Comprehensive Analysis of Cyan Soft-Carapace and Red Hard-Carapace Color Variants in Procambarus clarkii: Muscle Quality, Carapace Pigmentation, and Tissue-Specific DGAT2 mRNA Expression
Abstract
1. Introduction
2. Materials and Methods
2.1. Feeding Management
2.2. Measurement of Crustacean Chromaticity
2.3. Physical and Chemical Properties
2.4. Textural Properties
2.5. Whole-Body Composition
2.6. Determination of Carotenoids
2.7. Quantitative Real-Time PCR (qPCR)
2.8. Statistical Analysis
3. Results
3.1. Crustacean Chromaticity
3.2. Physicochemical Indices of Muscle Tissue
3.3. Textural Properties of Muscles
3.4. Whole Body Composition
3.5. Carotenoid Content
3.6. Expression of Genes Related to Body Color Formation
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| DGAT2 | Diacylglycerol acyltransferase 2 |
References
- Amine, T.M.; Aiad, A.S.; Abu El-Nile, M.O. Evaluation of chemical quality and nutrition value of fresh water cray fish (Procambarus clarkii). J. High Inst. Public Health 2008, 38, 1–13. [Google Scholar] [CrossRef]
- Bureau of Fisheries and Fishery Management; Ministry of Agriculture and Rural Affairs. China Fisheries Statistical Yearbook 2021; China Agriculture Press: Beijing, China, 2021. [Google Scholar]
- Crandall, K.A.; De Grave, S. An updated classification of the freshwater crayfishes (Decapoda: Astacidea) of the world, with a complete species list. J. Crustac. Biol. 2017, 37, 615–653. [Google Scholar] [CrossRef]
- Xu, Z.; Zhao, C.; Zhou, X. The relation between carapace color and growth of Procambarus clarkii. Acta Agric. Zhejiangensis 2010, 22, 839–842. (In Chinese) [Google Scholar] [CrossRef]
- Mao, T.; Yu, Y.; He, L.; Zhang, T.; Zhang, L.; Deng, W.; Zhang, X.; Zhang, H.; Dong, L. The nutritional quality discrepany of different sizes and colour of Procambarus clarkii. Freshw. Fish. 2020, 50, 77–82. (In Chinese) [Google Scholar] [CrossRef]
- Liu, Y.; He, J.; Yin, W.; Shen, Y.; Zhang, X. Survey on crayfish consumption in Wuxi market. J. Aquac. 2022, 43, 71–73. (In Chinese) [Google Scholar] [CrossRef]
- Walker, M.L.; Austin, C.M.; Meewan, M. Evidence for the inheritance of a blue variant of the Australian fresh-water crayfish Cherax destructor (Decapoda: Parastacidae) as an autosomal recessive. J. Crustac. Biol. 2000, 20, 25–30. [Google Scholar] [CrossRef]
- Patoka, J.; Římalová-Kadlecová, K.; Bílý, M.; Koščo, J. Frequency of new marble-colored morph in wild population of Austropotamobius torrentium (Decapoda: Astacidae). Biologia 2013, 68, 707–711. [Google Scholar] [CrossRef]
- Abramczyk, H.; Imiela, A.; Śliwińska, A. Novel strategies of Raman imaging for exploring cancer lipid reprogramming. J. Mol. Liq. 2019, 274, 52–59. [Google Scholar] [CrossRef]
- Lee, M.-C.; Park, J.C.; Lee, J.-S. Effects of environmental stressors on lipid metabolism in aquatic invertebrates. Aquat. Toxicol. 2018, 200, 83–92. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; McFie, P.J.; Bannan, S.L.; Brandt, C.; Stone, S.J. Diacylglycerol acyltransferase-2 (DGAT2) and monoacylglycerol acyltransferase-2 (MGAT2) interact to promote triacylglycerol synthesis. J. Biol. Chem. 2014, 289, 28237–28248. [Google Scholar] [CrossRef] [PubMed]
- Tang, Z.; Li, C.; Xu, G.; Zhao, Q.; Wei, Z.; Liu, S. Effects of dietary glutathione on growth performance, muscle quality and lipid metabolism of hybrid crucian carp (Carassius auratus cuvieri ♀ × Carassius auratus red var. ♂) fed a high-fat diet. Reprod. Breed. 2023, 3, 89–98. [Google Scholar] [CrossRef]
- Chang, G.; Kong, F.; Gao, S.; Cai, H.; Wang, L.; Ding, H.; Cheng, Y.; Li, J. Comparative transcriptome analysis reveals molecular mechanism of temperature effect on body color of red swamp crayfish (Procambarus clarkii). Comp. Biochem. Physiol. Part D. Genom. Proteom. 2026, 50, 101751. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Chen, J.; Huang, L.; Wu, B.; Wu, C.; He, J.; Bai, Z. PcASTA in Procambarus clarkii, a novel astaxanthin gene affecting shell color. Front. Mar. Sci. 2024, 10, 1343126. [Google Scholar] [CrossRef]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2017. CA A Cancer J. Clin. 2017, 67, 7–30. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Li, T.; Jin, Y.; Shen, J. Dgat2 reduces hepatocellular carcinoma malignancy via downregulation of cell cycle-related gene expression. Biomed. Pharmacother. 2019, 115, 108950. [Google Scholar] [CrossRef] [PubMed]
- Hong, Y.; Sun, K.; Zhu, X.; Zhu, X.; Deng, Q.; Huang, Y.; Hao, R.; Zhu, C. Identification of genes and SNPs related to body colors by transcriptome profiling in leopard coral grouper (Plectropomus leopardus Lacépède). J. Appl. Ichthyol. 2023, 2023, 4135906. [Google Scholar] [CrossRef]
- Lin, S.; Hossain, A.; Shahidi, F. Dietary lipid and astaxanthin contents affect the pigmentation of Arctic charr (Salvelinus alpinus). Food Prod. Process. Nutr. 2024, 6, 77. [Google Scholar] [CrossRef]
- International Commission on Illumination. CIE Recommendations on Uniform Color Spaces, Color-Difference Equations, and Metric Color Terms; Publication No. 15; CIE Central Bureau: Vienna, Austria, 1976. [Google Scholar]
- Cao, L.; Rasco, B.A.; Tang, J.; Liu, L.; Lai, K.; Fan, Y.; Huang, Y. Effects of freshness on the cook loss and shrinkage of grass carp (Ctenopharyngodon idellus) fillets following pasteurization. Int. J. Food Prop. 2016, 19, 2297–2306. [Google Scholar] [CrossRef]
- Sánchez-Alonso, I.; Haji-Maleki, R.; Borderías, A.J. Wheat fiber as a functional ingredient in restructured fish products. Food Chem. 2007, 100, 1037–1043. [Google Scholar] [CrossRef]
- Yang, Z.; Jiang, Q.; Zhang, W.; Xia, S.; Tian, H.; Liu, F.; Yang, W.; Yu, Y.; Wu, Y.; Zhu, Y.; et al. Comparison of morphometric parameters, nutritional composition, and textural properties of seven crustaceans species. Fishes 2024, 9, 141. [Google Scholar] [CrossRef]
- Fuentes, A.; Fernández-Segovia, I.; Serra, J.A.; Barat, J.M. Comparison of wild and cultured sea bass (Dicentrarchus labrax) quality. Food Chem. 2010, 119, 1514–1518. [Google Scholar] [CrossRef]
- AOAC. Official Methods of Analysis of the Association of Official Analytical Chemists, 15th ed.; Association of Official Analytical Chemists Inc.: Arlington, VA, USA, 2003. [Google Scholar]
- Ai, Z.; Yang, Z.; Ming, J.; Zhang, L.; Chen, X.; Xu, Z.; Zhang, W.; Wang, A.; Tian, H.; Xia, S.; et al. Effects of Four Light Colors on Physiology, Antioxidant Enzyme Activity, Shell Pigmentation, and Genes Associated with Body Color Formation in Procambarus clarkii. Fishes 2026, 11, 54. [Google Scholar] [CrossRef]
- Rocha, F.; Baião, L.F.; Moutinho, S.; Reis, B.; Oliveira, A.; Arenas, F.; Maia, M.R.G.; Fonseca, A.J.M.; Pintado, M.; Valente, L.M.P. The effect of sex, season and gametogenic cycle on gonad yield, biochemical composition and quality traits of Paracentrotus lividus along the North Atlantic coast of Portugal. Sci. Rep. 2019, 9, 2994. [Google Scholar] [CrossRef] [PubMed]
- Akhtar, P.; Gray, J.I.; Cooper, T.H.; Garling, D.L.; Booren, A.M. Dietary pigmentation and deposition of α-tocopherol and carotenoids in rainbow trout muscle and liver tissue. J. Food Sci. 1999, 64, 234–239. [Google Scholar] [CrossRef]
- San-Jose, L.M.; Granado-Lorencio, F.; Fitze, P.S. Dietary lipids reduce the expression of carotenoid-based coloration in Lacerta vivipara. Funct. Ecol. 2012, 26, 646–656. [Google Scholar] [CrossRef]
- Song, Z.; Liu, Y.; Liu, H.; Ye, Z.; Ma, Q.; Wei, Y.; Xiao, L.; Liang, M.; Xu, H. Dietary lysophosphatidylcholine improves the uptake of astaxanthin and modulates cholesterol transport in Pacific white shrimp Litopenaeus vannamei. Antioxidants 2024, 13, 505. [Google Scholar] [CrossRef] [PubMed]
- Lamberts, L.; Delcour, J.A. Carotenoids in raw and parboiled brown and milled rice. J. Agric. Food Chem. 2008, 56, 11914–11919. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Ma, Z.; Li, W.; Xue, Y.; Moss, A.S.; Wu, M. Impact of β-carotene enrichment on carotenoid composition and gene expression in Artemia metanauplii. Metabolites 2024, 14, 676. [Google Scholar] [CrossRef] [PubMed]
- Wade, N.M.; Goulter, K.C.; Wilson, K.J.; Hall, M.R.; Degnan, B.M. Esterified astaxanthin levels in lobster epithelia correlate with shell colour intensity: Potential role in crustacean shell colour formation. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2005, 141, 307–313. [Google Scholar] [CrossRef]
- King, D.A.; Shackelford, S.D.; Wheeler, T.L. Relative contributions of animal and muscle effects to variation in beef lean color stability. J. Anim. Sci. 2011, 89, 1434–1451. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Feng, L.; Jiang, W.-D.; Wu, P.; Liu, Y.; Jiang, J.; Kuang, S.-Y.; Tang, L.; Zhou, X.-Q. Different dietary protein levels affect flesh quality, fatty acids and alter gene expression of Nrf2-mediated antioxidant enzymes in the muscle of grass carp (Ctenopharyngodon idella). Aquaculture 2018, 493, 272–282. [Google Scholar] [CrossRef]
- Han, M.; Wang, P.; Xu, X.; Zhou, G. Low-field NMR study of heat-induced gelation of pork myofibrillar proteins and its relationship with microstructural characteristics. Food Res. Int. 2014, 62, 1175–1182. [Google Scholar] [CrossRef]
- El-Dengawy, R.A.; Sharaf, A.M.; El-Kadi, S.M.; Mahmoud, E.A.; Baidoon, E.M. Effect of frozen storage on the chemical, physical and microbiological quality of imported mackerel (Scomber scombrus). J. Food Dairy Sci. 2017, 8, 287–293. [Google Scholar] [CrossRef]
- Liu, B.; Wan, J.; Ge, X.; Xie, J.; Zhou, Q.; Miao, L.; Ren, M.; Pan, L. Effects of dietary vitamin C on the physiological responses and disease resistance to pH stress and Aeromonas hydrophila infection of Megalobrama amblycephala. Turk. J. Fish. Aquat. Sci. 2016, 16, 421–433. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Wang, J.; Tang, R.; He, X.; Li, L.; Takagi, Y.; Li, D. Improvement of muscle quality of grass carp (Ctenopharyngodon idellus) with a bio-floating bed in culture ponds. Front. Physiol. 2019, 10, 683. [Google Scholar] [CrossRef] [PubMed]
- Larsson, T.; Koppang, E.O.; Espe, M.; Terjesen, B.F.; Krasnov, A.; Moreno, H.M.; Rørvik, K.-A.; Thomassen, M.; Mørkøre, T. Fillet quality and health of Atlantic salmon (Salmo salar L.) fed a diet supplemented with glutamate. Aquaculture 2014, 426–427, 288–295. [Google Scholar] [CrossRef]
- Wang, M.; Feng, L.; Wu, P.; Liu, Y.; Ren, H.; Jin, X.; Zhou, X.; Jiang, W. Regulation of muscle springiness and hardness: The role of myo-inositol in enhancing fish flesh texture. Food Chem. X 2025, 29, 102788. [Google Scholar] [CrossRef] [PubMed]
- Ayala, M.D.; Hernández-Urcera, J.; Santaella, M.; Cal, R. Lasting Temperature Effects on the Muscle Tissue, Body Growth, and Fillet Texture of Adult Turbots, Scophthalmus maximus L. J. World Aquac. Soc. 2016, 47, 759–767. [Google Scholar] [CrossRef]
- Lee, Y.; Hwang, Y.; Kim, M.; Jeon, H.; Joo, S.; Fang, S.; Kim, J.-W. DGAT2 plays a crucial role to control ESRRA-PROX1 transcriptional network to maintain hepatic mitochondrial sustainability. Diabetes Metab. J. 2024, 48, 901–914. [Google Scholar] [CrossRef] [PubMed]
- Yan, J.; Liao, K.; Wang, T.; Mai, K.; Xu, W.; Ai, Q. Dietary lipid levels influence lipid deposition in the liver of large yellow croaker (Larimichthys crocea) by regulating lipoprotein receptors, fatty acid uptake and triacylglycerol synthesis and catabolism at the transcriptional level. PLoS ONE 2015, 10, e0129937. [Google Scholar] [CrossRef] [PubMed]
- Moruf, R.O.; Akinwunmi, M.F.; Lawal-Are, A.O. Chemometric estimation of captured Farfantepenaeus notialis Pérez-Farfante 1967 (Crustacea: Penaeidae). Acta Sci. Pol. Technol. Aliment. 2021, 20, 291–299. [Google Scholar] [CrossRef] [PubMed]
- Bentov, S.; Abehsera, S.; Sagi, A. The mineralized exoskeletons of crustaceans. In Extracellular Composite Matrices in Arthropods; Cohen, E., Moussian, B., Eds.; Springer: Berlin/Heidelberg, Germany, 2016; pp. 137–163. [Google Scholar]
- Zhou, F.; Wu, Z.; Wang, M.; Chen, K. Structure and mechanical properties of pincers of lobster (Procambarus clarkii) and crab (Eriocheir sinensis). J. Mech. Behav. Biomed. Mater. 2010, 3, 454–463. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Hu, J.; Wang, S.; Cheng, J.; Hu, X.; Lu, Z.; Lin, Z.; Bao, Z. Isolation and identification of the main carotenoid pigment from the rare orange muscle of the Yesso scallop. Food Chem. 2010, 118, 616–619. [Google Scholar] [CrossRef]
- Li, X.; Bai, Z.; Luo, H.; Wang, G.; Li, J. Comparative analysis of total carotenoid content in tissues of purple and white inner-shell color pearl mussel, Hyriopsis cumingii. Aquac. Int. 2014, 22, 1577–1585. [Google Scholar] [CrossRef]
- Gao, H.; Ma, H.; Sun, J.; Xu, W.; Gao, W.; Lai, X.; Yan, B. Expression and function analysis of crustacyanin gene family involved in resistance to heavy metal stress and body color formation in Exopalaemon carinicauda. J. Exp. Zool. Part B Mol. Dev. Evol. 2021, 336, 352–363. [Google Scholar] [CrossRef] [PubMed]
- Wade, N.M.; Gabaudan, J.; Glencross, B.D. A review of carotenoid utilisation and function in crustacean aquaculture. Rev. Aquac. 2015, 9, 141–156. [Google Scholar] [CrossRef]
- Shahidi, F.; Brown, J.A. Carotenoid pigments in seafoods and aquaculture. Crit. Rev. Food Sci. Nutr. 1998, 38, 1–67. [Google Scholar] [CrossRef] [PubMed]
- Shimidzu, N.; Goto, M.; Miki, W. Carotenoids as singlet oxygen quenchers in marine organisms. Fish. Sci. 1996, 62, 134–137. [Google Scholar] [CrossRef]
- Boonyaratpalin, M.; Thongrod, S.; Supamattaya, K.; Britton, G.; Schlipalius, L.E. Effects of β-carotene source, Dunaliella salina, and astaxanthin on pigmentation, growth, survival and health of Penaeus monodon. Aquac. Res. 2001, 32, 182–190. [Google Scholar] [CrossRef]
- Vogt, G.; Stöcker, W.; Storch, V.; Zwilling, R. Biosynthesis of Astacus protease, a digestive enzyme from crayfish. Histochemistry 1989, 91, 373–381. [Google Scholar] [CrossRef] [PubMed]
- Zhong, H.; Zhou, Y.; Xu, Q.; Yan, J.; Zhang, X.; Zhang, H.; Tang, Z.; Xiao, J.; Guo, Z.; Luo, Y.; et al. Low expression of miR-19a-5p is associated with high mRNA expression of diacylglycerol O-acyltransferase 2 (DGAT2) in hybrid tilapia. Genomics 2021, 113, 2392–2399. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Sun, Q.; Liu, Q.; Cheng, Y.; Wu, X. Estimation of genetic parameters for carotenoid traits in Chinese mitten crab, Eriocheir sinensis, females. Aquaculture 2021, 532, 735990. [Google Scholar] [CrossRef]
- Wu, S.; Huang, J.; Li, Y.; Zhao, L.; Liu, Z. Analysis of yellow mutant rainbow trout transcriptomes at different developmental stages reveals dynamic regulation of skin pigmentation genes. Sci. Rep. 2022, 12, 256. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.; Huang, J.; Li, Y.; Sun, T. Insights into molecular mechanisms of skin color variation in hybrid F1 of wild-type rainbow trout ♂ × yellow mutant rainbow trout ♀ through whole transcriptome and ceRNA network analysis. Aquac. Rep. 2024, 36, 102183. [Google Scholar] [CrossRef]
- Zhao, W.; Chen, X.; Arif, A.; Guo, Z.; Kanika, N.H.; Song, Y.; Wang, J.; Wang, C. Integrative Methylome and Transcriptome Analysis Reveals Epigenetic Regulation of Pigmentation in Oujiang Color Common Carp. Int. J. Mol. Sci. 2025, 26, 10001. [Google Scholar] [CrossRef] [PubMed]
- Nagaraju, G.P.C. Reproductive regulators in decapod crustaceans: An overview. J. Exp. Biol. 2011, 214, 3–16. [Google Scholar] [CrossRef] [PubMed]





| Gene | Sequences |
|---|---|
| β-actin-F | GAGGTTGCTGCCCTGGTT |
| β-actin-R | TAGCGGGAGTGTTGAAAG |
| DGAT2-F | TTGCGCCTCTCAACATCCC |
| DGAT2-R | ACTCAATCCTCCTGCCACCC |
| Groups | Two-Way ANOVA | |||||||
|---|---|---|---|---|---|---|---|---|
| Cyan Soft-Carapace♀ | Cyan Soft-Carapace♂ | Red Hard-Carapace♀ | Red Hard-Carapace♂ | Color | Sex | Color × Sex | ||
| Cephalothorax carapace | L | 18.82 ± 0.59 ab | 18.14 ± 1.23 ab | 17.71 ± 0.67 b | 21.16 ± 0.47 a | 0.012 | 0.008 | 0.019 |
| a* | 9.59 ± 0.35 | 11.37 ± 0.76 | 9.96 ± 0.86 | 9.80 ± 0.81 | 0.733 | 0.452 | 0.923 | |
| b* | 9.61 ± 0.49 | 9.73 ± 0.51 | 9.24 ± 0.67 | 11.18 ± 0.12 | 0.172 | 0.385 | 0.484 | |
| Abdomen carapace | L | 17.34 ± 1.03 | 17.43 ± 0.83 | 15.34 ± 0.63 | 16.28 ± 0.72 | 0.911 | 0.498 | 0.609 |
| a* | 14.40 ± 0.53 | 13.14 ± 0.49 | 13.67 ± 1.10 | 14.41 ± 0.84 | 0.550 | 0.625 | 0.573 | |
| b* | 13.41 ± 0.39 | 10.83 ± 0.68 | 11.99 ± 0.75 | 13.29 ± 0.73 | 0.012 | 0.031 | 0.015 | |
| Cheliped carapace | L | 23.02 ± 1.21 | 21.25 ± 0.59 | 23.55 ± 1.73 | 21.57 ± 0.74 | 0.980 | 0.554 | 0.925 |
| a* | 19.75 ± 0.84 | 21.41 ± 1.51 | 20.17 ± 1.51 | 18.36 ± 1.24 | 0.151 | 0.166 | 0.161 | |
| b* | 14.13 ± 0.70 | 14.91 ± 1.01 | 16.32 ± 1.49 | 16.77 ± 1.18 | 0.560 | 0.226 | 0.246 | |
| Groups | Two-Way ANOVA | |||||||
|---|---|---|---|---|---|---|---|---|
| Cyan Soft-Carapace♀ | Cyan Soft-Carapace♂ | Red Hard-Carapace♀ | Red Hard-Carapace♂ | Carapace Color | Sex | Carapace Color × Sex | ||
| Chroma | L | 40.62 ± 2.12 a | 39.73 ± 1.08 ab | 35.75 ± 0.95 ab | 34.16 ± 1.77 b | 0.221 | 0.648 | 0.826 |
| a* | 12.45 ± 0.31 c | 16.28 ± 0.21 a | 13.79 ± 0.72 bc | 14.25 ± 0.18 b | 0.001 | 0.047 | 0.002 | |
| b* | 11.43 ± 0.21 bc | 14.65 ± 0.55 a | 9.22 ± 0.88 c | 12.35 ± 0.80 ab | 0.214 | 0.481 | 0.685 | |
| Drip loss (%) 1 | 28.56 ± 0.60 a | 27.74 ± 1.78 ab | 22.94 ± 0.84 b | 26.11 ± 1.30 ab | 0.560 | 0.101 | 0.141 | |
| Cooking loss (%) 2 | 18.33 ± 1.37 a | 6.32 ± 0.85 c | 13.61 ± 1.25 b | 6.27 ± 0.38 c | 0.197 | 0.438 | 0.055 | |
| pH | 4.85 ± 0.02 b | 4.88 ± 0.03 b | 4.88 ± 0.04 b | 5.09 ± 0.06 a | 0.012 | 0.011 | 0.053 | |
| Items | Groups | Two-Way ANOVA | |||||
|---|---|---|---|---|---|---|---|
| Cyan Soft-Carapace♀ | Cyan Soft-Carapace♂ | Red Hard-Carapace♀ | Red Hard-Carapace♂ | Carapace Color | Sex | Carapace Color × Sex | |
| Hardness (g) | 248.80 ± 25.06 b | 325.19 ± 14.96 b | 612.01 ± 60.12 a | 731.50 ± 37.22 a | 0.010 | 0.160 | 0.557 |
| Springiness (mm) | 0.92 ± 0.02 | 0.90 ± 0.02 | 0.90 ± 0.02 | 0.85 ± 0.02 | 0.650 | 0.758 | 0.884 |
| Chewiness (mJ) | 58.02 ± 8.96 c | 244.56 ± 23.92 b | 222.33 ± 19.66 b | 351.04 ± 12.64 a | 0.406 | 0.019 | 0.371 |
| Cohesiveness (%) | 0.64 ± 0.02 | 0.62 ± 0.02 | 0.65 ± 0.02 | 0.59 ± 0.01 | 0.004 | 0.019 | 0.005 |
| Resilience (MPa) | 0.54 ± 0.03 | 0.57 ± 0.03 | 0.54 ± 0.08 | 0.58 ± 0.06 | 0.009 | 0.002 | 0.002 |
| Brittleness (g) | 248.80 ± 25.06 b | 325.19 ± 59.85 b | 612.01 ± 60.12 a | 764.22 ± 25.07 a | 0.132 | 0.032 | 0.162 |
| Gumminess (N) | 62.43 ± 11.09 c | 205.03 ± 40.75 b | 258.79 ± 22.53 b | 403.72 ± 15.04 a | 0.295 | 0.023 | 0.420 |
| Items | Groups | Two-Way ANOVA | |||||
|---|---|---|---|---|---|---|---|
| Cyan Soft-Carapace♀ | Cyan Soft-Carapace♂ | Red Hard-Carapace♀ | Red Hard-Carapace♂ | Carapace Color | Sex | Carapace Color × Sex | |
| Moisture (%) | 73.43 ± 0.81 | 75.93 ± 2.65 | 73.69 ± 1.15 | 70.77 ± 2.09 | 0.105 | 0.208 | 0.176 |
| Protein (%) | 10.42 ± 0.21 | 10.49 ± 1.39 | 9.89 ± 0.68 | 10.87 ± 1.21 | 0.693 | 0.798 | 0.661 |
| Lipid (%) | 3.37 ± 0.06 a | 3.33 ± 0.39 a | 3.51 ± 0.14 a | 1.91 ± 0.09 b | 0.002 | 0.056 | 0.007 |
| Ash (%) | 9.79 ± 0.94 ab | 6.06 ± 0.95 b | 9.15 ± 0.38 ab | 12.24 ± 0.93 a | 0.001 | 0.004 | 0.003 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Xia, S.; Liu, Y.; Zhang, J.; Dong, Y.; Yuan, X.; Hu, K.; Yang, S.; Ai, Z.; Li, M.; Song, G.; et al. Comprehensive Analysis of Cyan Soft-Carapace and Red Hard-Carapace Color Variants in Procambarus clarkii: Muscle Quality, Carapace Pigmentation, and Tissue-Specific DGAT2 mRNA Expression. Fishes 2026, 11, 393. https://doi.org/10.3390/fishes11070393
Xia S, Liu Y, Zhang J, Dong Y, Yuan X, Hu K, Yang S, Ai Z, Li M, Song G, et al. Comprehensive Analysis of Cyan Soft-Carapace and Red Hard-Carapace Color Variants in Procambarus clarkii: Muscle Quality, Carapace Pigmentation, and Tissue-Specific DGAT2 mRNA Expression. Fishes. 2026; 11(7):393. https://doi.org/10.3390/fishes11070393
Chicago/Turabian StyleXia, Silei, Yunqing Liu, Jingyi Zhang, Ya Dong, Xiao Yuan, Kunyuan Hu, Shiping Yang, Zhuozhuo Ai, Mingyou Li, Guangtong Song, and et al. 2026. "Comprehensive Analysis of Cyan Soft-Carapace and Red Hard-Carapace Color Variants in Procambarus clarkii: Muscle Quality, Carapace Pigmentation, and Tissue-Specific DGAT2 mRNA Expression" Fishes 11, no. 7: 393. https://doi.org/10.3390/fishes11070393
APA StyleXia, S., Liu, Y., Zhang, J., Dong, Y., Yuan, X., Hu, K., Yang, S., Ai, Z., Li, M., Song, G., Tian, H., Zhang, W., & Wang, A. (2026). Comprehensive Analysis of Cyan Soft-Carapace and Red Hard-Carapace Color Variants in Procambarus clarkii: Muscle Quality, Carapace Pigmentation, and Tissue-Specific DGAT2 mRNA Expression. Fishes, 11(7), 393. https://doi.org/10.3390/fishes11070393

