (CH50) in the 100% substitution group were significantly higher than those in the control group (p < 0.05). The contents of IL-1, C3 in serum and IL-1, CH50 in liver in the 50% substitution group were significantly higher than those in the control group (p < 0.05). The mRNA relative expression levels of C3, IL-1, MHC-I and interferon (IFN) in the head-kidney, kidney, liver and spleen of grass carp were significantly affected by feeding the grass carp with different common reed substitution ratios (p < 0.05). In summary, common reed, instead of wheat, in feed can improve the liver tissue structure, and increase the non-specific immune response level, of grass carp.

Graphical Abstract

1. Introduction

The common reed Phragmites australis is one of the most widely distributed and abundant wetland plant genera in the world [1] and found on every continent except Antarctica. The common reed plays an important role in regulating climate, inhibiting algae growth, accumulating heavy metals, preventing floods, strengthening dikes and maintaining biodiversity, with high ecological and socio-economic value [2,3,4,5]. The common reed has been used throughout history to produce non-food commodities, such as paper pulp, roofing and building materials or litter material, as well as for heating and as forage feed [6].
The Dongting Lake is one of the main producing areas of common reed in China, with a planting area of 666 km2 and an annual output of more than 900,000 tons, accounting for about 30% of the total output in China [7]. In recent years, the main utilization mode of the common reed in the Dongting Lake area is as papermaking raw materials. However, due to environmental pollution, the paper industry has completely withdrawn from the Dongting Lake area, and the utilization rate of the common reed in the lake area has significantly reduced. A mass of common reeds rotted and accumulated, thus causing eutrophication in local areas of the lake, as well as great resource waste and ecological pollution [8]. With the continuous growth of the aquaculture industry in China, the demand for feed raw materials has increased greatly. Limited by the output of agricultural products and resource allocation, the gap of conventional feed raw materials is getting bigger and bigger.
Common reed is an excellent forage grass of Gramineae for horses, cattle, and goats, and research on its forage mainly focuses on its use as roughage or silage for breeding herbivores, in which good results have been achieved [9,10]. However, there is no research on high-value and high-efficiency utilization of common reed processed into pellet feed. The Grass carp Ctenopharyngodon idellus is the main freshwater breeding fish in China. Since 2013, the output of grass carp culture in China has reached more than 5 million tons. In this experiment, grass carp was taken as the research object, and the effects of different proportions of common reed instead of wheat Triticum aestivum L. on liver tissue structure and immune performance index of grass carp were evaluated. The results can provide some theoretical basis for the development and utilization of common reed resources in Dongting Lake.

2. Materials and Methods

2.1. Experimental Feed

Common reeds were collected in the Changde area of Dongting Lake, chopped with a 220 V straw hay cutter, dried at 56 °C and ground into powder. The moisture, crude ash, crude protein, crude fiber and crude fat contents of common reed, wheat and the diets were determined as described by AOAC (2003). The gross energy of common reed, wheat and the diets were detected by an Oxygen bomb heat meter (Calorimeter, Parr instrument Company Moline, Illinois, USA). The main effective components of common reed and wheat were shown in Table 1.
The basic feed raw materials came from Alpha Feed, and the feed raw materials were crushed and screened, with a pore size of 0.43 mm. According to the nutrient content of common reed powder and wheat flour measured in this experiment, the grass carp compound feed in the control group was designed with VF123 feed formula software. In the experimental group, 50% and 100% common reed flour were used, instead of wheat flour, in the basic feed. See Table 2 for the composition and nutritional level of the experimental feed.

2.2. Feeding Management

Grass carp was purchased from a grass carp farm in Changde city, Hunan, China. The grass carp were acclimatized for two weeks in fiberglass tanks (diameter: 1.06 m, the volume of aquaculture water was 626L) with a flow-through system (source of water: Baima Lake in Changde; water flow velocity: 1300 mL/min) before the main culture experiment. Then, 72 healthy grass carps with an average body weight of 145.52 ± 2.56 g were randomly divided into three groups according to body weight, with no significant difference (p > 0.05). Each group had three replicates with eight fishes in each replicate. The feeding amount was about 3.0~5.0% of the fish body weight and adjusted according to the intake of the diet during the feeding trial, and feeding occurred at 08:00 and 15:00 every day. The feces were removed by siphoning before each feeding. The feeding status and health status of each group of experimental fish were recorded accurately every day, and the water quality was detected every week during the experimental culture. During the culture period, the water temperature was 20~26 °C, the dissolved oxygen was above 6.0 mg/L, pH was 7.5~7.8, and ammonia nitrogen under 0.5 mg/L.

2.3. Sample Collection and Processing

After culturing for 41 days and stopping feeding for one day, three fishes were randomly selected from each culturing bucket. All experimental fish were anesthetized with MS-222 (150 mg/L) (Sigma-Aldrich, Darmstadt, Germany) before sampling. Blood was taken from the tail vein, stood at 4 °C for 1 h, centrifuged for 15 min at 4000 r/min, and the serum was taken for biochemical parameters and immune factors content detection. After dissection, 0.2 g liver, spleen, kidney and head kidney were taken in each fish, frozen in liquid nitrogen and stored in a refrigerator at −80 °C for detection of immune gene expression level. One gram liver in each fish was rinsed with ice-cold PBS, and then homogenized in 9 mL PBS used JXFSTPRP-24L (Shanghai JingXin, Shanghai, China), centrifuged for 5 min at 5000 r/min, and the supernatant were stored at −80 °C for detecting the content of immune factors in liver. The liver tissues of 0.5 cm × 0.5 cm × 0.5 cm were fixed in 10% formaldehyde to observe the liver structure.

2.4. Detection of Serum Biochemical Parameters

Serum biochemical indices were tested in Liyuan Medical Testing Center of Changde City. Total protein (TP) was measured by the biuret method, albumin (ALB) was measured with bromocresol green (BCG) method, and globulin (GLB) was measured by the calculation method. Blood glucose (GLU) was measured by the hexokinase method, and Aspartate aminotransferase (AST) and Alanine aminotransferase (ALT) activities were measured by the IFCC rate method.

2.5. Observation of Liver Tissue Structure

The liver tissue was fixed in 10% formaldehyde for 24 h, then dehydrated by 30~100% ethanol gradient, made transparent with xylene and embedded in wax. Paraffin sections with a thickness of 4~5 μm were prepared, stained by means of the HE routine, sealed with neutral gum, and observed with a Leica Advanced Microscope System (DM3000). The area ration and number of hepatocyte vacuolization was visualized and quantified using ImageJ version 1.5.3 software. three areas of each liver section were quantified. By selecting ranges of pixel values in color images the pixels associated with black could be distinguished. The number of selected pixels was then quantified using a particle analysis operation and by counting the area of all bright objects (in pixels).

2.6. Detection of Immune Factor Activity and Content

Immunoglobulin M (IgM), Interleukin 1 (IL-1), Complement 3 (C3), Total Complement (50% Haemolytic Complement, CH50) and Cortisol in serum and in the liver were detected using an ELISA kit (Shanghai Enzyme Linked Biotechnology Co., Ltd., Shanghai, China).

2.7. Detection and Analysis of Immune Gene mRNA Expression Level

2.7.1. RNA Extraction and cDNA First Strand Synthesis

Total RNA was extracted from the liver, spleen, kidney and head kidney tissues, and stored at −80 °C using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The method referred to the instructions of TRIzol reagent. The integrity of the extracted RNA was detected by 1% agarose electrophoresis, and the total RNA, with good integrity, was used for the next experiment. A quantity of 2 μg total RNA was taken, and the first strand of cDNA was synthesized by using a RevertAid™ First Strand cDNA Synthesis reverse transcription kit (ThermoFisher, Carlsbad, CA, USA). The reverse transcription product was diluted 20 times and used for the analysis of immune gene mRNA expression level.

2.7.2. Fluorescence Quantitative PCR Analysis

According to the related literatures [11,12], immune genes Heat Shock Protein 70 (Hsp70), Lysozyme, Major histocompatibility complex I (MHC-I), Interferon (IFN), C3, IgM and IL-1 were screened out and detected these genes relative expression level after culture experiment. Primer synthesis was completed by Sangon Biotech Co., Ltd. (Shanghai, China), and primers sequence information is shown in Table 3. The fluorescence quantitative PCR reaction system involved the following: 2 × ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) 10 μL, 10 μmol/L primer 0.4 μL, diluted cDNA template 9.2 μL. The reaction procedure was as follows: 95 °C for 3 min: 95 °C for 5 s, 60 °C for 10 s, 72 °C for 15 s. The melting curve ranged from 65 °C to 97 °C and increased by 0.1 °C per second. The relative expression level of genes was calculated by the 2−ΔΔCt method. LightCycler 480 software release 1.5. 0 and Excel 2021 software were used for data processing. The β-actin gene was used as a reference gene, and the relative expression level of gene mRNA in the control group was analyzed by homogenization.

2.8. Data Analysis

SPSS 17.0 software was used for one-way ANOVA, and the Duncan method was used for significance analysis between groups. The significance level was p < 0.05. The results were plotted by mean ± SD, the activity and content of immune factors, and the expression level of immune-related genes used graph Pad Prism 6 software.

3. Results

3.1. Serum Biochemical Indicators

It can be seen from Table 4 that the contents of TP, ALB and GLB did not change significantly among the three groups (p > 0.05). The blood glucose concentration of grass carp in the substitution group was lower than that in the control group, especially in the 50% substitution group (p < 0.05). Except for AST activity in the 100% substitution group, serum ALT and AST activities of grass carp in the substitution group were significantly higher than those in the control group (p < 0.05).

3.2. Histological Structure of Liver

In the control group, hepatic cell boundaries were unclear and hepatocyte vacuolation was severe, accompanied by a small amount of lymphocyte infiltration (Figure 1a,b). In the 50% and 100% substitution groups, the boundaries of hepatocytes in grass carp liver were clear, the nuclei were clearly colored and basically located in the center, and the cells were arranged neatly and were of uniform size (Figure 1c,d,e,f). The area ratio and number of hepatocyte vacuolization in the substitution group was significantly lower than that in the control group (p < 0.05) (Table 5).

3.3. Activity and Contents of Immune Factors

Compared with the control group, the contents of serum IL-1 and C3 in the 100% common reed substitution group were significantly higher (p < 0.05), and the activity of CH50 in the 50% and 100% common reed substitution groups were significantly lower than in the control group (p < 0.05). The contents of IL-1 and CH50 in the liver of the 100% common reed substitution group were significantly higher than those in the control group (p < 0.05), but the content of C3 was significantly lower than that in the control group (p < 0.05). Compared with the control group, the contents of IL-1, C3, IgM and cortisol in the serum and liver of grass carp in the 50% common reed substitution group were not significantly different (p > 0.05) (Figure 2).

3.4. The mRNA Expression Level of Immune Genes

Compared with the control group, the expression levels of Hsp70, IL-1, MHC-I and lysozyme mRNA in the head and kidney of grass carp in the 100% common reed substitution group were significantly up-regulated (p < 0.05), while the expression levels of C3 and mRNA were significantly down-regulated. The mRNA expression levels of C3, Hsp70, lysozyme, MHC-I and other genes in the 50% common reed substitution group were significantly down-regulated in the head kidney (p < 0.05) (Figure 3A). Compared with the control group, the mRNA expression levels of IL-1 and lysozyme in the liver of grass carp in the substitution group were significantly down-regulated (p < 0.05), while the mRNA expression levels of C3, MHC-I and IgM genes were not significantly different (p > 0.05) (Figure 3B). The mRNA expression of C3 and Hsp70 in the spleen of the 50% common reed substitution group was significantly higher than that in the control group, while the expression of MHC-I was significantly lower than that in the control group (p < 0.05); The mRNA expression levels of other detected genes, except the IgM gene, in grass carp spleen of the 100% common reed substitution group were significantly lower than those in the control group (Figure 3C). The mRNA expression levels of Hsp70, MHC-I and IgM genes in the kidneys of the 100% common reed substitution group were significantly higher than those of the control group (p < 0.05), while the mRNA expression levels of other detected genes, except C3, in the kidneys of the 50% common reed substitution group were not significantly different (p > 0.05) (Figure 3D).

4. Discussion

The liver is the most important metabolic center of fish. When fish ingest feed with unreasonable nutritional structure, it causes nutritional stress to the liver, and then damages the normal structure and functions of the liver [13,14]. In this study, we found that the cellular structure of the liver tissue of grass carp in the common reed substitution group was closely arranged, while, in the control group, lymphocytes had infiltrated, cells were vacuolated and had obvious inflammatory reaction and cell vacuolization. Therefore, from the analysis of the results of the tissue sections, adding common reed to feed was helpful to improve the health status of the liver tissue.
Fish serum biochemical indicators are widely used to evaluate the health status, nutritional status and adaptation to the environment of fish, and are good physiological, pathological and toxicological indicators. TP content in serum can reflect the metabolism of protein in the body, and increase of TP content can accelerate the deposition of protein and promote the growth of the body. ALB and GLB mainly maintain the balance of cell nutrition and blood osmotic pressure in vivo [15]. In this experiment, the TP content of the substitution group and the control group were at the normal level of total protein content for teleost fish (30–50 g/L) [16]. The TP content of the substitution group was slightly higher than that in the control group, but the difference was not significant (p > 0.05), indicating that the nutritional status of the substitution group was better. Blood glucose is an important index reflecting the glucose metabolism of fish, the functional state of tissues and cells and endocrine function of the whole body [17]. The normal content of blood glucose in grass carp is 2.78–12.72 mmol/L [18]. In this study, the blood glucose concentration of grass carp in the substitution group was lower than that in the control group, and the 50% substitution group was significantly lower than that in the control group, but all of them were in the normal range. Transaminase is involved in protein metabolism and synthesis [19], and the activities of ALT and AST directly reflect the protein metabolism level [20], and are affected by the quantity and quality of dietary protein [21]. In this study, the serum ALT and AST activities of grass carp in the substitution group were significantly higher than those in the control group (p < 0.05), but still in the normal range, though lower than those detected by Cheng et al. [22] and Chen et al. [23]. In this study, the activity of ALT and AST in the serum of the grass carp in the substitution group might be related to the amino acid composition and high cellulose content of common reed. High cellulose content affects protein absorption of grass carp.
As a lower vertebrate, the fish has a relatively perfect acquired immune response, which can resist pathogen invasion through nonspecific immune response and specific immune response [24]. Complements and lysozymes are important non-specific immune system components of the body, which play the role of dissolving bacteria and eliminating cells (bacteria) in resisting the invasion of pathogenic microorganisms [25,26,27]. IL-1 and IFN are important cytokines in the body, which play an important role in inducing and activating inflammatory response and regulating immune response [28]. MHC-I and IgM are important factors in the activation and effects of the specific immune system, and play an important role in antigen binding and inhibition of pathogen activity [29]. In this study, the activity and content of immune factors, such as C3, CH50, IL-1, lysozymes, IgM, and MHC-I in the serum and liver of grass carp, and the mRNA expression level of corresponding genes in different tissues, were detected to judge the effect of a common reed diet, instead of a wheat diet, on the immune performance of grass carp. The activity and content of immune factors showed that the contents of IL-1, C3 and cortisol in the serum, IL-1 and CH50 in the liver of grass carp in the substitution group increased with increase of the common reed replacement ratio. The changes of non-specific immune indices of grass carp in the 100% common reed substitution group were significantly different from those in the control group (p < 0.05), but there was no significant difference in IgM content (p > 0.05). From the change results of immune factor content, adding the proper amount of common reed to feed could enhance the nonspecific immune response of grass carp, but had no significant effect on the specific immune response. The results were consistent with the research results of Chen et al. [30], who found that rutin, an active ingredient in the common reed, could significantly improve the nonspecific immunity of grass carp. At the same time, the results of gene expression level showed that the mRNA expression level of the immune gene of grass carp in the 50% common reed substitution group was down-regulated compared with that in the control group, while the expression of Hsp70, IL-1, lysozymes, MHC-I, and IgM in head kidney and kidney of grass carp in the 100% common reed substitution group were up-regulated to varying degrees. This might be related to the abundant bioactive components in the roots, stems and leaves of the common reed, such as flavonoids, reed polysaccharides and rutin. Studies have shown that flavonoids and rutin have significant antibacterial and antioxidant properties, and increase immune response [31,32]. Therefore, combined with the changes of immune factor activity and content and gene mRNA expression level, adding a certain amount of common reed in feed can improve the nonspecific immune response level of grass carp.

5. Conclusions

In conclusion, this study indicated that the replacement of wheat with common reed could improve the liver structure and function of grass carp, and, at the same time, improve the level of non-specific immune response of grass carp to a certain extent. However, the most suitable amount of common reed in grass carp feed remains to be further studied.

Author Contributions

Conceptualization, R.W., Y.L. and C.L. (Congqiang Luo); Data curation, C.H. and L.S.; Formal analysis, R.W.; Funding acquisition, P.Y.; Methodology, R.W., C.L. (Chaobo Lei) and Z.L.; Project administration, C.L. (Chaobo Lei), Z.L., Y.L. and L.S.; Resources, L.S.; Software, Z.L.; Supervision, C.L. (Congqiang Luo); Writing—original draft, R.W.; Writing—review & editing, R.W., C.H. and P.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by The Natural Science Foundation of Hunan Province (Grant no. 2021JJ30468), The Investigation of Aquaculture Germplasm Resources in Hunan Province (Grant no. 2130122), The Research Project of Education Department of Hunan Province (Grant no. 22B0701 and 20A339), Innovation Platform project of Education Department of Hunan Province (Grant No. 19K064) and Hunan University of Arts and Science Doctoral Foundation project (Grant no. 18BSQD20).

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and all procedures used in this experiment were approved by the Hunan University of Arts and Science Institutional Animal Care and Use Committee and were performed in accordance with approved protocols, protocol code: JSDX-2021-025 and date of approval: 15 March 2021.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We would like to acknowledge the contribution of the college students (Zhiwei Zhang, Fengling He and Kang Huang) at Hunan University of Arts and Science for their roles in fish husbandry and for their assistance with sampling.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Köbbing, J.F.; Thevs, N.; Zerbe, S. The Utilisation of Reed (Phragmites australis): A Review. Mires Peat 2013, 13, 1–14. [Google Scholar]
  2. Chen, L.; Zhang, L.; Liu, Z.; Lu, F.; Feng, G.; Yan, K.; Han, G. Physiological and Ecological Responses of Hetan and Chaotan Phragmites australis to Salt Stress. Acta Ecol. Sin. 2020, 40, 2090–2098. [Google Scholar]
  3. Meneses, N.C.; Baier, S.; Reidelstürz, P.; Geist, J.; Schneider, T. Modelling Heights of Sparse Aquatic Reed (Phragmites australis) Using Structure from Motion Point Clouds Derived from Rotary- And Fixed-Wing Unmanned Aerial Vehicle (Uav) Data. Limnologica 2018, 72, 10–21. [Google Scholar] [CrossRef]
  4. Minkina, T.; Fedorenko, G.; Nevidomskaya, D.; Fedorenko, A.; Chaplygin, V.; Mandzhieva, S. Morphological and Anatomical Changes of Phragmites australis Cav. Due to the Uptake and Accumulation of Heavy Metals from Polluted Soils. Sci. Total Environ. 2018, 636, 392–401. [Google Scholar] [CrossRef]
  5. Zhang, S.; Bai, J.; Wang, W.; Huang, L.; Zhang, G.; Wang, D. Heavy Metal Contents and Transfer Capacities of Phragmites australis and Suaeda salsa in the Yellow River Delta, China. Phys. Chem. Earth Parts A/B/C 2018, 104, 3–8. [Google Scholar] [CrossRef]
  6. Hansson, P.; Fredriksson, H. Use of Summer Harvested Common Reed (Phragmites australis) as Nutrient Source for Organic Crop Production in Sweden. Agric. Ecosyst. Environ. 2004, 102, 365–375. [Google Scholar] [CrossRef]
  7. Zhou, J.; Wan, R.R.; Wu, X.H.; Zhang, Y. Patterns of Long-Term Distribution of Typical Wetland Vegetation (1987–2016) and its Response to Hydrological Processes in Lake Dongting. J. Lake Sci. 2020, 6, 1723–1735. [Google Scholar]
  8. Sun, Z.; Mou, X.; Sun, W. Potential Effects of Tidal Flat Variations on Decomposition and Nutrient Dynamics of Phragmites australis, Suaeda salsa and Suaeda glauca Litter in Newly Created Marshes of the Yellow River Estuary, China. Ecol. Eng. 2016, 93, 175–186. [Google Scholar] [CrossRef]
  9. Sun, Z.; Zhou, D.; Ferreira, L.M.M.; Zhong, Q.; Lou, Y. Diet Composition, Herbage Intake and Digestibility in Inner Mongolian Cashmere Goats Grazing on Native Leymus Chinensis Plant Communities. Livest. Sci. 2008, 116, 146–155. [Google Scholar] [CrossRef]
  10. Kadi, S.A.; Ouendi, M.; Bannelier, C.; Berchiche, M.; Gidenne, T. Nutritive Value of Sun-Dried Common Reed (Phragmites australis) Leaves and its Effect on Performance and Carcass Characteristics of the Growing Rabbit. World Rabbit. Sci. 2018, 26, 113–121. [Google Scholar] [CrossRef]
  11. Xiao, T.Y.; Zhou, Z.Y.; Wang, R.H.; Li, Y.G.; Jin, S.Z.; Li, W.; Wang, H.Q. The Expression and Transmission of Immune Factors Between Generations in Maternal Ctenopharyngodon idella After Immunization with Gcrv Attenuated Vaccine. J. Fish. China 2017, 8, 1308–1318. [Google Scholar]
  12. Chen, L.J.; Yu, E.M.; Wang, G.J.; Jun, X.; Yu, D.G.; Li, Z.F.; Zhang, K.; Gong, W.B.; Tian, J.J. Effects of Feeding with Broad Bean on the Immune Organ Ultrastructure and Expression of Immune Genes of Grass Carp. J. China Agric. Univ. 2019, 6, 92–103. [Google Scholar]
  13. Zhou, W.; Rahimnejad, S.; Lu, K.; Wang, L.; Liu, W. Effects of Berberine on Growth, Liver Histology, and Expression of Lipid-Related Genes in Blunt Snout Bream (Megalobrama amblycephala) Fed High-Fat Diets. Fish Physiol. Biochem. 2019, 45, 83–91. [Google Scholar] [CrossRef] [PubMed]
  14. Sun, S.; Wu, Y.; Yu, H.; Su, Y.; Ren, M.; Zhu, J.; Ge, X. Serum Biochemistry, Liver Histology and Transcriptome Profiling of Bighead Carp Aristichthys Nobilis Following Different Dietary Protein Levels. Fish Shellfish Immunol. 2019, 86, 832–839. [Google Scholar] [CrossRef]
  15. Jahanbakhshi, A.; Imanpoor, M.R.; Taghizadeh, V.; Shabani, A. Hematological and Serum Biochemical Indices Changes Induced by Replacing Fish Meal with Plant Protein (Sesame Oil Cake and Corn Gluten) in the Great Sturgeon (Huso huso). Comp. Clin. Pathol. 2013, 22, 1087–1092. [Google Scholar] [CrossRef]
  16. Guo, X.Z.; Liang, X.F.; Fang, L.; Yuan, X.C.; Zhou, Y.; Li, B. Effects of Non-Protein Energy Sources on Serum Biochemical Indices and Histology of Liver in Grass Carp (Ctenopharyngodon idella). Acta Hydrobiol. Sin. 2014, 3, 582–587. [Google Scholar]
  17. Jiang, D.; Wu, Y.; Huang, D.; Ren, X.; Wang, Y. Effect of Blood Glucose Level on Acute Stress Response of Grass Carp Ctenopharyngodon idella. Fish Physiol. Biochem. 2017, 43, 1433–1442. [Google Scholar] [CrossRef]
  18. Yang, L.; Hu, Y.; Zhu, B.; Zhong, L.; Wei, Z.H.; Tang, T.; Zhang, J.Z. Effects of Flammulina velutipes Stembase on Growth, Digestive Enzyme Activities, Intestinal Tissue Structure, Muscle Quality and Serum Biochemical Parameters of Grass Carp (Ctenopharyngodon idella). Chin. J. Anim. Nutr. 2021, 8, 4569–4579. [Google Scholar]
  19. Zhu, B.; Zhong, L.; Zhao, Q.; Dai, Z.; Chen, K.; Yi, H.U. Effects of Flammulina velutipes Medium Residue on Growth Performance, Intestinal Tissue Structure and Serum Biochemical, Immune and Antioxidant Indexes of Grass Carp. Chin. J. Anim. Nutr. 2020, 32, 2921–2929. [Google Scholar]
  20. Meton, I.; Mediavilla, D.; Caseras, A.; Canto, E.; Fernandez, F.; Baanante, I.V. Effect of Diet Composition and Ration Size on Key Enzyme Activities of Glycolysis-Gluconeogenesis, the Pentose Phosphate Pathway and Amino Acid Metabolism in Liver of Gilthead Sea Bream (Sparus aurata). Br. J. Nutr. 1999, 82, 223–232. [Google Scholar] [CrossRef] [Green Version]
  21. Peres, H.; Oliva-Teles, A. Effect of the Dietary Essential Amino Acid Pattern on Growth, Feed Utilization and Nitrogen Metabolism of European Sea Bass (Dicentrarchus labrax). Aquaculture 2007, 267, 119–128. [Google Scholar] [CrossRef]
  22. Cheng, Z.; Zhang, G.Q.; Zhou, L.; Xu, Z.; Yang, H.; Li, X.Q.; Leng, X.J. Effects of Citric Acid on Growth Performance, Nutrient Utilization, Serum Biochemical Indices and Intestinal Tissue Morphology of Grass Carp (Ctenopharyngodon idella). Chin. J. Anim. Nutr. 2021, 8, 4580–4591. [Google Scholar]
  23. Chen, Y.; Ronghua, L.U.; Yang, G.; Zhang, Y.; Qin, C.; Hong, J.I.; Nie, G. University, HN, Effects of Replacing Soybean Oil with Black Soldier Fly (Hermetia illucens) Larvae Oil on the Growth Performance, Antioxidant Ability and Intestinal Microbiota of Grass Carp (Ctenopharyngodon idella). J. Fish. China 2019, 10, 2241–2255. [Google Scholar]
  24. Smith, N.C.; Rise, M.L.; Christian, S.L. A Comparison of the Innate and Adaptive Immune Systems in Cartilaginous Fish, Ray-Finned Fish, and Lobe-Finned Fish. Front. Immunol. 2019, 10, 2292. [Google Scholar] [CrossRef] [Green Version]
  25. Li, L.; Cardoso, J.C.R.; Félix, R.C.; Mateus, A.P.; Canário, A.V.M.; Power, D.M. Fish Lysozyme Gene Family Evolution and Divergent Function in Early Development. Dev. Comp. Immunol. 2021, 114, 103772. [Google Scholar] [CrossRef] [PubMed]
  26. Song, Q.; Xiao, Y.; Xiao, Z.; Liu, T.; Li, J.; Li, P.; Han, F. Lysozymes in Fish. J. Agric. Food Chem. 2021, 50, 15039–15051. [Google Scholar] [CrossRef]
  27. Demers, N.; Bayne, C. Immediate Increase of Plasma Protein Complement C3 in Response to an Acute Stressor. Fish Shellfish Immunol. 2020, 107, 411–413. [Google Scholar] [CrossRef]
  28. Langevin, C.; Aleksejeva, E.; Passoni, G.; Palha, N.; Levraud, J.; Boudinot, P. The Antiviral Innate Immune Response in Fish: Evolution and Conservation of the IFN System. J. Mol. Biol. 2013, 425, 4904–4920. [Google Scholar] [CrossRef]
  29. Workenhe, S.T.; Rise, M.L.; Kibenge, M.J.T.; Kibenge, F.S.B. The Fight Between the Teleost Fish Immune Response and Aquatic Viruses. Mol. Immunol. 2010, 47, 2525–2536. [Google Scholar] [CrossRef] [PubMed]
  30. Chen, M.; Guoxiang, F.U.; Dong, J.; Hao, W. Effects of Rutin on Growth Performance, Body Composition, Non-Specific Immunity and Intestinal Digestive Enzyme Activities of Grass Carp (Ctenopharyngodon idella). Chin. J. Anim. Nutr. 2019, 10, 4868–4876. [Google Scholar]
  31. Catoni, C.; Schaefer, H.M.; Peters, A. Fruit for Health: The Effect of Flavonoids on Humoral Immune Response and Food Selection in a Frugivorous Bird. Funct. Ecol. 2008, 22, 649–654. [Google Scholar] [CrossRef]
  32. Guardia, T.; Rotelli, A.E.; Juarez, A.O.; Pelzer, L.E. Anti-Inflammatory Properties of Plant Flavonoids. Effects of Rutin, Quercetin and Hesperidin on Adjuvant Arthritis in Rat. Farmaco 2001, 56, 683–687. [Google Scholar] [CrossRef] [PubMed]
Fishes 07 00378 g001 550
Figure 1. Effect of common reed on liver histology of grass carp (200 times). (a,b): 0% replacement group; (c,d): 50% replacement group; (e,f): 100% replacement group. The triangle in the figure indicates lymphocyte cells, and the arrow indicates vacuolar degeneration of cells.
Figure 1. Effect of common reed on liver histology of grass carp (200 times). (a,b): 0% replacement group; (c,d): 50% replacement group; (e,f): 100% replacement group. The triangle in the figure indicates lymphocyte cells, and the arrow indicates vacuolar degeneration of cells.
Fishes 07 00378 g001
Fishes 07 00378 g002 550
Figure 2. Effect of common reed on content and activity of immune factors in serum (A) and liver (B) of grass carp (N = 3). The units of IgM, IL-1, C3, CH50 and Cortisol were μg/mL, pg/mL, μg/mL, U/mL and ng/mL respectively. Different small letters mean significant difference among groups (p < 0.05), the same letters or no letters mean no significant difference (p > 0.05).
Figure 2. Effect of common reed on content and activity of immune factors in serum (A) and liver (B) of grass carp (N = 3). The units of IgM, IL-1, C3, CH50 and Cortisol were μg/mL, pg/mL, μg/mL, U/mL and ng/mL respectively. Different small letters mean significant difference among groups (p < 0.05), the same letters or no letters mean no significant difference (p > 0.05).
Fishes 07 00378 g002
Fishes 07 00378 g003 550
Figure 3. Effect of common reed on expression of immune genes in head kidney (A), liver (B), spleen (C) and kidney (D) of grass carp (N = 3). Different letters mean significant difference among groups (p < 0.05), the same letters or no letters mean no significant difference (p > 0.05).
Figure 3. Effect of common reed on expression of immune genes in head kidney (A), liver (B), spleen (C) and kidney (D) of grass carp (N = 3). Different letters mean significant difference among groups (p < 0.05), the same letters or no letters mean no significant difference (p > 0.05).
Fishes 07 00378 g003
Table
Table 1. Main active ingredients of common reed and wheat medium residue (air-dry basis%).
Table 1. Main active ingredients of common reed and wheat medium residue (air-dry basis%).
ItemsMoistureCrude ProteinAshCrude FiberCrude FatGross Energy (MJ/kg)
Common reed10.9314.166.4339.271.617.73
Wheat10.6114.186.611.881.718.24
Table
Table 2. Composition and nutrient levels of experimental diets (dry matter %).
Table 2. Composition and nutrient levels of experimental diets (dry matter %).
ItemsDiets
050%100%
Ingredients
Wheat30150
Common reed01530
Soybean meal303030
Fish meal333
Rapeseed meal262626
Ca(H2PO4)22.52.52.5
Carboxymethyl Cellulose222
Choline chloride0.150.150.15
Bentonite clay1.351.351.35
Vitamin premix 1111
Mineral premix 2111
Soybean oil333
Total100100100
Nutrient levels 3
Crude protein32.6133.1033.00
Crude fat4.824.604.77
Crude fiber4.849.2413.87
Crude ash9.9511.2012.45
Gross energy (kJ/g)19.9619.8619.84
1. Vitamin premix (mg/kg diet): vitamin A, 120,000 IU, vitamin B1, 200 mg, vitamin B2, 280 mg, vitamin B8, 240 mg, vitamin B12, 0.6 mg, vitamin D3, 40,000 IU, vitamin E 480 mg, vitamin K3, 200 mg, biotin 1.2 mg, folic acid, 60 mg, calcium pantothenic, 720 mg, nicotinic acid, 1000 mg, vitamin C phosphate, 6850 mg, inositol, 3200 mg; 2. Mineral premix (mg/kg diet): Cu (as copper sulfate) l60 mg, Fe (as ferrous sulfate) 4800 mg, Mn (as manganese sulfate) 800 mg, Zn (as zinc sulfate) 2000 mg, I (as potassium iodide) 40 mg, Se (as sodium selenite )4 mg, Mg (as magnesium sulfate) 400 mg, Co (as cobalt dichloride)12 mg; 3. Nutrient levels were measured values. Nutrient contents analyzed according to AOAC (1995) protocols.
Table
Table 3. The primers used in this study.
Table 3. The primers used in this study.
PrimersPrimer Sequence (5′-3′)References
IgM-FTGGTCATCAGGTGGCAAA[11]
IgM-RGCGGCTGTCTTCCATTCT
lysozyme-FTTCGACAGCAAAACAGGACAAC[11]
lysozyme-RGATATGATGGCAGCAATCACAGC
C3-FAATACGCCATTCCTGAGGTTTCC[11]
C3-RCTTCCACCATTTCACTGCCACTT
IL-1-FTACCGAGTCGGATGGTTCTTC[12]
IL-1-RTGTTATTAGCCACACCGGTCTC
IFN-I-FCGGCCGATACAGGATGATAAG[12]
IFN-I-RTCCTCCACCTTGGCATTGTC
MHC-I-FCCTGCTAATCCTCAAGCTGTCA[12]
MHC-I-RGCATGACACGTCACTGGAGAG
Hsp70-FGTGTCCATCCTGACCATTGA[12]
Hsp70-RATCTGGATTGATGCTCTTGTT
Actin-FGCTATGTGGCTCTTGACTTCG[12]
Actin-RGGGCACCTGAACCTCTCATT
Table
Table 4. Effects of common reed on serum biochemical parameters of grass carp (N = 3).
Table 4. Effects of common reed on serum biochemical parameters of grass carp (N = 3).
Items0%50%100%
TP (g/L)32.97 ± 3.2936.50 ± 1.8734.57 ± 0.35
ALB (g/L)15.73 ± 1.1117.00 ± 1.0415.70 ± 0.40
GLB/(g/L)17.23 ± 2.1819.50 ± 0.9018.87 ± 0.64
GLU (mmol/L)9.85 ± 0.81 a6.35 ± 0.56 b7.68 ± 1.02 ab
ALT/(U/L)22.35 ± 2.05 c64.60 ± 8.34 b98.05 ± 1.48 a
AST/(U/L)47.00 ± 3.11 b84.10 ± 17.25 a51.45 ± 0.92 b
Different superscript letters of peer data indicate significant difference between the two groups (p < 0.05), while the same or no superscript letters indicate no significant difference between the two groups (p > 0.05).
Table
Table 5. Histological parameters of liver from grass carp fed experimental diets.
Table 5. Histological parameters of liver from grass carp fed experimental diets.
Items0%50%100%
The area ratio of hepatocyte vacuolization (%) 113.26 ± 1.9 a3.37 ± 0.52 b2.69 ± 0.67 b
The number of hepatocyte vacuolization74.33 ± 13.01 a22.33 ± 2.52 b32.33 ± 2.52 b
1 The area ratio of hepatocyte vacuolization (%) = The area of hepatocyte vacuolization (pixels)/The area of image (pixels) × 100%. Different superscript letters of peer data indicate significant difference between the two groups (p < 0.05), while the same or no superscript letters indicate no significant difference between the two groups (p > 0.05).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wang, R.; Lei, C.; Li, Z.; Lei, Y.; Luo, C.; Shao, L.; Huang, C.; Yang, P. Effects of a Diet of Phragmites australis instead of Triticum aestivum L. on Immune Performance and Liver Tissue Structure of Ctenopharyngodon idellus. Fishes 2022, 7, 378. https://doi.org/10.3390/fishes7060378

AMA Style

Wang R, Lei C, Li Z, Lei Y, Luo C, Shao L, Huang C, Yang P. Effects of a Diet of Phragmites australis instead of Triticum aestivum L. on Immune Performance and Liver Tissue Structure of Ctenopharyngodon idellus. Fishes. 2022; 7(6):378. https://doi.org/10.3390/fishes7060378

Chicago/Turabian Style

Wang, Ronghua, Chaobo Lei, Zhenyu Li, Yanju Lei, Congqiang Luo, Liye Shao, Chunhong Huang, and Pinhong Yang. 2022. "Effects of a Diet of Phragmites australis instead of Triticum aestivum L. on Immune Performance and Liver Tissue Structure of Ctenopharyngodon idellus" Fishes 7, no. 6: 378. https://doi.org/10.3390/fishes7060378

Article Metrics

Back to TopTop